miRTarBase - #MIRT666324 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC16A10   
Synonyms MCT10, PRO0813, TAT1
Description solute carrier family 16 member 10
Transcript NM_018593   
Expression
Putative miRNA Targets on SLC16A10
3'UTR of SLC16A10
(miRNA target sites are highlighted)
>SLC16A10|NM_018593|3'UTR
   1 TATCTTACATACCTCCACCAGACTGGACTTGCTTTTTGAATTTTAAGCAAGTTTCCTTTCCTTTTATACAAATTGCAAAT
  81 TTCATATTTTTTTAATCACATCCTAGGAATAGCACAATAATTGGGAAATAGAACCCTTATCACTAGAAGAACCATTTTCT
 161 GCCACTAAATATCTCTGATGTTTCCATGAGTCTGAGGGCAGAGACTCTGGTATATGAAAACGTCTGAAAGTCACATATTG
 241 TGAAAATTTGAAGCTATCTCAGTAAAAAGCAGCTTTGGAAACTGTGAATGATCTTTAGCTTGTACAAATGTTTAAAAATA
 321 CCTCAGGCTATACTGAAAGGGTTGCAGTTTGGTTAGGAGTGGAAATATTTTGTTTGTTAATGATGTCTTCAGTTCTGGTA
 401 CCTCTGTTTTACTTTCTTATGCTCTTTGGAAACTTTTTGCAAAATTTAAGCCTGGGTTCTAGATAATACCAGATCTACCT
 481 AAACCTCAAGTCTATGTTAAAGTTGCTTTCCTGCTGTTAAATAAGCTATGATATTAAGATATTCTGACTTGCTCCAGTGT
 561 CAAGGGACCTTCTGGGAGCAGGTGCTAACATAGTGTTCAGAATCAATATGTGAGATGAAAAGGATCCCCTCCAGGAGGAT
 641 CCTGAGCTGTTCAGAAATCATTTAAGTTTACAGCGTTGTTCCCTTTGCGTTTGCAGTGCGTTTTACTCAAGTAGCCAGAA
 721 ACACCCCACGTTTCTGAATTTGTTTAAACTGTAACAATAAAGTAAAATAGAATGCATGAAAGATATTCTGGCGATTGTAA
 801 CTTAGAATTTTTCTGACTTCTGGATTTGTTGGCACTAGAACCTGATATTTAAAGTCTTACTGAGCAGCTATCAAGTGGCA
 881 GTTACAGGCACAAATTGGTGGAGGCTGGAGGATGGGGAGGGGAGCAAAACCCTTTATATTTGTGAAGAAAATATCTGTAG
 961 CTGATAGAAATAATTGCTTAAATTGGTTTATGAAATTAATGAGTCTGAAAAGGTTAAAAGCACTTATAAAAAGAACCAAG
1041 TCCTACATTTCCAGAACTTTCTGGCAAAAATTTGCACTCATATTATTTATCCTATGAACATTCCCATTGTTTTTTTTTGC
1121 TATTTATATACAGATTATCATAAGAAAGCTCTCAGTTTGAGGACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGU-AACAG------UGUGAGGu 5'
             |:|::| || ||      |||:||| 
Target 5' ctcATATTATTTATCCTATGAACATTCCc 3'
1077 - 1105 133.00 -9.40
2
miRNA  3' guUUGUGGUAACAG--UGUGAGGu 5'
            |: ||||  |||  |||:|:| 
Target 5' aaAGAACCA-AGTCCTACATTTCc 3'
1030 - 1052 125.00 -11.10
3
miRNA  3' guUUGU-GGUAACAGUGUGAGGu 5'
            |::| |||  |  |||| || 
Target 5' caAGTAGCCA--GAAACACCCCa 3'
708 - 728 116.00 -13.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30494625 3 COSMIC
COSN31567882 5 COSMIC
COSN26566742 39 COSMIC
COSN31519574 43 COSMIC
COSN30488462 56 COSMIC
COSN31525208 141 COSMIC
COSN31520697 154 COSMIC
COSN20103249 222 COSMIC
COSN19299081 281 COSMIC
COSN14764742 507 COSMIC
COSN23741907 675 COSMIC
COSN32057059 763 COSMIC
COSN20103255 854 COSMIC
COSN1323032 883 COSMIC
COSN9290642 977 COSMIC
COSN7593923 1035 COSMIC
COSN21689864 2012 COSMIC
COSN6720747 2358 COSMIC
COSN17639468 2965 COSMIC
COSN14710804 3047 COSMIC
COSN17007109 3145 COSMIC
COSN26828476 3295 COSMIC
COSN16203127 4290 COSMIC
COSN32196787 4364 COSMIC
COSN21876784 4398 COSMIC
COSN7593924 4442 COSMIC
COSN6720748 4478 COSMIC
COSN9963938 4727 COSMIC
COSN29606400 4908 COSMIC
COSN15350938 5181 COSMIC
COSN14741057 5376 COSMIC
COSN14866956 5496 COSMIC
COSN15104713 5619 COSMIC
COSN14766556 5725 COSMIC
COSN9963939 6143 COSMIC
COSN23743855 7019 COSMIC
COSN26106565 7793 COSMIC
COSN21390155 8687 COSMIC
rs14399 507 GWAS
rs354532 5376 GWAS
rs12711901 x rs22979 5725 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1223876160 4 dbSNP
rs1170737119 7 dbSNP
rs1390493748 9 dbSNP
rs745915537 10 dbSNP
rs758421636 11 dbSNP
rs773480871 11 dbSNP
rs1306023140 12 dbSNP
rs780544018 14 dbSNP
rs373930541 17 dbSNP
rs769212196 26 dbSNP
rs548609643 33 dbSNP
rs771541349 37 dbSNP
rs1297888144 52 dbSNP
rs777924730 58 dbSNP
rs971715982 62 dbSNP
rs1184717590 63 dbSNP
rs118149501 76 dbSNP
rs1461309047 86 dbSNP
rs1160037937 87 dbSNP
rs574413193 89 dbSNP
rs1402640889 93 dbSNP
rs527604049 94 dbSNP
rs1351882068 96 dbSNP
rs547351690 103 dbSNP
rs1162732358 104 dbSNP
rs986280087 116 dbSNP
rs1458446930 118 dbSNP
rs1297712982 130 dbSNP
rs1371027432 133 dbSNP
rs910408061 136 dbSNP
rs189096229 141 dbSNP
rs1318350404 146 dbSNP
rs1288987892 148 dbSNP
rs1244532428 165 dbSNP
rs1354570317 166 dbSNP
rs1231280358 168 dbSNP
rs1053716093 169 dbSNP
rs1360804035 170 dbSNP
rs1294713774 176 dbSNP
rs768653107 192 dbSNP
rs1321985376 201 dbSNP
rs1203153678 208 dbSNP
rs1017463131 210 dbSNP
rs368582525 212 dbSNP
rs201576847 220 dbSNP
rs148728349 221 dbSNP
rs34198423 222 dbSNP
rs201153583 223 dbSNP
rs34214262 223 dbSNP
rs199803669 225 dbSNP
rs994794457 261 dbSNP
rs1289789626 274 dbSNP
rs1433238302 276 dbSNP
rs945362560 281 dbSNP
rs1322989829 289 dbSNP
rs1027729467 291 dbSNP
rs906520951 305 dbSNP
rs1447547430 306 dbSNP
rs10457235 308 dbSNP
rs1418607171 311 dbSNP
rs950837147 320 dbSNP
rs1486649117 326 dbSNP
rs1244549411 331 dbSNP
rs1055602296 336 dbSNP
rs780105513 341 dbSNP
rs888645552 345 dbSNP
rs1005649516 351 dbSNP
rs983901215 355 dbSNP
rs961571693 358 dbSNP
rs928171589 359 dbSNP
rs1365763356 364 dbSNP
rs1282839772 366 dbSNP
rs1405756780 369 dbSNP
rs1367571795 380 dbSNP
rs1416178304 388 dbSNP
rs1427803061 392 dbSNP
rs1353794852 398 dbSNP
rs998834870 400 dbSNP
rs1170879723 410 dbSNP
rs1430037682 421 dbSNP
rs1422644842 422 dbSNP
rs73532731 423 dbSNP
rs991097319 428 dbSNP
rs570430180 433 dbSNP
rs1270499134 434 dbSNP
rs1202394841 437 dbSNP
rs1352841674 441 dbSNP
rs569415934 444 dbSNP
rs948405533 448 dbSNP
rs978434417 456 dbSNP
rs925572734 460 dbSNP
rs1308540004 464 dbSNP
rs1374816444 468 dbSNP
