miRTarBase - #MIRT667474 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAPK1   
Synonyms ERK, ERK-2, ERK2, ERT1, MAPK2, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk, p42-MAPK
Description mitogen-activated protein kinase 1
Transcript NM_002745   
Other Transcripts NM_138957   
Expression
Putative miRNA Targets on MAPK1
3'UTR of MAPK1
(miRNA target sites are highlighted)
>MAPK1|NM_002745|3'UTR
   1 ATTTGTCAGGACAAGGGCTCAGAGGACTGGACGTGCTCAGACATCGGTGTTCTTCTTCCCAGTTCTTGACCCCTGGTCCT
  81 GTCTCCAGCCCGTCTTGGCTTATCCACTTTGACTCCTTTGAGCCGTTTGGAGGGGCGGTTTCTGGTAGTTGTGGCTTTTA
 161 TGCTTTCAAAGAATTTCTTCAGTCCAGAGAATTCCTCCTGGCAGCCCTGTGTGTGTCACCCATTGGTGACCTGCGGCAGT
 241 ATGTACTTCAGTGCACCTACTGCTTACTGTTGCTTTAGTCACTAATTGCTTTCTGGTTTGAAAGATGCAGTGGTTCCTCC
 321 CTCTCCTGAATCCTTTTCTACATGATGCCCTGCTGACCATGCAGCCGCACCAGAGAGAGATTCTTCCCCAATTGGCTCTA
 401 GTCACTGGCATCTCACTTTATGATAGGGAAGGCTACTACCTAGGGCACTTTAAGTCAGTGACAGCCCCTTATTTGCACTT
 481 CACCTTTTGACCATAACTGTTTCCCCAGAGCAGGAGCTTGTGGAAATACCTTGGCTGATGTTGCAGCCTGCAGCAAGTGC
 561 TTCCGTCTCCGGAATCCTTGGGGAGCACTTGTCCACGTCTTTTCTCATATCATGGTAGTCACTAACATATATAAGGTATG
 641 TGCTATTGGCCCAGCTTTTAGAAAATGCAGTCATTTTTCTAAATAAAAAGGAAGTACTGCACCCAGCAGTGTCACTCTGT
 721 AGTTACTGTGGTCACTTGTACCATATAGAGGTGTAACACTTGTCAAGAAGCGTTATGTGCAGTACTTAATGTTTGTAAGA
 801 CTTACAAAAAAAGATTTAAAGTGGCAGCTTCACTCGACATTTGGTGAGAGAAGTACAAAGGTTGCAGTGCTGAGCTGTGG
 881 GCGGTTTCTGGGGATGTCCCAGGGTGGAACTCCACATGCTGGTGCATATACGCCCTTGAGCTACTTCAAATGTGGGTGTT
 961 TCAGTAACCACGTTCCATGCCTGAGGATTTAGCAGAGAGGAACACTGCGTCTTTAAATGAGAAAGTATACAATTCTTTTT
1041 CCTTCTACAGCATGTCAGCATCTCAAGTTCATTTTTCAACCTACAGTATAACAATTTGTAATAAAGCCTCCAGGAGCTCA
1121 TGACGTGAAGCACTGTTCTGTCCTCAAGTACTCAAATATTTCTGATACTGCTGAGTCAGACTGTCAGAAAAAGCTAGCAC
1201 TAACTCGTGTTTGGAGCTCTATCCATATTTTACTGATCTCTTTAAGTATTTGTTCCTGCCACTGTGTACTGTGGAGTTGA
1281 CTCGGTGTTCTGTCCCAGTGCGGTGCCTCCTCTTGACTTCCCCACTGCTCTCTGTGGTGAGAAATTTGCCTTGTTCAATA
1361 ATTACTGTACCCTCGCATGACTGTTACAGCTTTCTGTGCAGAGATGACTGTCCAAGTGCCACATGCCTACGATTGAAATG
1441 AAAACTCTATTGTTACCTCTGAGTTGTGTTCCACGGAAAATGCTATCCAGCAGATCATTTAGGAAAAATAATTCTATTTT
1521 TAGCTTTTCATTTCTCAGCTGTCCTTTTTTCTTGTTTGATTTTTGACAGCAATGGAGAATGGGTTATATAAAGACTGCCT
1601 GCTAATATGAACAGAAATGCATTTGTAATTCATGAAAATAAATGTACATCTTCTATCTTCACATTCATGTTAAGATTCAG
1681 TGTTGCTTTCCTCTGGATCAGCGTGTCTGAATGGACAGTCAGGTTCAGGTTGTGCTGAACACAGAAATGCTCACAGGCCT
1761 CACTTTGCCGCCCAGGCACTGGCCCAGCACTTGGATTTACATAAGATGAGTTAGAAAGGTACTTCTGTAGGGTCCTTTTT
1841 ACCTCTGCTCGGCAGAGAATCGATGCTGTCATGTTCCTTTATTCACAATCTTAGGTCTCAAATATTCTGTCAAACCCTAA
1921 CAAAGAAGCCCCGACATCTCAGGTTGGATTCCCTGGTTCTCTCTAAAGAGGGCCTGCCCTTGTGCCCCAGAGGTGCTGCT
2001 GGGCACAGCCAAGAGTTGGGAAGGGCCGCCCCACAGTACGCAGTCCTCACCACCCAGCCCAGGGTGCTCACGCTCACCAC
2081 TCCTGTGGCTGAGGAAGGATAGCTGGCTCATCCTCGGAAAACAGACCCACATCTCTATTCTTGCCCTGAAATACGCGCTT
2161 TTCACTTGCGTGCTCAGAGCTGCCGTCTGAAGGTCCACACAGCATTGACGGGACACAGAAATGTGACTGTTACCGGATAA
2241 CACTGATTAGTCAGTTTTCATTTATAAAAAAGCATTGACAGTTTTATTACTCTTGTTTCTTTTTAAATGGAAAGTTACTA
2321 TTATAAGGTTAATTTGGAGTCCTCTTCTAAATAGAAAACCATATCCTTGGCTACTAACATCTGGAGACTGTGAGCTCCTT
2401 CCCATTCCCCTTCCTGGTACTGTGGAGTCAGATTGGCATGAAACCACTAACTTCATTCTAGAATCATTGTAGCCATAAGT
2481 TGTGTGCTTTTTATTAATCATGCCAAACATAATGTAACTGGGCAGAGAATGGTCCTAACCAAGGTACCTATGAAAAGCGC
2561 TAGCTATCATGTGTAGTAGATGCATCATTTTGGCTCTTCTTACATTTGTAAAAATGTACAGATTAGGTCATCTTAATTCA
2641 TATTAGTGACACGGAACAGCACCTCCACTATTTGTATGTTCAAATAAGCTTTCAGACTAATAGCTTTTTTGGTGTCTAAA
2721 ATGTAAGCAAAAAATTCCTGCTGAAACATTCCAGTCCTTTCATTTAGTATAAAAGAAATACTGAACAAGCCAGTGGGATG
2801 GAATTGAAAGAACTAATCATGAGGACTCTGTCCTGACACAGGTCCTCAAAGCTAGCAGAGATACGCAGACATTGTGGCAT
2881 CTGGGTAGAAGAATACTGTATTGTGTGTGCAGTGCACAGTGTGTGGTGTGTGCACACTCATTCCTTCTGCTCTTGGGCAC
2961 AGGCAGTGGGTGTAGAGGTAACCAGTAGCTTTGAGAAGCTACATGTAGCTCACCAGTGGTTTTCTCTAAGGAATCACAAA
3041 AGTAAACTACCCAACCACATGCCACGTAATATTTCAGCCATTCAGAGGAAACTGTTTTCTCTTTATTTGCTTATATGTTA
3121 ATATGGTTTTTAAATTGGTAACTTTTATATAGTATGGTAACAGTATGTTAATACACACATACATACGCACACATGCTTTG
3201 GGTCCTTCCATAATACTTTTATATTTGTAAATCAATGTTTTGGAGCAATCCCAAGTTTAAGGGAAATATTTTTGTAAATG
3281 TAATGGTTTTGAAAATCTGAGCAATCCTTTTGCTTATACATTTTTAAAGCATTTGTGCTTTAAAATTGTTATGCTGGTGT
3361 TTGAAACATGATACTCCTGTGGTGCAGATGAGAAGCTATAACAGTGAATATGTGGTTTCTCTTACGTCATCCACCTTGAC
3441 ATGATGGGTCAGAAACAAATGGAAATCCAGAGCAAGTCCTCCAGGGTTGCACCAGGTTTACCTAAAGCTTGTTGCCTTTT
3521 CTTGTGCTGTTTATGCGTGTAGAGCACTCAAGAAAGTTCTGAAACTGCTTTGTATCTGCTTTGTACTGTTGGTGCCTTCT
3601 TGGTATTGTACCCCAAAATTCTGCATAGATTATTTAGTATAATGGTAAGTTAAAAAATGTTAAAGGAAGATTTTATTAAG
3681 AATCTGAATGTTTATTCATTATATTGTTACAATTTAACATTAACATTTATTTGTGGTATTTGTGATTTGGTTAATCTGTA
3761 TAAAAATTGTAAGTAGAAAGGTTTATATTTCATCTTAATTCTTTTGATGTTGTAAACGTACTTTTTAAAAGATGGATTAT
3841 TTGAATGTTTATGGCACCTGACTTGTAAAAAAAAAAAACTACAAAAAAATCCTTAGAATCATTAAATTGTGTCCCTGTAT
3921 TACCAAAATAACACAGCACCGTGCATGTATAGTTTAATTGCAGTTTCATCTGTGAAAACGTGAAATTGTCTAGTCCTTCG
4001 TTATGTTCCCCAGATGTCTTCCAGATTTGCTCTGCATGTGGTAACTTGTGTTAGGGCTGTGAGCTGTTCCTCGAGTTGAA
4081 TGGGGATGTCAGTGCTCCTAGGGTTCTCCAGGTGGTTCTTCAGACCTTCACCTGTGGGGGGGGGGGTAGGCGGTGCCCAC
4161 GCCCATCTCCTCATCCTCCTGAACTTCTGCAACCCCACTGCTGGGCAGACATCCTGGGCAACCCCTTTTTTCAGAGCAAG
4241 AAGTCATAAAGATAGGATTTCTTGGACATTTGGTTCTTATCAATATTGGGCATTATGTAATGACTTATTTACAAAACAAA
4321 GATACTGGAAAATGTTTTGGATGTGGTGTTATGGAAAGAGCACAGGCCTTGGACCCATCCAGCTGGGTTCAGAACTACCC
4401 CCTGCTTATAACTGCGGCTGGCTGTGGGCCAGTCATTCTGCGTCTCTGCTTTCTTCCTCTGCTTCAGACTGTCAGCTGTA
4481 AAGTGGAAGCAATATTACTTGCCTTGTATATGGTAAAGATTATAAAAATACATTTCAACTGTTCAGCATAGTACTTCAAA
4561 GCAAGTACTCAGTAAATAGCAAGTCTTTTTAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGG-UAACAGUGUGAGGu 5'