rs910274138 471 dbSNP
rs989274011 479 dbSNP
rs375920655 481 dbSNP
rs1431986084 486 dbSNP
rs945348597 488 dbSNP
rs982435667 493 dbSNP
rs1463438057 497 dbSNP
rs1357258945 506 dbSNP
rs14399 507 dbSNP
rs1213635822 508 dbSNP
rs1470051258 515 dbSNP
rs1430902508 526 dbSNP
rs1179399161 530 dbSNP
rs1417960779 531 dbSNP
rs575137169 533 dbSNP
rs1053254200 553 dbSNP
rs1308731700 555 dbSNP
rs1482559885 559 dbSNP
rs879557531 562 dbSNP
rs774608741 575 dbSNP
rs1262972605 576 dbSNP
rs1204642922 577 dbSNP
rs944521189 583 dbSNP
rs1266426522 588 dbSNP
rs1238444863 591 dbSNP
rs1275928712 592 dbSNP
rs937998951 595 dbSNP
rs1055231409 596 dbSNP
rs888510290 599 dbSNP
rs1038967632 600 dbSNP
rs759643113 603 dbSNP
rs1209114804 604 dbSNP
rs1239592225 607 dbSNP
rs897324551 608 dbSNP
rs1363943792 618 dbSNP
rs1160636812 620 dbSNP
rs1422595255 621 dbSNP
rs998469341 647 dbSNP
rs1184624266 654 dbSNP
rs900420035 660 dbSNP
rs994679401 662 dbSNP
rs1186135149 665 dbSNP
rs1351672388 666 dbSNP
rs1017368667 667 dbSNP
rs1451376494 671 dbSNP
rs879037989 675 dbSNP
rs886415416 676 dbSNP
rs1246469260 679 dbSNP
rs1384785645 689 dbSNP
rs554958982 690 dbSNP
rs1381359648 692 dbSNP
rs1385152965 698 dbSNP
rs1394355512 700 dbSNP
rs1004980875 701 dbSNP
rs1385179561 706 dbSNP
rs1164824364 709 dbSNP
rs966928882 711 dbSNP
rs1035500577 723 dbSNP
rs372870606 730 dbSNP
rs1177889363 731 dbSNP
rs927844334 748 dbSNP
rs1359524571 750 dbSNP
rs1429836174 754 dbSNP
rs1490193575 758 dbSNP
rs990981342 759 dbSNP
rs1286731394 769 dbSNP
rs534538314 783 dbSNP
rs1223188896 785 dbSNP
rs1366962557 789 dbSNP
rs968294094 793 dbSNP
rs938046238 794 dbSNP
rs1302091432 799 dbSNP
rs767557072 813 dbSNP
rs979658585 821 dbSNP
rs1347721068 829 dbSNP
rs990744903 837 dbSNP
rs925655839 838 dbSNP
rs1364450985 843 dbSNP
rs10680262 851 dbSNP
rs151328273 851 dbSNP
rs66698226 852 dbSNP
rs909876267 856 dbSNP
rs1042774182 857 dbSNP
rs1394899445 867 dbSNP
rs934309304 871 dbSNP
rs554156913 872 dbSNP
rs577410209 882 dbSNP
rs549883858 894 dbSNP
rs1038851304 899 dbSNP
rs1480215585 912 dbSNP
rs546081108 918 dbSNP
rs930579250 937 dbSNP
rs1037057680 962 dbSNP
rs1215573725 964 dbSNP
rs369772234 978 dbSNP
rs897356661 982 dbSNP
rs1195028809 983 dbSNP
rs1240534239 999 dbSNP
rs1252817197 1003 dbSNP
rs1221375339 1051 dbSNP
rs934123096 1061 dbSNP
rs563028141 1075 dbSNP
rs752823297 1077 dbSNP
rs1334546302 1079 dbSNP
rs889996289 1080 dbSNP
rs1410998236 1083 dbSNP
rs1399131203 1086 dbSNP
rs1174725607 1087 dbSNP
rs576623631 1095 dbSNP
rs1007234888 1109 dbSNP
rs1017316715 1110 dbSNP
rs1232348313 1110 dbSNP
rs564071667 1110 dbSNP
rs71838611 1110 dbSNP
rs761026856 1112 dbSNP
rs542313521 1117 dbSNP
rs1174230986 1119 dbSNP
rs562091452 1119 dbSNP
rs1425844226 1120 dbSNP
rs1399861578 1121 dbSNP
rs886468824 1122 dbSNP
rs1156701192 1123 dbSNP
rs1201481683 1124 dbSNP
rs1322413133 1126 dbSNP
rs1390323191 1127 dbSNP
rs764718177 1129 dbSNP
rs1224844595 1132 dbSNP
rs527670290 1135 dbSNP
rs140163540 1146 dbSNP
rs536845091 1153 dbSNP
rs1368141629 1157 dbSNP
rs896553219 1158 dbSNP
rs1277090818 1164 dbSNP
rs966585058 1165 dbSNP
rs1407140560 1166 dbSNP
rs982331374 1178 dbSNP
rs1399141634 1184 dbSNP
rs1012300870 1195 dbSNP
rs1023830084 1197 dbSNP
rs968181240 1198 dbSNP
rs979711013 1202 dbSNP
rs754214014 1207 dbSNP
rs757735793 1209 dbSNP
rs1331409786 1211 dbSNP
rs1209595957 1214 dbSNP
rs376199619 1217 dbSNP
rs1272853772 1222 dbSNP
rs959582953 1226 dbSNP
rs564221102 1231 dbSNP
rs1444918944 1235 dbSNP
rs990692612 1253 dbSNP
rs533207936 1261 dbSNP
rs909907429 1265 dbSNP
rs962671826 1275 dbSNP
rs142468159 1276 dbSNP
rs750110238 1296 dbSNP
rs115741123 1300 dbSNP
rs1247169125 1321 dbSNP
rs73532733 1322 dbSNP
rs1428950491 1323 dbSNP
rs548648838 1326 dbSNP
rs758075959 1327 dbSNP
rs1402487795 1328 dbSNP
rs565374327 1346 dbSNP
rs911387063 1350 dbSNP
rs974440504 1351 dbSNP
rs1472833155 1353 dbSNP
rs534317361 1358 dbSNP
rs1443899150 1368 dbSNP
rs1385705575 1369 dbSNP
rs1183366889 1370 dbSNP
rs1474224511 1372 dbSNP
rs942972758 1377 dbSNP
rs1215909128 1378 dbSNP
rs921780176 1386 dbSNP
rs192812936 1388 dbSNP
rs1222482855 1399 dbSNP
rs12213673 1402 dbSNP
rs1315284822 1404 dbSNP
rs1010549487 1405 dbSNP
rs1406562767 1405 dbSNP
rs1323672612 1413 dbSNP
rs1433132545 1414 dbSNP
rs1042181378 1423 dbSNP
rs902224201 1432 dbSNP
rs1003284356 1434 dbSNP
rs191632 1445 dbSNP
rs1166690892 1456 dbSNP
rs1407953610 1465 dbSNP
rs940732889 1470 dbSNP
rs1056873313 1478 dbSNP
rs1186782288 1480 dbSNP
rs1478593689 1485 dbSNP
rs1266216487 1489 dbSNP
rs959215883 1495 dbSNP
rs1197992218 1496 dbSNP
rs1490656679 1497 dbSNP
rs768440949 1501 dbSNP
rs1267716952 1502 dbSNP
rs1012146159 1535 dbSNP
rs1012351712 1537 dbSNP
rs1307338095 1541 dbSNP
rs1274118320 1543 dbSNP
rs1442127904 1544 dbSNP
rs1016776907 1553 dbSNP
rs962702329 1565 dbSNP
rs1045162668 1580 dbSNP
rs904046296 1585 dbSNP
rs1346095737 1588 dbSNP
rs1287081094 1593 dbSNP
rs1295271157 1594 dbSNP
rs1001032603 1599 dbSNP
rs115721980 1603 dbSNP
rs1229445984 1604 dbSNP
rs918687887 1610 dbSNP
rs957186664 1612 dbSNP
rs1175130395 1615 dbSNP
rs1354540834 1616 dbSNP
rs1268818534 1620 dbSNP
rs868412578 1626 dbSNP
rs1480590301 1632 dbSNP
rs1008439919 1635 dbSNP
rs1290697170 1642 dbSNP
rs1321676972 1644 dbSNP