            ||: || : ||  |||:||| 
Target 5' aaAATTCCTGCTGAAACATTCCa 3'
2731 - 2753 136.00 -13.60
2
miRNA  3' guuUGUGGUA------ACA-GUGUGAGgu 5'
             ||| ::|      ||| |||||||  
Target 5' tgcACAGTGTGTGGTGTGTGCACACTCat 3'
2913 - 2941 133.00 -14.30
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||||    ||  |:||||| 
Target 5' gaAACA----TG--ATACTCCt 3'
3363 - 3378 130.00 -9.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30148176 3 COSMIC
COSN228878 6 COSMIC
COSN20054254 49 COSMIC
COSN31553017 103 COSMIC
COSN30485209 115 COSMIC
COSN26722400 136 COSMIC
COSN31601783 144 COSMIC
COSN23324714 296 COSMIC
COSN23324713 297 COSMIC
COSN21458853 382 COSMIC
COSN15759560 839 COSMIC
COSN24941124 1576 COSMIC
COSN20583600 1627 COSMIC
COSN8008974 2070 COSMIC
COSN8014251 2084 COSMIC
COSN8008973 2121 COSMIC
COSN22122786 2241 COSMIC
COSN8014250 2245 COSMIC
COSN23133205 2474 COSMIC
COSN23237894 3218 COSMIC
COSN17393171 3291 COSMIC
COSN29571309 3455 COSMIC
COSN1895223 4148 COSMIC
COSN8008972 4405 COSMIC
COSN24147531 4635 COSMIC
COSN10028300 4932 COSMIC
COSN25513151 4974 COSMIC
COSN26277332 4986 COSMIC
COSN20575933 5078 COSMIC
COSN19657552 5079 COSMIC
COSN28358085 5090 COSMIC
COSN21792992 5099 COSMIC
COSN31568677 5188 COSMIC
COSN10028299 5309 COSMIC
COSN8612334 5481 COSMIC
COSN30172974 5523 COSMIC
COSN20093932 5525 COSMIC
COSN26562355 5667 COSMIC
COSN5989171 5738 COSMIC
COSN31561714 5836 COSMIC
COSN31485341 5886 COSMIC
COSN31517860 5896 COSMIC
COSN28824362 5926 COSMIC
COSN26569926 5986 COSMIC
COSN31547778 5989 COSMIC
COSN31553703 6171 COSMIC
COSN5989170 6286 COSMIC
COSN31584569 6328 COSMIC
COSN31515826 6450 COSMIC
COSN16171796 6504 COSMIC
COSN16173251 6505 COSMIC
COSN31579050 6528 COSMIC
COSN26838343 6657 COSMIC
COSN8014249 6810 COSMIC
COSN30016193 6913 COSMIC
COSN8014248 7109 COSMIC
COSN1895222 7395 COSMIC
COSN20117198 7739 COSMIC
COSN22322090 8055 COSMIC
COSN31543302 8119 COSMIC
COSN28803689 8140 COSMIC
COSN26604088 8265 COSMIC
COSN27671925 8329 COSMIC
COSN31543602 8710 COSMIC
COSN19167493 8785 COSMIC
COSN31539007 8803 COSMIC
COSN27452497 8820 COSMIC
COSN19660748 8821 COSMIC
COSN26506740 8832 COSMIC
COSN31515260 8933 COSMIC
COSN27509974 9090 COSMIC
COSN8346388 9325 COSMIC
rs59312009 4636 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1390270307 1 dbSNP
rs760224856 5 dbSNP
rs1416852286 14 dbSNP
rs1452247184 17 dbSNP
rs749902416 18 dbSNP
rs767137802 22 dbSNP
rs761406678 25 dbSNP
rs199968209 31 dbSNP
rs1176722906 33 dbSNP
rs768421042 34 dbSNP
rs762799226 37 dbSNP
rs556379533 38 dbSNP
rs769624669 48 dbSNP
rs747054506 49 dbSNP
rs150526856 50 dbSNP
rs751762672 50 dbSNP
rs1341340739 51 dbSNP
rs956495224 54 dbSNP
rs1268491319 61 dbSNP
rs1271287530 70 dbSNP
rs1347230682 72 dbSNP
rs1220249359 74 dbSNP
rs1280272843 76 dbSNP
rs1346105966 86 dbSNP
rs1180339502 88 dbSNP
rs1219218002 103 dbSNP
rs185867955 106 dbSNP
rs1251627634 107 dbSNP
rs1197940753 108 dbSNP
rs3188781 112 dbSNP
rs1482560701 116 dbSNP
rs1263127119 120 dbSNP
rs1239804453 124 dbSNP
rs547434903 127 dbSNP
rs969707776 128 dbSNP
rs533661119 137 dbSNP
rs867585395 149 dbSNP
rs1432842736 150 dbSNP
rs958434215 161 dbSNP
rs1033115503 172 dbSNP
rs527779980 174 dbSNP
rs1013514575 182 dbSNP
rs1400330096 188 dbSNP
rs1316498433 196 dbSNP
rs141640602 197 dbSNP
rs896447386 197 dbSNP
rs1302827334 204 dbSNP
rs1334821281 207 dbSNP
rs1020537923 211 dbSNP
rs1243036211 214 dbSNP
rs1392984290 214 dbSNP
rs998842950 215 dbSNP
rs1350424727 217 dbSNP
rs375181009 219 dbSNP
rs1281742604 220 dbSNP
rs531872995 221 dbSNP
rs996398677 222 dbSNP
rs1470325324 226 dbSNP
rs942786813 226 dbSNP
rs371806292 227 dbSNP
rs1180497592 229 dbSNP
rs1364089540 240 dbSNP
rs1469462554 248 dbSNP
rs1431488283 262 dbSNP
rs1040571171 264 dbSNP
rs796607708 269 dbSNP
rs1462199737 270 dbSNP
rs748793441 275 dbSNP
rs371886420 276 dbSNP
rs562877103 277 dbSNP
rs1392445871 280 dbSNP
rs888552319 282 dbSNP
rs1310638730 286 dbSNP
rs1052078352 288 dbSNP
rs1237365180 293 dbSNP
rs1286376169 296 dbSNP
rs1357993966 299 dbSNP
rs1214009470 303 dbSNP
rs2298432 304 dbSNP
rs929999290 307 dbSNP
rs1200408802 309 dbSNP
rs532709187 320 dbSNP
rs925095850 321 dbSNP
rs560533746 324 dbSNP
rs1184411198 333 dbSNP
rs918542407 341 dbSNP
rs1422488748 345 dbSNP
rs192279025 350 dbSNP
rs1179353126 351 dbSNP
rs373899385 365 dbSNP
rs949961986 366 dbSNP
rs1164497296 379 dbSNP
rs917107842 380 dbSNP
rs991263624 384 dbSNP
rs1463071730 414 dbSNP
rs916418904 419 dbSNP
rs992050590 430 dbSNP
rs1336556588 435 dbSNP
rs1233460503 436 dbSNP
rs1292324615 437 dbSNP
rs186923754 441 dbSNP
rs1264400557 445 dbSNP
rs1251422898 450 dbSNP
rs561258937 457 dbSNP
rs1257940041 458 dbSNP
rs1349504201 463 dbSNP
rs1004910382 464 dbSNP
rs1478954052 475 dbSNP
rs1032771162 489 dbSNP
rs182598220 490 dbSNP
rs1372647506 491 dbSNP
rs1240888616 492 dbSNP
rs1174846262 496 dbSNP
rs1376377433 504 dbSNP
rs147265384 510 dbSNP
rs1020364151 511 dbSNP
rs1311490345 511 dbSNP
rs1314146999 518 dbSNP
rs996672279 522 dbSNP
rs1295656576 523 dbSNP
rs1453223348 527 dbSNP
rs1408226892 528 dbSNP
rs900630810 529 dbSNP
rs1306425865 544 dbSNP
rs998469548 550 dbSNP
rs1257719499 554 dbSNP
rs1400263620 559 dbSNP
rs901408607 563 dbSNP
rs1209861654 575 dbSNP
rs1489392164 587 dbSNP
rs1187390991 590 dbSNP
rs1160556482 591 dbSNP
rs1018516832 600 dbSNP
rs1193954337 606 dbSNP
rs1426822039 611 dbSNP
rs545000533 615 dbSNP
rs1396182475 619 dbSNP
rs1007078805 620 dbSNP
rs1052047865 621 dbSNP
rs1454969255 623 dbSNP
rs1289090143 629 dbSNP
rs888576390 643 dbSNP
rs1360612560 644 dbSNP
rs556471470 649 dbSNP
rs924947250 657 dbSNP
rs1371603723 658 dbSNP
rs539367950 663 dbSNP
rs1233565052 675 dbSNP
rs147441924 677 dbSNP
rs1318520993 678 dbSNP
rs1190375582 683 dbSNP
rs769618374 684 dbSNP
rs897186161 685 dbSNP
rs947812624 695 dbSNP
rs1046815866 696 dbSNP
rs949993043 697 dbSNP
rs1253775233 699 dbSNP
rs917182927 701 dbSNP
rs1192320387 704 dbSNP
rs916388076 708 dbSNP
rs1356851111 710 dbSNP
rs1420083844 713 dbSNP
rs1159317232 721 dbSNP
rs992024060 726 dbSNP
rs1246443037 727 dbSNP
rs1384900868 729 dbSNP
rs960596851 732 dbSNP
rs1055608512 737 dbSNP
rs1430065876 745 dbSNP
rs7292584 746 dbSNP
rs1320391552 757 dbSNP
rs925776176 761 dbSNP
rs533885347 765 dbSNP
rs1380925169 767 dbSNP
rs1215848850 770 dbSNP
rs978569902 773 dbSNP
rs1468094185 778 dbSNP
rs967520453 780 dbSNP
rs748350427 800 dbSNP
rs996253190 803 dbSNP
rs1176955963 813 dbSNP
rs1406329368 819 dbSNP
rs964793764 822 dbSNP
rs565515970 824 dbSNP
rs1460497895 825 dbSNP
rs1323757192 833 dbSNP
rs1164597919 834 dbSNP
rs553639351 836 dbSNP
rs1009058782 846 dbSNP
rs976434516 852 dbSNP
rs1031885955 866 dbSNP
rs1000855708 871 dbSNP
rs1294167654 874 dbSNP
rs752373295 883 dbSNP
rs370335528 887 dbSNP
rs547767006 889 dbSNP
rs965015679 898 dbSNP
rs1334186866 905 dbSNP
rs903493941 912 dbSNP
rs755183216 914 dbSNP
rs142890923 915 dbSNP
rs74277335 916 dbSNP
rs1231478613 918 dbSNP
rs1486862248 922 dbSNP
rs1489682524 926 dbSNP
rs1267820470 929 dbSNP
rs894921611 929 dbSNP
rs1162161447 942 dbSNP
rs1421092742 943 dbSNP
rs1027557692 945 dbSNP
rs1361378019 946 dbSNP
rs1056310838 948 dbSNP
rs939203775 953 dbSNP
rs994291690 954 dbSNP
rs766382429 955 dbSNP
rs1340005689 957 dbSNP
rs930575002 959 dbSNP
rs1355026484 971 dbSNP
rs897212570 992 dbSNP
rs1046441229 993 dbSNP
rs1013553062 1000 dbSNP
rs1362767941 1009 dbSNP
rs975172046 1022 dbSNP
rs895112054 1023 dbSNP
rs1055678455 1028 dbSNP
rs1353083749 1030 dbSNP
rs1485130770 1031 dbSNP
rs191683343 1041 dbSNP
rs754876888 1042 dbSNP
rs1243273556 1056 dbSNP
rs1475472853 1057 dbSNP
rs925837574 1064 dbSNP
rs1185808369 1065 dbSNP
rs1043265681 1066 dbSNP
rs1410964846 1073 dbSNP
rs1388224242 1076 dbSNP
rs1422278324 1085 dbSNP
rs1174026261 1086 dbSNP
rs945878782 1087 dbSNP
rs1433032290 1090 dbSNP
rs1320540734 1093 dbSNP
rs912989273 1095 dbSNP
rs1430137168 1099 dbSNP
rs1428126499 1101 dbSNP
rs1373796417 1105 dbSNP
rs532701634 1106 dbSNP
rs372192251 1107 dbSNP
rs987524263 1110 dbSNP
rs112766808 1113 dbSNP
rs965043262 1114 dbSNP
rs1285951437 1120 dbSNP
rs1032272458 1121 dbSNP
rs1447262525 1122 dbSNP
rs910886204 1126 dbSNP
rs546922865 1130 dbSNP
rs1000422843 1131 dbSNP
rs530196725 1132 dbSNP
rs1194191777 1138 dbSNP
rs1027177100 1139 dbSNP
rs973329132 1145 dbSNP
rs367801891 1146 dbSNP
rs1160470281 1147 dbSNP
rs561397570 1147 dbSNP
rs1025022004 1156 dbSNP
rs187238114 1163 dbSNP
rs1011960787 1165 dbSNP
rs1396796743 1170 dbSNP
rs1322975000 1171 dbSNP
rs894890597 1176 dbSNP
rs1284040967 1178 dbSNP
rs1056193117 1182 dbSNP
rs1241585776 1184 dbSNP
rs1225532822 1186 dbSNP
rs1013621918 1192 dbSNP
rs1297898628 1193 dbSNP
rs895185646 1198 dbSNP
rs1252329097 1201 dbSNP
rs1449829788 1205 dbSNP
rs1356775468 1206 dbSNP
rs1335376884 1208 dbSNP
rs113678749 1209 dbSNP
rs1404657013 1212 dbSNP
rs1420054788 1213 dbSNP
rs1176535237 1214 dbSNP
rs939086027 1214 dbSNP
rs1389177131 1215 dbSNP
rs1033628922 1216 dbSNP
rs1481174035 1223 dbSNP
rs1001483655 1225 dbSNP
rs1176394347 1229 dbSNP
rs1335551199 1230 dbSNP
rs886251370 1231 dbSNP
rs1440946913 1232 dbSNP
rs1470415388 1232 dbSNP
rs1048036278 1234 dbSNP
rs1233328310 1235 dbSNP
rs1250904055 1235 dbSNP
rs1336240200 1235 dbSNP
rs1343989928 1235 dbSNP
rs1475686979 1235 dbSNP
rs35926036 1235 dbSNP
rs748909941 1235 dbSNP
rs769959083 1235 dbSNP
rs796522263 1235 dbSNP
rs869125639 1235 dbSNP
rs372067944 1236 dbSNP
rs369508871 1237 dbSNP
rs1169011327 1238 dbSNP
rs1463920045 1238 dbSNP
rs920545532 1238 dbSNP
rs904458964 1248 dbSNP
rs1042952359 1249 dbSNP
rs373628921 1250 dbSNP
rs1263774538 1254 dbSNP
rs183260931 1258 dbSNP
rs1315346959 1259 dbSNP
rs1415077932 1260 dbSNP
rs565289613 1263 dbSNP
rs891598638 1267 dbSNP
rs911892722 1270 dbSNP
rs987490220 1271 dbSNP
rs1040853612 1273 dbSNP
rs191893884 1280 dbSNP
rs1338714224 1281 dbSNP
rs910917632 1282 dbSNP
rs1282275024 1286 dbSNP
rs985106198 1287 dbSNP
rs187181816 1288 dbSNP
rs1254100339 1290 dbSNP
rs1430403190 1294 dbSNP
rs979364886 1298 dbSNP
rs1372974435 1300 dbSNP
rs1290127226 1302 dbSNP
rs553924956 1305 dbSNP
rs1023675405 1307 dbSNP
rs1376510175 1309 dbSNP
rs1434893375 1312 dbSNP
rs1336811820 1314 dbSNP
rs972976506 1315 dbSNP
rs961884616 1316 dbSNP
rs1157961290 1325 dbSNP
rs540087537 1337 dbSNP
rs756013194 1339 dbSNP
rs17759598 1344 dbSNP
rs554214933 1354 dbSNP
rs1348340609 1359 dbSNP
rs1397834672 1365 dbSNP
rs1033702746 1368 dbSNP
rs1210376569 1378 dbSNP
rs761742474 1380 dbSNP
rs1243748000 1383 dbSNP
rs903821165 1385 dbSNP
rs1261197599 1389 dbSNP
rs774321698 1399 dbSNP
rs1185485453 1403 dbSNP
rs1021966964 1407 dbSNP
rs1484962677 1410 dbSNP
rs537560793 1416 dbSNP
rs1260332424 1417 dbSNP
rs1047552686 1450 dbSNP
rs145926429 1456 dbSNP
rs184222426 1457 dbSNP
rs1245782734 1459 dbSNP
rs1288938763 1472 dbSNP
rs943790992 1474 dbSNP
rs1384163340 1479 dbSNP
rs1327869985 1483 dbSNP
rs1371409413 1484 dbSNP
rs889557021 1488 dbSNP
rs1218394810 1490 dbSNP
rs1317833303 1499 dbSNP