rs1262691817 1646 dbSNP
rs1019044515 1653 dbSNP
rs1314061763 1662 dbSNP
rs942834134 1673 dbSNP
rs965653582 1677 dbSNP
rs1389657520 1679 dbSNP
rs1054726938 1690 dbSNP
rs1437092925 1691 dbSNP
rs576686542 1700 dbSNP
rs1403472793 1709 dbSNP
rs1448665909 1709 dbSNP
rs914806095 1709 dbSNP
rs1469971089 1713 dbSNP
rs921665754 1726 dbSNP
rs1156298442 1732 dbSNP
rs951918617 1733 dbSNP
rs1419017710 1737 dbSNP
rs1409272065 1741 dbSNP
rs1281787146 1743 dbSNP
rs946369701 1760 dbSNP
rs985020103 1761 dbSNP
rs1242886046 1763 dbSNP
rs907664669 1765 dbSNP
rs1186999666 1774 dbSNP
rs1318314197 1777 dbSNP
rs1204622698 1779 dbSNP
rs542376688 1781 dbSNP
rs751961623 1782 dbSNP
rs555887787 1784 dbSNP
rs1238333923 1785 dbSNP
rs1216293016 1786 dbSNP
rs572449493 1787 dbSNP
rs1316299560 1792 dbSNP
rs1262221217 1793 dbSNP
rs1459946895 1794 dbSNP
rs781151457 1797 dbSNP
rs1185270701 1798 dbSNP
rs1243667512 1803 dbSNP
rs1469754851 1804 dbSNP
rs1242202164 1812 dbSNP
rs1175526200 1818 dbSNP
rs1410503615 1825 dbSNP
rs183110798 1830 dbSNP
rs1335839044 1842 dbSNP
rs917953276 1846 dbSNP
rs1396308780 1863 dbSNP
rs1163269334 1880 dbSNP
rs1401456196 1887 dbSNP
rs1418166417 1888 dbSNP
rs187045144 1893 dbSNP
rs769630523 1909 dbSNP
rs1452384202 1914 dbSNP
rs1360577401 1919 dbSNP
rs1161014600 1925 dbSNP
rs796359199 1931 dbSNP
rs141040439 1932 dbSNP
rs67241534 1932 dbSNP
rs62420362 1933 dbSNP
rs746494419 1933 dbSNP
rs1410776270 1940 dbSNP
rs1045213739 1964 dbSNP
rs1385065878 1987 dbSNP
rs1056203081 1999 dbSNP
rs62420363 2000 dbSNP
rs563172649 2009 dbSNP
rs1259864101 2010 dbSNP
rs369384508 2012 dbSNP
rs76811591 2019 dbSNP
rs1053035772 2024 dbSNP
rs1204651129 2030 dbSNP
rs1338861653 2035 dbSNP
rs1486265152 2040 dbSNP
rs892610830 2046 dbSNP
rs1218795147 2063 dbSNP
rs1008908635 2065 dbSNP
rs1247264193 2085 dbSNP
rs529040404 2091 dbSNP
rs354551 2103 dbSNP
rs1341928836 2107 dbSNP
rs965706393 2114 dbSNP
rs1293054973 2116 dbSNP
rs1338809091 2118 dbSNP
rs34925544 2120 dbSNP
rs565436467 2124 dbSNP
rs1340667325 2131 dbSNP
rs995794293 2146 dbSNP
rs79950357 2150 dbSNP
rs1164227503 2152 dbSNP
rs962568373 2158 dbSNP
rs951804198 2171 dbSNP
rs1371680620 2175 dbSNP
rs1192802045 2187 dbSNP
rs994037963 2192 dbSNP
rs772349635 2196 dbSNP
rs984515523 2220 dbSNP
rs1197292919 2222 dbSNP
rs576797853 2223 dbSNP
rs551104046 2245 dbSNP
rs1489840842 2246 dbSNP
rs1209814022 2248 dbSNP
rs1210237342 2251 dbSNP
rs1225807494 2264 dbSNP
rs1358249968 2278 dbSNP
rs1015186762 2284 dbSNP
rs544227227 2290 dbSNP
rs955385002 2292 dbSNP
rs987319921 2293 dbSNP
rs1345456941 2294 dbSNP
rs1324834839 2301 dbSNP
rs1018332399 2302 dbSNP
rs964226927 2330 dbSNP
rs370159665 2350 dbSNP
rs760839034 2354 dbSNP
rs1466353062 2356 dbSNP
rs1425967112 2360 dbSNP
rs1174409149 2365 dbSNP
rs571192995 2368 dbSNP
rs948071051 2369 dbSNP
rs980776310 2374 dbSNP
rs1392513340 2383 dbSNP
rs1430965052 2399 dbSNP
rs765668927 2399 dbSNP
rs977702077 2401 dbSNP
rs925235670 2403 dbSNP
rs923638450 2411 dbSNP
rs936769113 2413 dbSNP
rs938998472 2414 dbSNP
rs1056620497 2415 dbSNP
rs1274927585 2418 dbSNP
rs1322270232 2418 dbSNP
rs1236152121 2419 dbSNP
rs1334450482 2440 dbSNP
rs569461949 2442 dbSNP
rs539770757 2444 dbSNP
rs532128536 2458 dbSNP
rs1335030971 2470 dbSNP
rs1469476334 2479 dbSNP
rs1335077151 2504 dbSNP
rs892655243 2519 dbSNP
rs1174331044 2525 dbSNP
rs1326105639 2530 dbSNP
rs1478970705 2538 dbSNP
rs1361950094 2543 dbSNP
rs898316030 2545 dbSNP
rs944200993 2548 dbSNP
rs1239737360 2553 dbSNP
rs1458082827 2553 dbSNP
rs994530863 2554 dbSNP
rs1278733530 2564 dbSNP
rs1041318892 2580 dbSNP
rs900085040 2583 dbSNP
rs1025551864 2588 dbSNP
rs556879440 2592 dbSNP
rs370243458 2626 dbSNP
rs1008188042 2647 dbSNP
rs1241479904 2657 dbSNP
rs533598005 2659 dbSNP
rs1233472802 2662 dbSNP
rs1254242706 2666 dbSNP
rs762263916 2672 dbSNP
rs536051895 2680 dbSNP
rs1336275402 2682 dbSNP
rs1398970709 2687 dbSNP
rs1384315050 2688 dbSNP
rs1260555729 2718 dbSNP
rs1014659908 2721 dbSNP
rs555950888 2722 dbSNP
rs572458747 2725 dbSNP
rs541482464 2726 dbSNP
rs1024780927 2727 dbSNP
rs1472266059 2735 dbSNP
rs939034474 2743 dbSNP
rs1211648184 2747 dbSNP
rs991810063 2748 dbSNP
rs72939587 2749 dbSNP
rs1204201341 2756 dbSNP
rs1218057357 2757 dbSNP
rs980661627 2758 dbSNP
rs1290049379 2759 dbSNP
rs947831210 2777 dbSNP
rs925286442 2784 dbSNP
rs757940921 2786 dbSNP
rs766090575 2787 dbSNP
rs1325997782 2799 dbSNP
rs1298872735 2801 dbSNP
rs988654375 2806 dbSNP
rs1173552369 2808 dbSNP
rs1388111274 2809 dbSNP
rs1161481819 2826 dbSNP
rs913984704 2829 dbSNP
rs944236295 2838 dbSNP
rs1455848180 2855 dbSNP
rs1322884082 2861 dbSNP
rs191701287 2864 dbSNP
rs898368356 2867 dbSNP
rs117711648 2870 dbSNP
rs1047424048 2886 dbSNP
rs1267324677 2893 dbSNP
rs372977839 2893 dbSNP
rs1221442853 2902 dbSNP
rs374253355 2903 dbSNP
rs1018313677 2912 dbSNP
rs184335832 2918 dbSNP
rs1011704218 2919 dbSNP
rs1233636745 2930 dbSNP
rs1259935559 2932 dbSNP
rs1021686414 2935 dbSNP
rs1210205087 2940 dbSNP
rs567141849 2949 dbSNP
rs1350325089 2955 dbSNP
rs563235411 2959 dbSNP
rs1166575455 2961 dbSNP
rs887467301 2963 dbSNP
rs1422415348 2974 dbSNP
rs1170791982 2989 dbSNP
rs1478544588 2999 dbSNP
rs1266111415 3001 dbSNP
rs73532736 3009 dbSNP
rs1489084681 3010 dbSNP
rs1036367318 3017 dbSNP