rs1318941496 1521 dbSNP
rs149077149 1526 dbSNP
rs1267507580 1533 dbSNP
rs1359208106 1537 dbSNP
rs1463619856 1539 dbSNP
rs1038887133 1542 dbSNP
rs1254145483 1544 dbSNP
rs1468466921 1545 dbSNP
rs930979953 1551 dbSNP
rs919563257 1552 dbSNP
rs911862900 1556 dbSNP
rs1159397110 1560 dbSNP
rs1410519256 1561 dbSNP
rs1166515049 1562 dbSNP
rs536354565 1569 dbSNP
rs1161441189 1570 dbSNP
rs973429152 1573 dbSNP
rs1423394557 1574 dbSNP
rs940265130 1597 dbSNP
rs138827805 1599 dbSNP
rs924731298 1602 dbSNP
rs978946210 1603 dbSNP
rs992305399 1604 dbSNP
rs1273957552 1612 dbSNP
rs757404329 1615 dbSNP
rs1321639800 1619 dbSNP
rs916084673 1626 dbSNP
rs1234902053 1627 dbSNP
rs991717823 1631 dbSNP
rs959504606 1638 dbSNP
rs763919476 1648 dbSNP
rs1177385556 1649 dbSNP
rs574198503 1663 dbSNP
rs189618886 1664 dbSNP
rs1003248829 1667 dbSNP
rs979503588 1668 dbSNP
rs968495394 1669 dbSNP
rs1185011303 1671 dbSNP
rs1162610375 1672 dbSNP
rs1356024931 1676 dbSNP
rs1462280826 1683 dbSNP
rs1307239205 1694 dbSNP
rs370827367 1695 dbSNP
rs1267104821 1697 dbSNP
rs547152088 1698 dbSNP
rs11704800 1700 dbSNP
rs1360662726 1710 dbSNP
rs1294437189 1713 dbSNP
rs1020943862 1717 dbSNP
rs1378549617 1731 dbSNP
rs1227056840 1737 dbSNP
rs566203321 1743 dbSNP
rs1010596156 1744 dbSNP
rs377640277 1745 dbSNP
rs1294157054 1753 dbSNP
rs1273003549 1760 dbSNP
rs1019517324 1768 dbSNP
rs1212582477 1770 dbSNP
rs373278957 1773 dbSNP
rs559629681 1773 dbSNP
rs1472189175 1777 dbSNP
rs1341976247 1779 dbSNP
rs1008076371 1780 dbSNP
rs889589702 1781 dbSNP
rs1429111683 1782 dbSNP
rs530207788 1783 dbSNP
rs868330269 1791 dbSNP
rs995259744 1792 dbSNP
rs1313740272 1793 dbSNP
rs1365921330 1796 dbSNP
rs184956581 1797 dbSNP
rs1445873600 1803 dbSNP
rs551054237 1805 dbSNP
rs890394354 1811 dbSNP
rs1363252495 1816 dbSNP
rs1295083499 1821 dbSNP
rs150207690 1822 dbSNP
rs1036683253 1833 dbSNP
rs1295768485 1837 dbSNP
rs934694152 1840 dbSNP
rs1171206281 1841 dbSNP
rs115057976 1844 dbSNP
rs1043498329 1848 dbSNP
rs918183467 1849 dbSNP
rs1207401118 1857 dbSNP
rs140941849 1860 dbSNP
rs1490582354 1862 dbSNP
rs1465240293 1866 dbSNP
rs1187869326 1867 dbSNP
rs916052966 1869 dbSNP
rs1172984197 1872 dbSNP
rs1424698210 1874 dbSNP
rs991685363 1876 dbSNP
rs960261589 1882 dbSNP
rs938186065 1891 dbSNP
rs532419127 1892 dbSNP
rs547474070 1893 dbSNP
rs1434934414 1894 dbSNP
rs928904829 1895 dbSNP
rs926811691 1896 dbSNP
rs1373592110 1898 dbSNP
rs12168996 1903 dbSNP
rs560215401 1904 dbSNP
rs1194444529 1905 dbSNP
rs950394190 1911 dbSNP
rs968144485 1913 dbSNP
rs1480591304 1915 dbSNP
rs913913468 1924 dbSNP
rs1329265004 1934 dbSNP
rs1252469875 1937 dbSNP
rs2266966 1939 dbSNP
rs1319436851 1952 dbSNP
rs1199287478 1957 dbSNP
rs1280846894 1958 dbSNP
rs963187099 1974 dbSNP
rs1160523742 1988 dbSNP
rs146543523 1997 dbSNP
rs554349689 2000 dbSNP
rs34478799 2005 dbSNP
rs1019549996 2010 dbSNP
rs747504133 2013 dbSNP
rs1442376008 2017 dbSNP
rs953899542 2018 dbSNP
rs1329725762 2027 dbSNP
rs1028144033 2034 dbSNP
rs543854385 2041 dbSNP
rs180890833 2044 dbSNP
rs558514530 2046 dbSNP
rs867882001 2047 dbSNP
rs773761209 2053 dbSNP
rs772392712 2059 dbSNP
rs571834751 2069 dbSNP
rs896118520 2070 dbSNP
rs938797139 2072 dbSNP
rs538286144 2073 dbSNP
rs1056684075 2083 dbSNP
rs188377482 2084 dbSNP
rs553357191 2089 dbSNP
rs1420125732 2096 dbSNP
rs1480850429 2098 dbSNP
rs930254461 2113 dbSNP
rs61757964 2114 dbSNP
rs1388976381 2116 dbSNP
rs536954847 2124 dbSNP
rs973114262 2125 dbSNP
rs1350713580 2126 dbSNP
rs926810443 2134 dbSNP
rs567816780 2137 dbSNP
rs1017344024 2145 dbSNP
rs551244918 2148 dbSNP
rs946849324 2149 dbSNP
rs1354209105 2151 dbSNP
rs914001978 2153 dbSNP
rs1357283034 2160 dbSNP
rs1030142514 2162 dbSNP
rs186558310 2163 dbSNP
rs5755074 2166 dbSNP
rs551727861 2170 dbSNP
rs911893002 2171 dbSNP
rs528445538 2173 dbSNP
rs559710351 2174 dbSNP
rs1169617056 2175 dbSNP
rs7292198 2176 dbSNP
rs973947388 2189 dbSNP
rs1055848250 2193 dbSNP
rs373871234 2194 dbSNP
rs1015348155 2196 dbSNP
rs370867993 2197 dbSNP
rs558633135 2198 dbSNP
rs1380502805 2203 dbSNP
rs1338625840 2204 dbSNP
rs1229529357 2209 dbSNP
rs61757965 2217 dbSNP
rs896192376 2218 dbSNP
rs1226408084 2222 dbSNP
rs1034632953 2227 dbSNP
rs1278217396 2231 dbSNP
rs560744866 2237 dbSNP
rs760030879 2241 dbSNP
rs544041283 2242 dbSNP
rs1453358585 2249 dbSNP
rs1449171575 2254 dbSNP
rs1189788378 2267 dbSNP
rs1389883147 2274 dbSNP
rs376358786 2276 dbSNP
rs750362546 2278 dbSNP
rs770542649 2283 dbSNP
rs1378977683 2284 dbSNP
rs1466295502 2290 dbSNP
rs1301685207 2302 dbSNP
rs1399458283 2303 dbSNP
rs574973813 2308 dbSNP
rs1052560377 2313 dbSNP
rs910222338 2332 dbSNP
rs1182418443 2333 dbSNP
rs1432610819 2335 dbSNP
rs2266965 2338 dbSNP
rs1312991246 2342 dbSNP
rs1280164073 2346 dbSNP
rs1232811729 2352 dbSNP
rs1202946729 2353 dbSNP
rs1209859115 2354 dbSNP
rs757284306 2355 dbSNP
rs1286386526 2357 dbSNP
rs911920558 2359 dbSNP
rs563535023 2360 dbSNP
rs931947506 2367 dbSNP
rs1268502321 2373 dbSNP
rs751310691 2374 dbSNP
rs1174946650 2375 dbSNP
rs545105032 2377 dbSNP
rs1448812451 2378 dbSNP
rs572710296 2388 dbSNP
rs967698777 2393 dbSNP
rs1342305045 2397 dbSNP
rs1432896068 2400 dbSNP
rs1021506766 2405 dbSNP
rs1368055766 2408 dbSNP
rs1381807532 2409 dbSNP
rs974358455 2411 dbSNP
rs1352601951 2412 dbSNP
rs958671518 2417 dbSNP
rs962615509 2418 dbSNP
rs1002942819 2419 dbSNP
rs907307391 2420 dbSNP
rs61757966 2422 dbSNP
rs994379905 2431 dbSNP
rs1189881501 2434 dbSNP
rs755676679 2441 dbSNP
rs1473403232 2447 dbSNP
rs1182266352 2448 dbSNP
rs1474070924 2450 dbSNP
rs1455521244 2457 dbSNP
rs982526889 2461 dbSNP
rs1238640331 2462 dbSNP
rs1190408578 2463 dbSNP
rs1038580668 2473 dbSNP
rs1457186918 2476 dbSNP
rs960423041 2477 dbSNP
rs1263530138 2479 dbSNP
rs1372626620 2480 dbSNP
rs1410736246 2485 dbSNP
rs1050080887 2489 dbSNP
rs1287743842 2489 dbSNP
rs139775915 2489 dbSNP
rs910192949 2489 dbSNP
rs933054029 2490 dbSNP
rs1218493657 2491 dbSNP
rs923085897 2492 dbSNP
rs1489810475 2495 dbSNP
rs1290803253 2498 dbSNP
rs74907149 2499 dbSNP
rs1205442653 2500 dbSNP
rs1250360404 2505 dbSNP
rs1471341901 2507 dbSNP
rs1001887867 2511 dbSNP
rs1414411431 2517 dbSNP
rs1268487215 2519 dbSNP
rs1162424842 2523 dbSNP
rs1226861438 2529 dbSNP
rs117072070 2530 dbSNP
rs752354551 2532 dbSNP
rs1022548452 2534 dbSNP
rs1405633600 2545 dbSNP
rs1403366783 2550 dbSNP
rs1365284351 2552 dbSNP
rs1303557854 2573 dbSNP
rs1379077469 2574 dbSNP
rs764784990 2575 dbSNP
rs1304142890 2576 dbSNP
rs1011572845 2577 dbSNP
rs557575153 2578 dbSNP
rs1273425968 2587 dbSNP
rs1435765374 2594 dbSNP
rs1211597922 2605 dbSNP
rs1237612755 2605 dbSNP
rs1002913433 2613 dbSNP
rs971463227 2621 dbSNP
rs1391747459 2625 dbSNP
rs1449816678 2632 dbSNP
rs537668093 2636 dbSNP
rs34746140 2644 dbSNP
rs1388537180 2647 dbSNP
rs1474825792 2648 dbSNP
rs372965908 2652 dbSNP
rs994663558 2658 dbSNP
rs1489733166 2659 dbSNP
rs759090092 2659 dbSNP
rs35419717 2661 dbSNP
rs796633514 2665 dbSNP
rs1038957347 2667 dbSNP
rs1434790968 2668 dbSNP
rs776146376 2669 dbSNP
rs1295931666 2674 dbSNP
rs1453238361 2675 dbSNP
rs1007083818 2679 dbSNP
rs932002601 2691 dbSNP
rs1278656226 2701 dbSNP
rs890061862 2704 dbSNP
rs920587849 2706 dbSNP
rs1050050534 2709 dbSNP
rs772514985 2714 dbSNP
rs1187693372 2715 dbSNP
rs922931101 2724 dbSNP
rs762317955 2736 dbSNP
rs1435830383 2743 dbSNP
rs1192016317 2744 dbSNP
rs1041441683 2748 dbSNP
rs769396204 2749 dbSNP
rs774709408 2751 dbSNP
rs1161525438 2766 dbSNP
rs1390001764 2774 dbSNP
rs768968196 2778 dbSNP
rs190399700 2780 dbSNP
rs960501715 2783 dbSNP
rs535124520 2785 dbSNP
rs927727634 2788 dbSNP
rs1328829026 2790 dbSNP
rs565888388 2800 dbSNP
rs1221140890 2803 dbSNP
rs980891955 2804 dbSNP
rs1329707346 2807 dbSNP
rs971385521 2820 dbSNP
rs1281825378 2832 dbSNP
rs1453141954 2833 dbSNP
rs1400330982 2841 dbSNP
rs1246318567 2858 dbSNP
rs1172212158 2859 dbSNP
rs1026085556 2860 dbSNP
rs1184432859 2862 dbSNP
rs1479214645 2864 dbSNP
rs1472516578 2866 dbSNP
rs1428234324 2875 dbSNP
rs963148805 2891 dbSNP
rs549011845 2907 dbSNP
rs1323380777 2910 dbSNP
rs1348942405 2913 dbSNP
rs1022370924 2917 dbSNP
rs1289621039 2919 dbSNP
rs1350598579 2920 dbSNP
rs1011186636 2924 dbSNP
rs1478909692 2930 dbSNP
rs1230992268 2945 dbSNP
rs545597385 2949 dbSNP
rs1017042008 2959 dbSNP
rs1210196470 2961 dbSNP
rs1180933475 2963 dbSNP
rs747941425 2969 dbSNP
rs1259999616 2976 dbSNP
rs780186835 2987 dbSNP
rs890030742 2989 dbSNP
rs770173079 2996 dbSNP
rs1009076383 3000 dbSNP
rs1221268974 3001 dbSNP
rs780983137 3002 dbSNP
rs998409951 3004 dbSNP
rs1371584899 3007 dbSNP
rs1370691215 3012 dbSNP
rs901479295 3015 dbSNP
rs1041802125 3017 dbSNP
rs1383796323 3017 dbSNP
rs529927910 3022 dbSNP
rs1050537179 3024 dbSNP
rs1448094864 3034 dbSNP
rs1390287713 3049 dbSNP
rs548268218 3050 dbSNP
rs899190757 3052 dbSNP
rs530959719 3053 dbSNP
rs1283321235 3054 dbSNP
rs1357035208 3058 dbSNP
rs1230389888 3073 dbSNP
rs1275595391 3075 dbSNP
rs1038086262 3079 dbSNP
rs1482885870 3079 dbSNP
rs1258362677 3080 dbSNP
rs927112678 3083 dbSNP
rs995374493 3085 dbSNP
rs1187492137 3091 dbSNP
rs565030764 3095 dbSNP
rs1358183741 3104 dbSNP
rs545060976 3105 dbSNP
rs940680551 3106 dbSNP
rs76533939 3112 dbSNP
rs962827299 3122 dbSNP
rs1165585568 3130 dbSNP
rs1403735109 3132 dbSNP
rs1176411594 3138 dbSNP
rs1440230041 3141 dbSNP
rs1336033291 3144 dbSNP
rs1380559599 3147 dbSNP
rs781435839 3149 dbSNP
rs954186708 3152 dbSNP
rs939191396 3153 dbSNP
rs1225541894 3157 dbSNP
rs576697314 3164 dbSNP
rs530586348 3166 dbSNP
rs1181808531 3169 dbSNP
rs1257789406 3172 dbSNP
rs1345847621 3185 dbSNP
rs1460963576 3186 dbSNP
rs1029796676 3192 dbSNP
rs998433139 3193 dbSNP
rs565098203 3194 dbSNP
rs980582312 3195 dbSNP
rs544731594 3197 dbSNP
rs969531353 3198 dbSNP
rs1315365311 3203 dbSNP
rs914973238 3204 dbSNP
rs572943386 3206 dbSNP
rs956324839 3207 dbSNP
rs892814191 3221 dbSNP
rs1370214391 3223 dbSNP
rs559078947 3225 dbSNP
rs1452588998 3229 dbSNP
rs937093381 3233 dbSNP
rs1380707459 3235 dbSNP
rs1377747855 3237 dbSNP
rs905666737 3239 dbSNP
rs542681768 3241 dbSNP
rs1302928362 3248 dbSNP
rs1303640958 3248 dbSNP
rs1009149404 3252 dbSNP
rs559460140 3254 dbSNP
rs1343136708 3255 dbSNP
rs1261409175 3257 dbSNP
rs949980085 3258 dbSNP
rs8138018 3259 dbSNP
rs996297033 3261 dbSNP
rs1267842624 3263 dbSNP
rs35450537 3266 dbSNP
rs899266838 3267 dbSNP
rs1212047582 3268 dbSNP
rs1037764108 3273 dbSNP
rs941326532 3284 dbSNP
rs1004849325 3291 dbSNP
rs1423201094 3292 dbSNP
rs985479814 3292 dbSNP
rs1414554390 3297 dbSNP
rs886404482 3301 dbSNP
rs1344579959 3306 dbSNP
rs1183676809 3312 dbSNP
rs954156378 3316 dbSNP
rs922753748 3323 dbSNP
rs1404568490 3326 dbSNP
rs977361370 3332 dbSNP
rs17821423 3340 dbSNP
rs1489451605 3348 dbSNP
rs1021590768 3352 dbSNP
rs1306874937 3359 dbSNP
rs758179698 3362 dbSNP
rs140704383 3376 dbSNP
rs957001988 3378 dbSNP
rs185493615 3386 dbSNP
rs1221314880 3388 dbSNP
rs757459411 3396 dbSNP
rs1266106607 3402 dbSNP
rs749334944 3405 dbSNP
rs1045282967 3410 dbSNP
rs534804100 3411 dbSNP