rs777887577 3020 dbSNP
rs1457509358 3037 dbSNP
rs1258899189 3038 dbSNP
rs1207592165 3040 dbSNP
rs1265827985 3046 dbSNP
rs354550 3047 dbSNP
rs1218637419 3049 dbSNP
rs1199946220 3056 dbSNP
rs559463025 3058 dbSNP
rs1439685309 3059 dbSNP
rs1411686450 3068 dbSNP
rs528194022 3069 dbSNP
rs551433667 3079 dbSNP
rs916287231 3081 dbSNP
rs1426665763 3082 dbSNP
rs1024833248 3083 dbSNP
rs354549 3086 dbSNP
rs1392715584 3087 dbSNP
rs530516943 3092 dbSNP
rs973799675 3095 dbSNP
rs1002150581 3096 dbSNP
rs550541633 3102 dbSNP
rs1239141644 3114 dbSNP
rs1175385088 3118 dbSNP
rs570366550 3119 dbSNP
rs140741032 3120 dbSNP
rs1312719837 3122 dbSNP
rs1303378391 3132 dbSNP
rs912369202 3136 dbSNP
rs1237831719 3137 dbSNP
rs913856237 3138 dbSNP
rs149691990 3139 dbSNP
rs354548 3145 dbSNP
rs534836138 3146 dbSNP
rs932804480 3161 dbSNP
rs1048668398 3182 dbSNP
rs370582406 3183 dbSNP
rs903240450 3184 dbSNP
rs558218796 3187 dbSNP
rs1210946486 3188 dbSNP
rs750540742 3191 dbSNP
rs1036032033 3196 dbSNP
rs897462427 3202 dbSNP
rs1259034561 3206 dbSNP
rs1214432147 3211 dbSNP
rs1352818643 3215 dbSNP
rs147785558 3220 dbSNP
rs749127772 3225 dbSNP
rs960482196 3228 dbSNP
rs1380798474 3230 dbSNP
rs1295799983 3232 dbSNP
rs905049580 3233 dbSNP
rs207467362 3244 dbSNP
rs1023138212 3248 dbSNP
rs1160843685 3252 dbSNP
rs1002034634 3260 dbSNP
rs550068539 3262 dbSNP
rs1375098730 3263 dbSNP
rs973685040 3264 dbSNP
rs919689122 3267 dbSNP
rs957986214 3272 dbSNP
rs951188951 3273 dbSNP
rs1487941104 3275 dbSNP
rs1263751348 3279 dbSNP
rs1423471457 3279 dbSNP
rs1162685856 3281 dbSNP
rs1218678607 3287 dbSNP
rs1354044601 3291 dbSNP
rs1370261695 3295 dbSNP
rs1458526176 3298 dbSNP
rs982917990 3302 dbSNP
rs1275766853 3303 dbSNP
rs1398792619 3307 dbSNP
rs557673834 3309 dbSNP
rs1340569485 3310 dbSNP
rs1411385638 3311 dbSNP
rs1272399671 3314 dbSNP
rs1170092357 3315 dbSNP
rs1195848037 3315 dbSNP
rs1425832008 3315 dbSNP
rs1478217956 3315 dbSNP
rs375004298 3315 dbSNP
rs386408251 3315 dbSNP
rs55999105 3315 dbSNP
rs76921389 3315 dbSNP
rs1308425735 3316 dbSNP
rs1377906281 3317 dbSNP
rs1009856932 3329 dbSNP
rs1449785089 3329 dbSNP
rs1266427476 3331 dbSNP
rs1210148904 3332 dbSNP
rs1491210311 3332 dbSNP
rs1491232430 3333 dbSNP
rs943837058 3333 dbSNP
rs76822159 3334 dbSNP
rs987314331 3334 dbSNP
rs1020971525 3336 dbSNP
rs1226115074 3340 dbSNP
rs1039646939 3346 dbSNP
rs1274505585 3347 dbSNP
rs1231725783 3350 dbSNP
rs921160714 3361 dbSNP
rs535192166 3372 dbSNP
rs976830650 3373 dbSNP
rs921346964 3383 dbSNP
rs1483164727 3386 dbSNP
rs868677621 3390 dbSNP
rs903164655 3393 dbSNP
rs17606672 3396 dbSNP
rs189128915 3398 dbSNP
rs1402624683 3404 dbSNP
rs910002069 3406 dbSNP
rs940304312 3407 dbSNP
rs1170839035 3418 dbSNP
rs1477003998 3418 dbSNP
rs1376961706 3420 dbSNP
rs117461063 3422 dbSNP
rs544439525 3426 dbSNP
rs949014046 3430 dbSNP
rs1215964 3432 dbSNP
rs1169217363 3433 dbSNP
rs768915380 3440 dbSNP
rs1198189418 3445 dbSNP
rs533614211 3449 dbSNP
rs552093253 3455 dbSNP
rs1304194159 3456 dbSNP
rs899394587 3459 dbSNP
rs1375233048 3469 dbSNP
rs1385755786 3484 dbSNP
rs1447817124 3486 dbSNP
rs995035952 3492 dbSNP
rs1332312448 3496 dbSNP
rs866082724 3500 dbSNP
rs75322169 3501 dbSNP
rs1053627101 3506 dbSNP
rs1378265199 3507 dbSNP
rs1177706385 3509 dbSNP
rs893605114 3510 dbSNP
rs965228396 3512 dbSNP
rs1184933592 3513 dbSNP
rs1441379770 3517 dbSNP
rs1278708620 3518 dbSNP
rs372721040 3521 dbSNP
rs1352077984 3525 dbSNP
rs975216768 3530 dbSNP
rs1241281031 3531 dbSNP
rs1379428019 3539 dbSNP
rs921087164 3539 dbSNP
rs947311070 3549 dbSNP
rs539221915 3559 dbSNP
rs528070348 3563 dbSNP
rs1021275354 3566 dbSNP
rs978673291 3574 dbSNP
rs1208512869 3586 dbSNP
rs192725296 3587 dbSNP
rs1358502008 3592 dbSNP
rs369510985 3604 dbSNP
rs1483713705 3605 dbSNP
rs141239638 3607 dbSNP
rs1409851806 3608 dbSNP
rs1187932656 3617 dbSNP
rs1472253506 3619 dbSNP
rs1237567517 3630 dbSNP
rs1189371830 3632 dbSNP
rs954131912 3633 dbSNP
rs1451472895 3634 dbSNP
rs1189114835 3638 dbSNP
rs776856316 3639 dbSNP
rs1412505055 3640 dbSNP
rs768396566 3640 dbSNP
rs1177998311 3649 dbSNP
rs1359323756 3657 dbSNP
rs984588331 3661 dbSNP
rs1057220363 3670 dbSNP
rs1017117432 3677 dbSNP
rs895864471 3681 dbSNP
rs1318207913 3682 dbSNP
rs1339907088 3688 dbSNP
rs1297549986 3689 dbSNP
rs1400532788 3690 dbSNP
rs948901244 3691 dbSNP
rs961831735 3701 dbSNP
rs1435244261 3712 dbSNP
rs1271253991 3723 dbSNP
rs973032210 3727 dbSNP
rs1422277911 3728 dbSNP
rs917501303 3729 dbSNP
rs1487101984 3732 dbSNP
rs1367553297 3738 dbSNP
rs1221243843 3739 dbSNP
rs1449555520 3751 dbSNP
rs1452428116 3760 dbSNP
rs777576594 3761 dbSNP
rs949066168 3765 dbSNP
rs981780490 3771 dbSNP
rs1317445061 3776 dbSNP
rs899319387 3778 dbSNP
rs1217784757 3788 dbSNP
rs762353700 3793 dbSNP
rs995087021 3796 dbSNP
rs1303880245 3803 dbSNP
rs937759446 3804 dbSNP
rs1208332520 3808 dbSNP
rs12660339 3813 dbSNP
rs1398934801 3815 dbSNP
rs1170688363 3824 dbSNP
rs1026951462 3826 dbSNP
rs1053916893 3839 dbSNP
rs1466286983 3854 dbSNP
rs535545075 3867 dbSNP
rs1004264359 3873 dbSNP
rs1019375594 3874 dbSNP
rs550453419 3875 dbSNP
rs1197049176 3887 dbSNP
rs569027560 3889 dbSNP
rs1042344157 3895 dbSNP
rs1206670218 3903 dbSNP
rs539284980 3907 dbSNP
rs968532213 3909 dbSNP
rs1156473358 3911 dbSNP
rs1390432592 3913 dbSNP
rs1457271447 3920 dbSNP
rs901107409 3921 dbSNP
rs978708834 3932 dbSNP
rs1218546636 3939 dbSNP
rs1322331477 3943 dbSNP
rs1371527518 3943 dbSNP
rs1375641079 3943 dbSNP
rs201961181 3944 dbSNP
rs934696693 3948 dbSNP
rs1349750323 3954 dbSNP
rs1176060412 3957 dbSNP
rs549845261 3973 dbSNP
rs993207556 3979 dbSNP
rs917232574 3987 dbSNP
rs1028298908 3988 dbSNP
rs889756381 3997 dbSNP
rs765869731 4001 dbSNP
rs1224122493 4003 dbSNP
rs1005665157 4008 dbSNP
rs773410940 4009 dbSNP
rs1482342877 4022 dbSNP
rs1255471638 4029 dbSNP
rs371489678 4041 dbSNP
rs557612174 4042 dbSNP
rs1228208639 4043 dbSNP
rs746615247 4046 dbSNP
rs1348416734 4047 dbSNP
rs1282236279 4048 dbSNP
rs961604604 4049 dbSNP
rs1286643161 4052 dbSNP
rs375805547 4057 dbSNP
rs1224356945 4058 dbSNP
rs1267416725 4060 dbSNP
rs1024444795 4065 dbSNP
rs1392768005 4069 dbSNP
rs1047996406 4073 dbSNP
rs1301691631 4078 dbSNP
rs886662679 4083 dbSNP
rs971640121 4090 dbSNP
rs765928458 4097 dbSNP
rs1450005356 4100 dbSNP
rs1009140533 4107 dbSNP
rs1161643929 4118 dbSNP
rs1422221335 4126 dbSNP
rs1041132994 4138 dbSNP
rs926288792 4148 dbSNP
rs572826134 4161 dbSNP
rs937658841 4168 dbSNP
rs1485969514 4171 dbSNP
rs1223652122 4173 dbSNP
rs900837917 4175 dbSNP
rs989285962 4178 dbSNP
rs1261081008 4182 dbSNP
rs1240762044 4185 dbSNP
rs185370776 4186 dbSNP
rs1028041785 4202 dbSNP
rs1233315889 4204 dbSNP
rs945113767 4205 dbSNP
rs1179786082 4225 dbSNP
rs1042618726 4226 dbSNP
rs900990928 4242 dbSNP
rs1000413488 4245 dbSNP
rs1399931188 4256 dbSNP
rs557549008 4264 dbSNP
rs1290929683 4265 dbSNP
rs1456609626 4266 dbSNP
rs555743082 4267 dbSNP
rs1410976008 4271 dbSNP
rs933923546 4271 dbSNP
rs1165894615 4273 dbSNP
rs1476250067 4279 dbSNP
rs1326835813 4291 dbSNP
rs1406651173 4292 dbSNP
rs1191492354 4297 dbSNP
rs574004725 4318 dbSNP
rs1487888987 4320 dbSNP
rs573016297 4342 dbSNP
rs1049620796 4343 dbSNP
rs1206635330 4352 dbSNP
rs1487314855 4353 dbSNP
rs190716456 4356 dbSNP
rs751288029 4362 dbSNP
rs181405880 4378 dbSNP
rs185795815 4383 dbSNP
rs766942812 4393 dbSNP
rs146974840 4396 dbSNP
rs560737813 4400 dbSNP
rs1218565022 4407 dbSNP
rs1038486940 4411 dbSNP
rs1298212938 4418 dbSNP
rs561930535 4423 dbSNP
rs1390424321 4431 dbSNP
rs369368593 4440 dbSNP
rs1326908599 4442 dbSNP
rs994224631 4443 dbSNP
rs138135374 4450 dbSNP
rs1398217599 4486 dbSNP
rs1169977023 4488 dbSNP
rs1024495386 4491 dbSNP
rs971525374 4499 dbSNP
rs930841974 4500 dbSNP
rs1195214375 4505 dbSNP
rs1292355953 4506 dbSNP
rs776054166 4519 dbSNP
rs1001813797 4520 dbSNP
rs561724585 4526 dbSNP
rs189056446 4527 dbSNP
rs959105562 4530 dbSNP
rs1197400777 4534 dbSNP
rs1339447342 4540 dbSNP
rs1253712807 4544 dbSNP
rs550637900 4545 dbSNP
rs1186375233 4552 dbSNP
rs181199634 4559 dbSNP
rs914876212 4561 dbSNP
rs1473471826 4569 dbSNP
rs1163359660 4570 dbSNP
rs1443385334 4580 dbSNP
rs1386344802 4586 dbSNP
rs1330793746 4587 dbSNP
rs1429684832 4593 dbSNP
rs1410654127 4605 dbSNP
rs1167339091 4607 dbSNP
rs1398690794 4626 dbSNP
rs191631 4628 dbSNP
rs1394270406 4633 dbSNP
rs977782883 4635 dbSNP
rs1455321368 4646 dbSNP
rs1236029178 4652 dbSNP
rs1333713425 4655 dbSNP
rs922469623 4663 dbSNP
rs933808712 4665 dbSNP
rs1252031112 4668 dbSNP
rs1049671792 4669 dbSNP
rs996475005 4670 dbSNP
rs1049523095 4696 dbSNP
rs1236890760 4697 dbSNP
rs904244060 4701 dbSNP
rs911121461 4702 dbSNP
rs1308857957 4703 dbSNP
rs1443201960 4715 dbSNP
rs1450238020 4724 dbSNP
rs1332215603 4728 dbSNP
rs999934068 4734 dbSNP
rs941253446 4743 dbSNP
rs1038778614 4751 dbSNP
rs551179049 4752 dbSNP
rs1174157972 4753 dbSNP
rs566390418 4756 dbSNP
rs770319690 4761 dbSNP
rs1470638640 4764 dbSNP
rs1157692734 4767 dbSNP
rs1198899688 4772 dbSNP
rs1470274514 4778 dbSNP
rs1184728447 4784 dbSNP
rs1485644589 4793 dbSNP
rs1258887698 4794 dbSNP
rs1213608915 4795 dbSNP
rs1487552354 4796 dbSNP
rs1285741309 4812 dbSNP
rs1339794428 4816 dbSNP
rs1224559019 4824 dbSNP
rs1045834090 4826 dbSNP
rs533840940 4831 dbSNP
rs1244213247 4839 dbSNP
rs1356133090 4858 dbSNP
rs149106557 4866 dbSNP
rs1416528820 4867 dbSNP
rs1358404643 4868 dbSNP
rs143204948 4870 dbSNP
rs1183599278 4883 dbSNP
rs148297180 4886 dbSNP
rs1474618534 4888 dbSNP
rs1447202273 4892 dbSNP
rs775910152 4893 dbSNP
rs980045920 4895 dbSNP
rs1241901676 4899 dbSNP
rs143428434 4899 dbSNP
rs1449073627 4902 dbSNP
rs1288037173 4903 dbSNP
rs952254120 4908 dbSNP
rs556598853 4909 dbSNP
rs1295139872 4910 dbSNP
rs1022391981 4912 dbSNP
rs1235064707 4917 dbSNP
rs1338283250 4918 dbSNP
rs1269401275 4920 dbSNP
rs966390142 4922 dbSNP
rs1431266675 4923 dbSNP
rs1346713869 4924 dbSNP
rs977835243 4925 dbSNP
rs922355100 4929 dbSNP
rs186734593 4932 dbSNP
rs1166391101 4934 dbSNP
rs1464537010 4948 dbSNP
rs545582918 4952 dbSNP
rs1187595703 4966 dbSNP
rs763345112 4968 dbSNP
rs1040651627 4979 dbSNP
rs1193250076 4983 dbSNP
rs911017797 4986 dbSNP
rs554414095 4987 dbSNP
rs1275152496 4988 dbSNP
rs1150076 4993 dbSNP
rs1326980559 4994 dbSNP
rs1272263160 4998 dbSNP
rs1215073428 5002 dbSNP
rs747161835 5003 dbSNP
rs1363891576 5008 dbSNP
rs774873899 5010 dbSNP
rs1049450067 5011 dbSNP
rs918609573 5012 dbSNP
rs1371210297 5017 dbSNP
rs1327472170 5021 dbSNP
rs929940960 5027 dbSNP
rs1353405685 5029 dbSNP
rs1171816501 5036 dbSNP
rs1412070835 5039 dbSNP
rs762067406 5053 dbSNP