rs1407141259 3413 dbSNP
rs566203539 3414 dbSNP
rs1417314056 3416 dbSNP
rs778175779 3418 dbSNP
rs905635554 3419 dbSNP
rs1045566540 3421 dbSNP
rs764826135 3422 dbSNP
rs1372683352 3426 dbSNP
rs914982238 3427 dbSNP
rs989205734 3429 dbSNP
rs555325481 3435 dbSNP
rs1014540891 3437 dbSNP
rs56681630 3438 dbSNP
rs770844346 3453 dbSNP
rs1362169069 3455 dbSNP
rs1359219828 3456 dbSNP
rs923592452 3456 dbSNP
rs557615960 3458 dbSNP
rs941307498 3470 dbSNP
rs1301080106 3471 dbSNP
rs954921745 3472 dbSNP
rs1029221760 3473 dbSNP
rs1183546283 3474 dbSNP
rs1350467660 3475 dbSNP
rs975332106 3479 dbSNP
rs963545625 3482 dbSNP
rs569732035 3483 dbSNP
rs1392240547 3489 dbSNP
rs550421410 3490 dbSNP
rs753283498 3492 dbSNP
rs1352860664 3495 dbSNP
rs1450770052 3503 dbSNP
rs1004922684 3505 dbSNP
rs886477922 3508 dbSNP
rs967240703 3509 dbSNP
rs1450899537 3521 dbSNP
rs1300344148 3532 dbSNP
rs1267126057 3533 dbSNP
rs530837463 3535 dbSNP
rs1209684841 3541 dbSNP
rs1214805228 3546 dbSNP
rs1489083972 3551 dbSNP
rs1267803041 3558 dbSNP
rs1271615262 3561 dbSNP
rs1305288333 3564 dbSNP
rs1223090437 3570 dbSNP
rs76937744 3573 dbSNP
rs1035642758 3574 dbSNP
rs61757967 3582 dbSNP
rs1218804326 3588 dbSNP
rs958305517 3595 dbSNP
rs1417691443 3598 dbSNP
rs1032660588 3600 dbSNP
rs906460808 3640 dbSNP
rs1044954551 3664 dbSNP
rs577851747 3666 dbSNP
rs112552081 3680 dbSNP
rs893636588 3685 dbSNP
rs1295174886 3690 dbSNP
rs1389864151 3691 dbSNP
rs1053566461 3701 dbSNP
rs1399566070 3702 dbSNP
rs1014009471 3703 dbSNP
rs1171481504 3704 dbSNP
rs528160895 3713 dbSNP
rs935054012 3717 dbSNP
rs762303474 3735 dbSNP
rs753020925 3737 dbSNP
rs1283441503 3738 dbSNP
rs1322657588 3759 dbSNP
rs767982681 3762 dbSNP
rs896959380 3786 dbSNP
rs743411 3790 dbSNP
rs987150894 3795 dbSNP
rs769041191 3802 dbSNP
rs888400848 3809 dbSNP
rs1198566776 3811 dbSNP
rs1347905284 3817 dbSNP
rs1428695065 3821 dbSNP
rs922188505 3823 dbSNP
rs974985242 3824 dbSNP
rs1049707807 3825 dbSNP
rs1162037037 3829 dbSNP
rs1390070454 3830 dbSNP
rs1400466832 3836 dbSNP
rs1316754494 3839 dbSNP
rs1343068160 3842 dbSNP
rs1438189400 3844 dbSNP
rs1303179543 3848 dbSNP
rs1344358039 3851 dbSNP
rs1221198208 3856 dbSNP
rs542763827 3866 dbSNP
rs932619572 3875 dbSNP
rs901176606 3880 dbSNP
rs963922125 3882 dbSNP
rs1223523373 3889 dbSNP
rs111897467 3890 dbSNP
rs193281803 3892 dbSNP
rs544079223 3902 dbSNP
rs1175944602 3907 dbSNP
rs1457725698 3921 dbSNP
rs914044632 3924 dbSNP
rs950785165 3925 dbSNP
rs1157123579 3930 dbSNP
rs763266762 3934 dbSNP
rs1035713864 3947 dbSNP
rs936904589 3949 dbSNP
rs61757968 3958 dbSNP
rs905823942 3965 dbSNP
rs1024012385 3968 dbSNP
rs752148806 3969 dbSNP
rs1336212907 3971 dbSNP
rs57416050 3976 dbSNP
rs1331421648 3977 dbSNP
rs746093588 3990 dbSNP
rs73149938 3996 dbSNP
rs572425382 4005 dbSNP
rs1357630080 4010 dbSNP
rs1053597988 4011 dbSNP
rs766850692 4014 dbSNP
rs999334566 4021 dbSNP
rs1180327571 4027 dbSNP
rs902275168 4029 dbSNP
rs1445597946 4031 dbSNP
rs1051479782 4042 dbSNP
rs1384220342 4046 dbSNP
rs1422370613 4051 dbSNP
rs1169086642 4052 dbSNP
rs1015837980 4057 dbSNP
rs1409257126 4069 dbSNP
rs1005373331 4071 dbSNP
rs932986187 4072 dbSNP
rs1376151212 4077 dbSNP
rs1453082624 4079 dbSNP
rs148762538 4084 dbSNP
rs1028157958 4086 dbSNP
rs535565058 4087 dbSNP
rs942284304 4091 dbSNP
rs1172174648 4097 dbSNP
rs996735691 4100 dbSNP
rs1251925152 4103 dbSNP
rs781417834 4109 dbSNP
rs983602890 4110 dbSNP
rs569668915 4111 dbSNP
rs950858202 4116 dbSNP
rs543313419 4130 dbSNP
rs1183304062 4138 dbSNP
rs34338438 4140 dbSNP
rs1157383298 4142 dbSNP
rs1241702197 4158 dbSNP
rs1442337686 4167 dbSNP
rs945435859 4168 dbSNP
rs1239381970 4172 dbSNP
rs981488303 4177 dbSNP
rs556185332 4178 dbSNP
rs1458745048 4179 dbSNP
rs1470258560 4186 dbSNP
rs189551916 4189 dbSNP
rs1022951150 4196 dbSNP
rs1403674857 4200 dbSNP
rs936791240 4203 dbSNP
rs1296536180 4205 dbSNP
rs1326130961 4213 dbSNP
rs1225333959 4218 dbSNP
rs1276698528 4221 dbSNP
rs1012599533 4223 dbSNP
rs143953363 4226 dbSNP
rs957997375 4227 dbSNP
rs926783432 4238 dbSNP
rs1261611466 4239 dbSNP
rs149893942 4250 dbSNP
rs1237757153 4251 dbSNP
rs528263571 4257 dbSNP
rs183670339 4260 dbSNP
rs916880482 4264 dbSNP
rs1480694435 4274 dbSNP
rs1175580295 4275 dbSNP
rs999369240 4276 dbSNP
rs1455141496 4277 dbSNP
rs961407791 4282 dbSNP
rs1309935082 4288 dbSNP
rs1380761951 4288 dbSNP
rs1304983952 4296 dbSNP
rs1448945650 4299 dbSNP
rs902311136 4310 dbSNP
rs1051552603 4311 dbSNP
rs777613957 4316 dbSNP
rs1240202261 4324 dbSNP
rs191469179 4325 dbSNP
rs9607264 4329 dbSNP
rs1038679377 4332 dbSNP
rs952524175 4336 dbSNP
rs1404704945 4337 dbSNP
rs758395556 4340 dbSNP
rs941668559 4341 dbSNP
rs1198139015 4343 dbSNP
rs1266681746 4348 dbSNP
rs565896245 4351 dbSNP
rs1419534850 4371 dbSNP
rs549056355 4378 dbSNP
rs1028125288 4381 dbSNP
rs747845541 4390 dbSNP
rs901114393 4391 dbSNP
rs1443341472 4402 dbSNP
rs1047927271 4403 dbSNP
rs929515821 4404 dbSNP
rs928797516 4405 dbSNP
rs764881386 4406 dbSNP
rs35774216 4410 dbSNP
rs139065119 4418 dbSNP
rs1306676330 4420 dbSNP
rs563266811 4423 dbSNP
rs1248689200 4425 dbSNP
rs1293474940 4426 dbSNP
rs1359794558 4428 dbSNP
rs1221001980 4432 dbSNP
rs1266171688 4433 dbSNP
rs548664471 4435 dbSNP
rs1177746915 4438 dbSNP
rs543445369 4438 dbSNP
rs1214135665 4440 dbSNP
rs186999078 4443 dbSNP
rs1417057086 4451 dbSNP
rs1185252211 4454 dbSNP
rs1000971791 4460 dbSNP
rs1286505997 4466 dbSNP
rs185077900 4467 dbSNP
rs1356375308 4469 dbSNP
rs1462909658 4480 dbSNP
rs1298084817 4486 dbSNP