rs1045886397 5054 dbSNP
rs1346947240 5068 dbSNP
rs935787823 5087 dbSNP
rs767853268 5093 dbSNP
rs937371631 5098 dbSNP
rs1176977890 5099 dbSNP
rs1463134234 5100 dbSNP
rs1210084454 5101 dbSNP
rs891629364 5107 dbSNP
rs1309122521 5112 dbSNP
rs1014067020 5121 dbSNP
rs1056387592 5123 dbSNP
rs1348302192 5124 dbSNP
rs1305256142 5128 dbSNP
rs543299875 5142 dbSNP
rs1012271572 5143 dbSNP
rs1298195966 5147 dbSNP
rs561462423 5150 dbSNP
rs868406509 5151 dbSNP
rs528862790 5177 dbSNP
rs562998320 5181 dbSNP
rs1435782734 5183 dbSNP
rs1397255384 5185 dbSNP
rs1157153642 5197 dbSNP
rs1027651159 5202 dbSNP
rs952072711 5206 dbSNP
rs141439143 5207 dbSNP
rs1178971358 5220 dbSNP
rs1481591597 5222 dbSNP
rs1255383757 5224 dbSNP
rs1481656914 5234 dbSNP
rs1485916447 5238 dbSNP
rs1282114539 5239 dbSNP
rs1236449530 5252 dbSNP
rs1315910867 5254 dbSNP
rs1029249379 5266 dbSNP
rs1307125720 5276 dbSNP
rs1225009537 5301 dbSNP
rs1352996792 5305 dbSNP
rs1293277044 5308 dbSNP
rs1411546406 5314 dbSNP
rs1377654675 5317 dbSNP
rs1455666297 5322 dbSNP
rs955127516 5324 dbSNP
rs1322662778 5330 dbSNP
rs1161509334 5336 dbSNP
rs1422200752 5337 dbSNP
rs1417250291 5338 dbSNP
rs985152556 5339 dbSNP
rs748271646 5345 dbSNP
rs1014971792 5352 dbSNP
rs1259384952 5354 dbSNP
rs1018535227 5366 dbSNP
rs1386140342 5375 dbSNP
rs354532 5376 dbSNP
rs1260999149 5377 dbSNP
rs1332588906 5382 dbSNP
rs1223929839 5384 dbSNP
rs1332116408 5397 dbSNP
rs974418998 5400 dbSNP
rs918507508 5403 dbSNP
rs1234452937 5408 dbSNP
rs1357858472 5409 dbSNP
rs773821961 5424 dbSNP
rs929846063 5426 dbSNP
rs1382048423 5429 dbSNP
rs981445176 5436 dbSNP
rs1326663243 5439 dbSNP
rs1229635837 5443 dbSNP
rs1363062973 5449 dbSNP
rs763217803 5459 dbSNP
rs190625883 5460 dbSNP
rs1393852381 5476 dbSNP
rs1165686729 5478 dbSNP
rs1487910725 5481 dbSNP
rs979676455 5494 dbSNP
rs354531 5496 dbSNP
rs1427762822 5500 dbSNP
rs1265930463 5512 dbSNP
rs1262162938 5516 dbSNP
rs1187906918 5529 dbSNP
rs1490931358 5530 dbSNP
rs893318666 5548 dbSNP
rs1272010332 5551 dbSNP
rs947578172 5553 dbSNP
rs539444208 5557 dbSNP
rs1042397382 5558 dbSNP
rs1336250819 5561 dbSNP
rs1250172683 5563 dbSNP
rs1227342425 5568 dbSNP
rs1308455466 5571 dbSNP
rs1298113152 5573 dbSNP
rs527534345 5582 dbSNP
rs903452351 5586 dbSNP
rs1370477345 5590 dbSNP
rs1326794870 5591 dbSNP
rs73765939 5600 dbSNP
rs1029301804 5606 dbSNP
rs1166156064 5608 dbSNP
rs949794050 5612 dbSNP
rs890762732 5615 dbSNP
rs1006621148 5616 dbSNP
rs375080877 5619 dbSNP
rs905703654 5620 dbSNP
rs1193850977 5625 dbSNP
rs1469462055 5626 dbSNP
rs1326314023 5627 dbSNP
rs182871093 5642 dbSNP
rs962900964 5662 dbSNP
rs973924290 5673 dbSNP
rs1232610857 5682 dbSNP
rs1347582228 5706 dbSNP
rs150824723 5708 dbSNP
rs1161365021 5709 dbSNP
rs187079430 5719 dbSNP
rs2297939 5725 dbSNP
rs138274931 5735 dbSNP
rs1027496034 5749 dbSNP
rs572125995 5765 dbSNP
rs1397071508 5769 dbSNP
rs1309739656 5774 dbSNP
rs951297482 5775 dbSNP
rs981330076 5784 dbSNP
rs746813285 5803 dbSNP
rs752165429 5806 dbSNP
rs1411274479 5807 dbSNP
rs142866612 5812 dbSNP
rs958677868 5813 dbSNP
rs992023063 5815 dbSNP
rs1437876504 5821 dbSNP
rs1254656351 5826 dbSNP
rs914655010 5838 dbSNP
rs1485588327 5839 dbSNP
rs1213309064 5850 dbSNP
rs947424279 5856 dbSNP
rs1041892175 5858 dbSNP
rs1223596995 5864 dbSNP
rs966182728 5866 dbSNP
rs1239906726 5867 dbSNP
rs1337586543 5869 dbSNP
rs1412849144 5870 dbSNP
rs976146357 5870 dbSNP
rs1251536855 5881 dbSNP
rs542883900 5887 dbSNP
rs1179143559 5890 dbSNP
rs933586896 5902 dbSNP
rs1157612059 5906 dbSNP
rs373807442 5917 dbSNP
rs1185544849 5918 dbSNP
rs1413527458 5920 dbSNP
rs1186429779 5925 dbSNP
rs1475134066 5931 dbSNP
rs1258680636 5938 dbSNP
rs1386955806 5939 dbSNP
rs555219649 5941 dbSNP
rs1051950026 5943 dbSNP
rs1205925041 5953 dbSNP
rs1353011739 5954 dbSNP
rs1271291421 5961 dbSNP
rs890813836 5963 dbSNP
rs1231406006 5973 dbSNP
rs1354699969 5978 dbSNP
rs1368457625 5984 dbSNP
rs1293802747 5985 dbSNP
rs979687784 5985 dbSNP
rs1324456449 5993 dbSNP
rs1317282486 6000 dbSNP
rs1006553210 6006 dbSNP
rs780879489 6009 dbSNP
rs1039892168 6014 dbSNP
rs1390220381 6036 dbSNP
rs191098300 6043 dbSNP
rs745359834 6047 dbSNP
rs995642004 6050 dbSNP
rs988525568 6051 dbSNP
rs1474663107 6058 dbSNP
rs1382967487 6064 dbSNP
rs1025497726 6066 dbSNP
rs951183475 6078 dbSNP
rs1194170182 6085 dbSNP
rs1002815198 6087 dbSNP
rs1247328510 6102 dbSNP
rs912875203 6108 dbSNP
rs1213191062 6113 dbSNP
rs1035603730 6125 dbSNP
rs1274610655 6129 dbSNP
rs958729978 6130 dbSNP
rs183502155 6136 dbSNP
rs1290580288 6137 dbSNP
rs914518172 6138 dbSNP
rs1207108470 6141 dbSNP
rs968848329 6142 dbSNP
rs1045448771 6146 dbSNP
rs753872577 6147 dbSNP
rs977879756 6161 dbSNP
rs1431039599 6167 dbSNP
rs1366866929 6170 dbSNP
rs924810842 6177 dbSNP
rs1394555559 6183 dbSNP
rs1167606136 6186 dbSNP
rs1180124251 6188 dbSNP
rs933469825 6197 dbSNP
rs937137302 6200 dbSNP
rs1245042015 6201 dbSNP
rs1168814851 6202 dbSNP
rs1451689230 6205 dbSNP
rs1393559459 6213 dbSNP
rs1193231578 6214 dbSNP
rs1445377657 6231 dbSNP
rs1248464310 6235 dbSNP
rs769227685 6236 dbSNP
rs756998807 6248 dbSNP
rs1435955933 6249 dbSNP
rs1052004137 6254 dbSNP
rs1272060155 6256 dbSNP
rs1228919713 6261 dbSNP
rs1049469469 6262 dbSNP
rs1300872846 6271 dbSNP
rs544156682 6274 dbSNP
rs887671956 6276 dbSNP
rs1367697515 6283 dbSNP
rs563460448 6293 dbSNP
rs1036388824 6295 dbSNP
rs1230124949 6296 dbSNP
rs1330121654 6298 dbSNP
rs1432081497 6305 dbSNP
rs1393653540 6308 dbSNP
rs532812554 6310 dbSNP
rs1170895547 6314 dbSNP
rs1358146198 6317 dbSNP
rs6902442 6320 dbSNP
rs559851346 6322 dbSNP
rs1406143363 6327 dbSNP
rs527460216 6333 dbSNP
rs1433760962 6338 dbSNP
rs953527766 6339 dbSNP
rs1297457430 6344 dbSNP
rs116608155 6346 dbSNP
rs1277838751 6347 dbSNP
rs1032913073 6349 dbSNP
rs1312375257 6355 dbSNP
rs898128773 6358 dbSNP
rs1296751529 6360 dbSNP
rs561201130 6361 dbSNP
rs1371969609 6367 dbSNP
rs1289600785 6381 dbSNP
rs1412148836 6389 dbSNP
rs988798180 6392 dbSNP
rs995297578 6394 dbSNP
rs971003644 6397 dbSNP
rs1361156056 6403 dbSNP
rs531515986 6412 dbSNP
rs1265288240 6427 dbSNP
rs748214307 6428 dbSNP
rs927022872 6429 dbSNP
rs886980690 6440 dbSNP
rs1002700351 6441 dbSNP
rs1187011942 6444 dbSNP
rs1483443309 6446 dbSNP
rs1257457197 6454 dbSNP
rs1213210066 6457 dbSNP
rs1315818760 6462 dbSNP
rs550150667 6468 dbSNP
rs1048914833 6475 dbSNP
rs571663627 6479 dbSNP
rs1354067885 6485 dbSNP
rs146113269 6508 dbSNP
rs1293177896 6512 dbSNP
rs11963436 6518 dbSNP
rs566065407 6523 dbSNP
rs76198205 6524 dbSNP
rs535462036 6527 dbSNP
rs1031712611 6537 dbSNP
rs77849966 6539 dbSNP
rs76790050 6541 dbSNP
rs74362357 6542 dbSNP
rs987605952 6544 dbSNP
rs1161397564 6545 dbSNP
rs1459915081 6556 dbSNP
rs1415649341 6558 dbSNP
rs1164118622 6560 dbSNP
rs554875978 6561 dbSNP
rs576631347 6562 dbSNP
rs1184420530 6570 dbSNP
rs943647864 6571 dbSNP
rs889235826 6582 dbSNP
rs187505683 6583 dbSNP
rs974051228 6601 dbSNP
rs1433502991 6604 dbSNP
rs1001340184 6609 dbSNP
rs1290031868 6610 dbSNP
rs919627003 6613 dbSNP
rs537343340 6623 dbSNP
rs1032553005 6625 dbSNP
rs930973185 6625 dbSNP
rs1366150499 6632 dbSNP
rs1322786011 6647 dbSNP
rs140143538 6651 dbSNP
rs11963475 6652 dbSNP
rs938374087 6655 dbSNP
rs1057005667 6656 dbSNP
rs568581245 6657 dbSNP
rs1282238291 6658 dbSNP
rs1490895021 6662 dbSNP
rs1318870252 6663 dbSNP
rs1370001682 6665 dbSNP
rs1168012605 6666 dbSNP
rs1216378245 6670 dbSNP
rs894268826 6672 dbSNP
rs1390454541 6681 dbSNP
rs1012862136 6684 dbSNP
rs544632986 6687 dbSNP
rs6903645 6688 dbSNP
rs1251758300 6691 dbSNP
rs572061101 6699 dbSNP
rs1210969559 6700 dbSNP
rs971057575 6701 dbSNP
rs981046143 6708 dbSNP
rs1227223039 6709 dbSNP
rs1343308647 6712 dbSNP
rs1269086563 6717 dbSNP
rs868482027 6718 dbSNP
rs926948508 6731 dbSNP
rs1156594163 6752 dbSNP
rs1370358696 6753 dbSNP
rs1372823523 6757 dbSNP
rs10457236 6758 dbSNP
rs984945100 6761 dbSNP
rs998804259 6776 dbSNP
rs1031598274 6777 dbSNP
rs1296357297 6786 dbSNP
rs1428935525 6788 dbSNP
rs1170099350 6790 dbSNP
rs573038312 6792 dbSNP
rs1349841983 6793 dbSNP
rs1198900567 6794 dbSNP
rs1324493337 6794 dbSNP
rs1209024074 6795 dbSNP
rs1235571810 6795 dbSNP
rs1275630902 6795 dbSNP
rs1304870091 6795 dbSNP
rs1331405468 6795 dbSNP
rs1334041796 6795 dbSNP
rs1347377345 6795 dbSNP
rs535554856 6795 dbSNP
rs869213025 6795 dbSNP
rs1403428698 6796 dbSNP
rs78501770 6797 dbSNP
rs1409068729 6803 dbSNP
rs1350895303 6811 dbSNP
rs4038339 6815 dbSNP
rs987488594 6816 dbSNP
rs940483231 6817 dbSNP
rs1017801689 6818 dbSNP
rs1352888539 6819 dbSNP
rs923158711 6824 dbSNP
rs560927735 6825 dbSNP
rs1288992847 6827 dbSNP
rs933319595 6833 dbSNP
rs1202390405 6834 dbSNP
rs1348635517 6837 dbSNP
rs1260160196 6838 dbSNP
rs1170086388 6848 dbSNP
rs1350986576 6850 dbSNP
rs1290100421 6854 dbSNP
rs1050442245 6867 dbSNP
rs1334409859 6874 dbSNP
rs1397362103 6882 dbSNP
rs889119827 6887 dbSNP
rs773351315 6893 dbSNP
rs760991655 6902 dbSNP
rs973719925 6903 dbSNP
rs771684119 6907 dbSNP
rs1163388797 6908 dbSNP
rs1472712626 6909 dbSNP
rs1470163974 6937 dbSNP
rs929542571 6945 dbSNP
rs772778165 6947 dbSNP
rs1054248633 6955 dbSNP
rs982449088 6957 dbSNP
rs908186160 6959 dbSNP
rs71562286 6962 dbSNP
rs182526742 6974 dbSNP
rs894330433 6977 dbSNP
rs1166078231 6981 dbSNP
rs1246574235 6988 dbSNP
rs1324364343 6990 dbSNP
rs771581484 6992 dbSNP
rs565209862 7034 dbSNP
rs948557803 7039 dbSNP
rs1366558240 7041 dbSNP
rs1390196158 7044 dbSNP
rs1043012871 7050 dbSNP
rs532526142 7051 dbSNP
rs1415006274 7053 dbSNP
rs527863358 7064 dbSNP
rs547830353 7081 dbSNP
rs998689511 7085 dbSNP
rs1474611579 7093 dbSNP
rs775172968 7096 dbSNP
rs1189437748 7097 dbSNP
rs1283682822 7097 dbSNP
rs1251161040 7098 dbSNP
rs1380766944 7102 dbSNP
rs1248066589 7103 dbSNP
rs984564561 7112 dbSNP
rs566127570 7113 dbSNP
rs1339793788 7128 dbSNP
rs1296504952 7132 dbSNP
rs1008960591 7135 dbSNP
rs188268312 7153 dbSNP
rs1438051008 7154 dbSNP
rs933265600 7157 dbSNP
rs964944138 7158 dbSNP
rs1351016419 7179 dbSNP
rs1326083032 7189 dbSNP
rs148586788 7192 dbSNP
rs936629912 7203 dbSNP
rs1027785820 7219 dbSNP
rs1053894026 7223 dbSNP
rs1445980908 7227 dbSNP
rs950964357 7228 dbSNP
rs879676938 7229 dbSNP
rs1185929442 7234 dbSNP
rs983674290 7235 dbSNP
rs945468309 7239 dbSNP
rs908235199 7265 dbSNP
rs372065771 7270 dbSNP
rs1449187827 7275 dbSNP
rs1205452404 7276 dbSNP
rs1166527349 7282 dbSNP
rs17072457 7286 dbSNP
rs1276030767 7288 dbSNP
rs1033858062 7295 dbSNP
rs761760089 7300 dbSNP
rs1277182905 7304 dbSNP
rs915637132 7311 dbSNP
rs948463719 7314 dbSNP
rs1403975993 7322 dbSNP