rs1371882719 4491 dbSNP
rs1354176300 4496 dbSNP
rs990177507 4513 dbSNP
rs957565132 4517 dbSNP
rs1032266370 4519 dbSNP
rs999442801 4521 dbSNP
rs541377111 4526 dbSNP
rs572561483 4534 dbSNP
rs147346808 4536 dbSNP
rs918208254 4538 dbSNP
rs1037027663 4558 dbSNP
rs1399663919 4559 dbSNP
rs997699361 4565 dbSNP
rs1456437928 4568 dbSNP
rs371275641 4570 dbSNP
rs1300437304 4571 dbSNP
rs541916714 4576 dbSNP
rs576172460 4579 dbSNP
rs1444183118 4582 dbSNP
rs1182011105 4583 dbSNP
rs778691373 4591 dbSNP
rs556125780 4594 dbSNP
rs753553573 4600 dbSNP
rs1353201541 4609 dbSNP
rs1337749971 4610 dbSNP
rs192890753 4610 dbSNP
rs765861241 4611 dbSNP
rs983805686 4616 dbSNP
rs879436816 4621 dbSNP
rs59312009 4636 dbSNP
rs188805565 4639 dbSNP
rs534620056 4640 dbSNP
rs1045915841 4647 dbSNP
rs565830410 4648 dbSNP
rs1244055614 4652 dbSNP
rs956711378 4653 dbSNP
rs916003167 4661 dbSNP
rs1421606729 4664 dbSNP
rs990602224 4665 dbSNP
rs1000939261 4666 dbSNP
rs535771335 4672 dbSNP
rs1320762908 4677 dbSNP
rs1346529168 4680 dbSNP
rs1431027856 4681 dbSNP
rs1287729762 4693 dbSNP
rs1289125373 4697 dbSNP
rs1224861445 4699 dbSNP
rs768532355 4704 dbSNP
rs1283823722 4708 dbSNP
rs1210479974 4711 dbSNP
rs1217197904 4717 dbSNP
rs549242370 4721 dbSNP
rs1276396184 4723 dbSNP
rs535535506 4732 dbSNP
rs1317694940 4733 dbSNP
rs1215379001 4734 dbSNP
rs924601212 4736 dbSNP
rs746754721 4737 dbSNP
rs1261356732 4745 dbSNP
rs978033594 4746 dbSNP
rs966599697 4752 dbSNP
rs569800820 4755 dbSNP
rs556545559 4760 dbSNP
rs1477330940 4761 dbSNP
rs1030231284 4767 dbSNP
rs1409204682 4768 dbSNP
rs1400888771 4787 dbSNP
rs1157877402 4789 dbSNP
rs1358287713 4793 dbSNP
rs1280471317 4796 dbSNP
rs1344733660 4797 dbSNP
rs1434238900 4808 dbSNP
rs1434824151 4810 dbSNP
rs1373746904 4812 dbSNP
rs1223048060 4815 dbSNP
rs1284126281 4819 dbSNP
rs1361950641 4819 dbSNP
rs373622324 4819 dbSNP
rs1223236455 4820 dbSNP
rs1036591817 4825 dbSNP
rs1450344550 4841 dbSNP
rs940953844 4842 dbSNP
rs1330999908 4843 dbSNP
rs1234010131 4858 dbSNP
rs908204013 4858 dbSNP
rs1378028733 4860 dbSNP
rs183519889 4861 dbSNP
rs1163613781 4865 dbSNP
rs1048071545 4868 dbSNP
rs1403135657 4875 dbSNP
rs1330781050 4879 dbSNP
rs964867902 4885 dbSNP
rs532911775 4886 dbSNP
rs1441197247 4887 dbSNP
rs190746867 4900 dbSNP
rs187783631 4902 dbSNP
rs1385193103 4903 dbSNP
rs1006375525 4905 dbSNP
rs975576956 4909 dbSNP
rs887471896 4918 dbSNP
rs763531188 4920 dbSNP
rs1274307763 4921 dbSNP
rs993098434 4922 dbSNP
rs775930891 4923 dbSNP
rs1464776984 4925 dbSNP
rs1446038243 4926 dbSNP
rs1423969276 4952 dbSNP
rs1367579047 4954 dbSNP
rs912405140 4960 dbSNP
rs1169207418 4969 dbSNP
rs988049524 4972 dbSNP
rs775517226 4986 dbSNP
rs1476943991 4987 dbSNP
rs1408070377 4989 dbSNP
rs1046369147 4992 dbSNP
rs1453158078 4995 dbSNP
rs948915339 4997 dbSNP
rs894635190 5000 dbSNP
rs1229698388 5013 dbSNP
rs1054582768 5024 dbSNP
rs1339246336 5026 dbSNP
rs936059191 5027 dbSNP
rs1032326874 5028 dbSNP
rs1462027371 5031 dbSNP
rs1000900402 5032 dbSNP
rs765764285 5035 dbSNP
rs977438853 5037 dbSNP
rs1440339037 5039 dbSNP
rs182045585 5043 dbSNP
rs1373175026 5044 dbSNP
rs1477433472 5045 dbSNP
rs933952001 5046 dbSNP
rs969385075 5055 dbSNP
rs1048752 5060 dbSNP
rs923220401 5063 dbSNP
rs369882007 5079 dbSNP
rs561937736 5080 dbSNP
rs1014104937 5081 dbSNP
rs142929571 5082 dbSNP
rs1803546 5083 dbSNP
rs759823197 5090 dbSNP
rs576108680 5091 dbSNP
rs1344691291 5105 dbSNP
rs951814770 5107 dbSNP
rs189893697 5108 dbSNP
rs1398278156 5109 dbSNP
rs993129329 5110 dbSNP
rs1285732829 5116 dbSNP
rs562616863 5132 dbSNP
rs1254646686 5133 dbSNP
rs1342381270 5135 dbSNP
rs888069827 5149 dbSNP
rs1262045649 5156 dbSNP
rs1375418375 5158 dbSNP
rs1048042551 5159 dbSNP
rs575788846 5160 dbSNP
rs1400538573 5161 dbSNP
rs1172038649 5163 dbSNP
rs545998937 5165 dbSNP
rs1480725775 5175 dbSNP
rs1175028849 5177 dbSNP
rs930946879 5184 dbSNP
rs1375751384 5185 dbSNP
rs771105424 5188 dbSNP
rs1159342831 5191 dbSNP
rs1412425632 5193 dbSNP
rs1424121759 5195 dbSNP
rs749386600 5197 dbSNP
rs943799989 5200 dbSNP
rs186313665 5203 dbSNP
rs1478959082 5206 dbSNP
rs1346627194 5207 dbSNP
rs1013579806 5209 dbSNP
rs375325360 5210 dbSNP
rs1337876081 5217 dbSNP
rs1178065594 5218 dbSNP
rs1458237792 5221 dbSNP
rs1286270905 5222 dbSNP
rs747024060 5226 dbSNP
rs1352617484 5227 dbSNP
rs1240125948 5231 dbSNP
rs1213741573 5241 dbSNP
rs1293345965 5255 dbSNP
rs1490481611 5259 dbSNP
rs935225331 5261 dbSNP
rs41282607 5264 dbSNP
rs979344514 5266 dbSNP
rs1055015279 5270 dbSNP
rs1311834224 5299 dbSNP
rs969352503 5306 dbSNP
rs1379839270 5308 dbSNP
rs771844158 5311 dbSNP
rs992241054 5313 dbSNP
rs1366311007 5315 dbSNP
rs1479456327 5320 dbSNP
rs961098524 5321 dbSNP
rs903282938 5322 dbSNP
rs1392331002 5323 dbSNP
rs1308995409 5327 dbSNP
rs1375623913 5328 dbSNP
rs1309228246 5329 dbSNP
rs748116881 5330 dbSNP
rs1041789462 5333 dbSNP
rs534911696 5345 dbSNP
rs756250271 5351 dbSNP
rs1376934859 5352 dbSNP
rs181531099 5355 dbSNP
rs1220260762 5362 dbSNP
rs1263603567 5364 dbSNP
rs922585992 5368 dbSNP
rs887955242 5385 dbSNP
rs1237362726 5389 dbSNP
rs1445347755 5395 dbSNP
rs1485496039 5399 dbSNP
rs1185626532 5406 dbSNP
rs1027824747 5408 dbSNP
rs1386151161 5408 dbSNP
rs555585528 5412 dbSNP
rs1358273952 5416 dbSNP
rs1375218237 5419 dbSNP
rs535674078 5429 dbSNP
rs569887053 5430 dbSNP
rs899481432 5431 dbSNP
rs1454960752 5436 dbSNP
rs1338276229 5437 dbSNP
rs1379523530 5447 dbSNP
rs943261916 5449 dbSNP
rs1039807272 5451 dbSNP
rs138946992 5457 dbSNP