rs1454687004 7324 dbSNP
rs765117610 7325 dbSNP
rs17072461 7328 dbSNP
rs373534039 7329 dbSNP
rs971806829 7336 dbSNP
rs192207974 7337 dbSNP
rs1471539170 7340 dbSNP
rs934608827 7357 dbSNP
rs1271710890 7368 dbSNP
rs1483900669 7372 dbSNP
rs1052948905 7377 dbSNP
rs1235437616 7379 dbSNP
rs890496893 7388 dbSNP
rs1008845913 7389 dbSNP
rs764085820 7400 dbSNP
rs751340748 7401 dbSNP
rs781548462 7404 dbSNP
rs1227125481 7429 dbSNP
rs1329122302 7440 dbSNP
rs1260910010 7443 dbSNP
rs1412133348 7444 dbSNP
rs369705428 7449 dbSNP
rs1462234390 7454 dbSNP
rs1203777134 7468 dbSNP
rs1244222500 7471 dbSNP
rs1302491920 7474 dbSNP
rs958077644 7478 dbSNP
rs994910394 7484 dbSNP
rs529133932 7485 dbSNP
rs1456743097 7512 dbSNP
rs1475975546 7516 dbSNP
rs1175940307 7524 dbSNP
rs950846531 7527 dbSNP
rs1411214680 7529 dbSNP
rs1159794585 7530 dbSNP
rs1427501650 7533 dbSNP
rs945491497 7536 dbSNP
rs1337487079 7544 dbSNP
rs184526430 7545 dbSNP
rs1035265797 7546 dbSNP
rs1238815308 7549 dbSNP
rs1206335963 7556 dbSNP
rs189298815 7561 dbSNP
rs1055319202 7572 dbSNP
rs1230708273 7580 dbSNP
rs1320309829 7583 dbSNP
rs992911294 7588 dbSNP
rs753030815 7591 dbSNP
rs1381666888 7594 dbSNP
rs915538494 7599 dbSNP
rs114678949 7601 dbSNP
rs1434539185 7602 dbSNP
rs978523771 7603 dbSNP
rs113275319 7604 dbSNP
rs1325256056 7605 dbSNP
rs934492732 7607 dbSNP
rs1052999376 7611 dbSNP
rs1266937863 7615 dbSNP
rs1348001994 7618 dbSNP
rs1415591655 7628 dbSNP
rs757091320 7636 dbSNP
rs796665793 7641 dbSNP
rs1026680 7642 dbSNP
rs548608445 7644 dbSNP
rs1264533467 7646 dbSNP
rs1487766782 7649 dbSNP
rs944588885 7650 dbSNP
rs1039465855 7651 dbSNP
rs900473546 7660 dbSNP
rs1199177259 7670 dbSNP
rs1295761182 7672 dbSNP
rs868493151 7673 dbSNP
rs1481544669 7674 dbSNP
rs1049125101 7682 dbSNP
rs886644157 7683 dbSNP
rs1363279698 7685 dbSNP
rs958219622 7691 dbSNP
rs1292858741 7699 dbSNP
rs1458283199 7700 dbSNP
rs1367137710 7702 dbSNP
rs989409178 7704 dbSNP
rs1005043671 7705 dbSNP
rs1390283551 7707 dbSNP
rs913924883 7712 dbSNP
rs1189982762 7713 dbSNP
rs1430923568 7723 dbSNP
rs576138709 7732 dbSNP
rs1385605538 7734 dbSNP
rs1228453894 7738 dbSNP
rs1272858229 7740 dbSNP
rs371389807 7744 dbSNP
rs375658618 7748 dbSNP
rs1231233374 7752 dbSNP
rs140223180 7752 dbSNP
rs1300513624 7755 dbSNP
rs1233924879 7756 dbSNP
rs1254329086 7756 dbSNP
rs1256616785 7756 dbSNP
rs1286353899 7756 dbSNP
rs1325629924 7756 dbSNP
rs1344421517 7756 dbSNP
rs1491166022 7756 dbSNP
rs4038340 7756 dbSNP
rs59098736 7756 dbSNP
rs76481206 7756 dbSNP
rs1491277916 7757 dbSNP
rs1347236955 7758 dbSNP
rs1405168457 7759 dbSNP
rs1287389838 7760 dbSNP
rs966647869 7760 dbSNP
rs1410474649 7763 dbSNP
rs1470658696 7763 dbSNP
rs1473127859 7765 dbSNP
rs866980034 7765 dbSNP
rs1365855422 7767 dbSNP
rs1333448295 7772 dbSNP
rs1446722789 7775 dbSNP
rs1207303800 7776 dbSNP
rs1250417024 7777 dbSNP
rs1450697379 7778 dbSNP
rs1442021107 7791 dbSNP
rs1257083138 7793 dbSNP
rs1202296903 7799 dbSNP
rs1463586439 7801 dbSNP
rs1266230884 7802 dbSNP
rs1227640651 7804 dbSNP
rs1329619230 7815 dbSNP
rs139530728 7816 dbSNP
rs928025733 7817 dbSNP
rs982163988 7817 dbSNP
rs1334389334 7818 dbSNP
rs1490956564 7834 dbSNP
rs1200371471 7840 dbSNP
rs1320494441 7841 dbSNP
rs896742155 7842 dbSNP
rs1250118070 7843 dbSNP
rs1417343130 7845 dbSNP
rs1055728761 7846 dbSNP
rs757745199 7848 dbSNP
rs1185646579 7849 dbSNP
rs565145084 7853 dbSNP
rs779439420 7854 dbSNP
rs377325568 7856 dbSNP
rs773896663 7862 dbSNP
rs541391753 7864 dbSNP
rs978958694 7865 dbSNP
rs1425114701 7872 dbSNP
rs1223475572 7878 dbSNP
rs1362434670 7882 dbSNP
rs993141716 7884 dbSNP
rs1297213162 7887 dbSNP
rs1435155106 7890 dbSNP
rs1032716305 7892 dbSNP
rs1347511084 7894 dbSNP
rs868399952 7896 dbSNP
rs145162689 7900 dbSNP
rs911704515 7902 dbSNP
rs530150554 7903 dbSNP
rs1391817999 7904 dbSNP
rs944635836 7908 dbSNP
rs1307094181 7913 dbSNP
rs113500008 7914 dbSNP
rs1428009547 7914 dbSNP
rs1245852677 7915 dbSNP
rs867422228 7921 dbSNP
rs921949720 7942 dbSNP
rs11970391 7944 dbSNP
rs1011247541 7960 dbSNP
rs1196578287 7965 dbSNP
rs530982453 7967 dbSNP
rs192417894 7970 dbSNP
rs1223716561 7971 dbSNP
rs1026679 7973 dbSNP
rs1479780629 7976 dbSNP
rs886531169 7979 dbSNP
rs768215783 7985 dbSNP
rs1056663907 8002 dbSNP
rs1339689018 8003 dbSNP
rs1273442571 8009 dbSNP
rs1214700980 8017 dbSNP
rs534988154 8019 dbSNP
rs966699862 8020 dbSNP
rs982046859 8024 dbSNP
rs1436311700 8028 dbSNP
rs1332062655 8030 dbSNP
rs1387050400 8031 dbSNP
rs896627286 8032 dbSNP
rs1370252575 8033 dbSNP
rs1169463372 8035 dbSNP
rs1411737515 8036 dbSNP
rs1444969221 8040 dbSNP
rs1169502249 8043 dbSNP
rs776165344 8046 dbSNP
rs761268022 8048 dbSNP
rs1023888467 8057 dbSNP
rs990915532 8059 dbSNP
rs905560133 8066 dbSNP
rs910050102 8068 dbSNP
rs999873249 8069 dbSNP
rs1250698381 8077 dbSNP
rs1032602513 8081 dbSNP
rs765241642 8088 dbSNP
rs1335255419 8093 dbSNP
rs1385633486 8097 dbSNP
rs941501364 8117 dbSNP
rs1229176158 8125 dbSNP
rs1295298690 8133 dbSNP
rs988493262 8134 dbSNP
rs1306178046 8136 dbSNP
rs1229859760 8140 dbSNP
rs140853525 8143 dbSNP
rs1285725988 8144 dbSNP
rs1227015719 8145 dbSNP
rs1018764363 8146 dbSNP
rs1308882438 8151 dbSNP
rs918814297 8158 dbSNP
rs1460899049 8160 dbSNP
rs1201880512 8161 dbSNP
rs965885914 8164 dbSNP
rs1415092684 8165