rs532971539 5458 dbSNP
rs984600813 5461 dbSNP
rs1219210548 5463 dbSNP
rs1257394952 5471 dbSNP
rs147211986 5474 dbSNP
rs1238267268 5481 dbSNP
rs1180261762 5494 dbSNP
rs141737757 5496 dbSNP
rs1483041677 5500 dbSNP
rs1421770456 5501 dbSNP
rs935110004 5506 dbSNP
rs1238318744 5511 dbSNP
rs551481898 5513 dbSNP
rs971782947 5518 dbSNP
rs547118932 5519 dbSNP
rs371994844 5524 dbSNP
rs1431338264 5525 dbSNP
rs1300522334 5527 dbSNP
rs1285784351 5529 dbSNP
rs979313229 5532 dbSNP
rs1400137051 5541 dbSNP
rs947979218 5550 dbSNP
rs191493119 5551 dbSNP
rs959233966 5556 dbSNP
rs992606998 5558 dbSNP
rs1311778612 5560 dbSNP
rs1208242320 5564 dbSNP
rs960815125 5566 dbSNP
rs562075826 5572 dbSNP
rs907917587 5574 dbSNP
rs1033234198 5575 dbSNP
rs1261571246 5576 dbSNP
rs61757972 5581 dbSNP
rs868498860 5582 dbSNP
rs1424939593 5583 dbSNP
rs1226162941 5585 dbSNP
rs1413163965 5588 dbSNP
rs375379789 5590 dbSNP
rs1419776311 5591 dbSNP
rs559731000 5599 dbSNP
rs903314018 5600 dbSNP
rs1416267744 5610 dbSNP
rs1358325553 5614 dbSNP
rs531758194 5619 dbSNP
rs1406721140 5622 dbSNP
rs562948132 5624 dbSNP
rs1366614638 5627 dbSNP
rs546230398 5632 dbSNP
rs965358909 5636 dbSNP
rs1215908478 5641 dbSNP
rs1354689156 5641 dbSNP
rs1162745441 5644 dbSNP
rs1490971712 5644 dbSNP
rs1200155324 5645 dbSNP
rs1246690469 5648 dbSNP
rs1423361652 5651 dbSNP
rs1414669566 5652 dbSNP
rs1179392137 5663 dbSNP
rs371804640 5664 dbSNP
rs1381709999 5665 dbSNP
rs1190272784 5671 dbSNP
rs577310938 5680 dbSNP
rs560527870 5689 dbSNP
rs1358111713 5693 dbSNP
rs186857371 5695 dbSNP
rs1194916053 5696 dbSNP
rs148024045 5697 dbSNP
rs368450070 5698 dbSNP
rs755820827 5701 dbSNP
rs542634378 5707 dbSNP
rs1221513857 5715 dbSNP
rs890797293 5716 dbSNP
rs1239731385 5720 dbSNP
rs1052590063 5726 dbSNP
rs910465594 5730 dbSNP
rs1361656879 5731 dbSNP
rs1210573846 5735 dbSNP
rs1289793915 5743 dbSNP
rs999287306 5748 dbSNP
rs903675187 5756 dbSNP
rs1338052624 5757 dbSNP
rs1277321864 5761 dbSNP
rs542160539 5763 dbSNP
rs1200409606 5766 dbSNP
rs576259549 5772 dbSNP
rs1163335587 5778 dbSNP
rs372006235 5783 dbSNP
rs749846889 5786 dbSNP
rs1056392565 5789 dbSNP
rs556133291 5790 dbSNP
rs1350487365 5792 dbSNP
rs1167201664 5797 dbSNP
rs907889636 5809 dbSNP
rs1329549641 5812 dbSNP
rs1385346941 5814 dbSNP
rs930515705 5818 dbSNP
rs919085387 5820 dbSNP
rs1283691955 5825 dbSNP
rs143312246 5826 dbSNP
rs1423240931 5833 dbSNP
rs767058268 5836 dbSNP
rs920745917 5837 dbSNP
rs1430620183 5845 dbSNP
rs1317668042 5847 dbSNP
rs971818726 5848 dbSNP
rs964985227 5864 dbSNP
rs1019573359 5870 dbSNP
rs1191065808 5871 dbSNP
rs1236414596 5874 dbSNP
rs1009168273 5876 dbSNP
rs971538428 5885 dbSNP
rs748470465 5886 dbSNP
rs1030699417 5889 dbSNP
rs758827595 5891 dbSNP
rs1404549934 5894 dbSNP
rs1396851044 5897 dbSNP
rs570488119 5906 dbSNP
rs781241029 5906 dbSNP
rs1338747226 5916 dbSNP
rs553708955 5917 dbSNP
rs1317844250 5921 dbSNP
rs529637329 5925 dbSNP
rs760021073 5926 dbSNP
rs967566860 5931 dbSNP
rs1020445638 5936 dbSNP
rs1200641511 5939 dbSNP
rs1308990753 5944 dbSNP
rs1277535098 5946 dbSNP
rs998341507 5949 dbSNP
rs1195304802 5960 dbSNP
rs1386083040 5962 dbSNP
rs772210640 5963 dbSNP
rs1327978115 5968 dbSNP
rs1191182206 5978 dbSNP
rs907856432 5981 dbSNP
rs181651890 5983 dbSNP
rs376407455 5986 dbSNP
rs13058 5991 dbSNP
rs1048998847 5993 dbSNP
rs1463732591 5995 dbSNP
rs920714818 6002 dbSNP
rs1398724760 6003 dbSNP
rs930551354 6012 dbSNP
rs897688340 6013 dbSNP
rs1273880977 6018 dbSNP
rs375554609 6040 dbSNP
rs766466362 6051 dbSNP
rs544087178 6062 dbSNP
rs1434243470 6064 dbSNP
rs1397485442 6066 dbSNP
rs367989807 6070 dbSNP
rs1456039649 6071 dbSNP
rs943507280 6078 dbSNP
rs912074736 6079 dbSNP
rs988113839 6084 dbSNP
rs956338615 6085 dbSNP
rs867084189 6096 dbSNP
rs868213923 6097 dbSNP
rs578219094 6099 dbSNP
rs1159288501 6100 dbSNP
rs916993733 6101 dbSNP
rs548435738 6104 dbSNP
rs977786891 6119 dbSNP
rs1195964640 6122 dbSNP
rs991214916 6126 dbSNP
rs1392163344 6131 dbSNP
rs1386500056 6133 dbSNP
rs1481415787 6146 dbSNP
rs531884391 6151 dbSNP
rs760961716 6161 dbSNP
rs937043206 6162 dbSNP
rs569428820 6163 dbSNP
rs1003854042 6168 dbSNP
rs373690873 6172 dbSNP
rs925602348 6175 dbSNP
rs552533747 6179 dbSNP
rs1267143316 6182 dbSNP
rs1488773370 6186 dbSNP
rs1208968525 6189 dbSNP
rs773095348 6191 dbSNP
rs886399391 6195 dbSNP
rs1376178957 6198 dbSNP
rs967640372 6200 dbSNP
rs1020519358 6203 dbSNP
rs977331901 6206 dbSNP
rs930613692 6209 dbSNP
rs779634218 6223 dbSNP
rs751828691 6225 dbSNP
rs1018813554 6231 dbSNP
rs899188434 6237 dbSNP
rs1006966538 6238 dbSNP
rs772257682 6239 dbSNP
rs1026926187 6241 dbSNP
rs748063982 6243 dbSNP
rs897761902 6246 dbSNP
rs1448046968 6255 dbSNP
rs1331596971 6256 dbSNP
rs912027279 6267 dbSNP
rs987696088 6267 dbSNP
rs1314274258 6272 dbSNP
rs558351908 6275 dbSNP
rs1202165695 6276 dbSNP
rs1322211020 6279 dbSNP
rs934898863 6283 dbSNP
rs1036248324 6288 dbSNP
rs1157331413 6288 dbSNP
rs1199106501 6291 dbSNP
rs1237722275 6293 dbSNP
rs1439641260 6294 dbSNP
rs149163217 6299 dbSNP
rs924822019 6305 dbSNP
rs189308915 6312 dbSNP
rs1163267099 6315 dbSNP
rs1426484924 6317 dbSNP
rs1466468019 6321 dbSNP
rs1170419884 6327 dbSNP
rs774319089 6329 dbSNP
rs1420493234 6341 dbSNP
rs1304269629 6344 dbSNP
rs540752694 6345 dbSNP
rs1379229468 6364 dbSNP
rs967682948 6369 dbSNP
rs1291355389 6374 dbSNP
rs768408671 6377 dbSNP
rs138241462 6383 dbSNP
rs1021983793 6384 dbSNP
rs755512060 6385 dbSNP
rs1212477245 6387 dbSNP
rs1256863052 6392 dbSNP
rs184931478 6399