miRTarBase - #MIRT668166 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GDE1   
Synonyms 363E6.2, MIR16
Description glycerophosphodiester phosphodiesterase 1
Transcript NM_016641   
Expression
Putative miRNA Targets on GDE1
3'UTR of GDE1
(miRNA target sites are highlighted)
>GDE1|NM_016641|3'UTR
   1 ACTTTCACGGTGGGACGAAACGGGTTCAGAAACTGCCAGGGGCCTCATACAGGGATATCAAAATACCCTTTGTGCTAGCC
  81 CAGGCCCTGGGGAATCAGGTGACTCACACAAATGCAATAGTTGGTCACTGCATTTTTACCTGAACCAAAGCTAAACCCGG
 161 TGTTGCCACCATGCACCATGGCATGCCAGAGTTCAACACTGTTGCTCTTGAAAATCTGGGTCTGAAAAAACGCACAAGAG
 241 CCCCTGCCCTGCCCTAGCTGAGGCACACAGGGAGACCCAGTGAGGATAAGCACAGATTGAATTGTACAGTTTGCAGATGC
 321 AGATGTAAATGCATGGGACATGCATGATAACTCAGAGTTGACATTTTAAAACTTGCCACACTTATTTCAAATATTTGTAC
 401 TCAGCTATGTTAACATGTACTGTAGACATCAAACTTGTGGCCATACTAATAAAATTATTAAAAGGAGCACTAAAGGAAAA
 481 CTGTGTGCCAAGCATCATATCCTAAGGCATACGGAATTTGGGGAAGCCACCATGCAATCCAGTGAGGCTTCAGTGTACAG
 561 CAACCAAAATGGTAGGGAGGTCTTGAAGCCAATGAGGGATTTATAGCATCTTGAATAGAGAGCTGCAAACCACCAGGGGG
 641 CAGAGTTGCATTTTTCCAGGCTTTTTAGGAAGCTCTGCAACAGATGTGATCTGATCATAGGCAATTAGAACTGGAAGAAA
 721 CTTCCAAAAATATCTAGGTTTGTCCTCATTTTACAAATGAGGAAACTAAACTCTGTGGAAGGGAAGGGGTTGCCTCAAAA
 801 GTCACAGCTTAGCTGGGCACAGTGGCTCATGCCGATAATCCCAGCAATTCAGAAAGCTGAGGCAGGAGGATTACTTGAGG
 881 CCAGACTGGGCAATATAGCAAGACCCCATCTCTAAAAAATTAGGCATGGTGGTGCATGCCTGTATTCCCAGCTACTCAGG
 961 AGGTTGAGGTGGGAGGATCACTTGAGCCCAGAAGTTCAAGGCTGCAATGAGCCATGATTACACCACGGCACTACAACCTT
1041 GGTGGCACAGTGAGAACCTGACTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATAACTAGAACTTCTAGAACATCT
1121 TGTTTACAGTTAGCCAGAAACTATACAAGTGGTTTAACATGCATTATCTTACTCAATCCATACAAAAGTCTTATGGAGGT
1201 GTTAGCACTCTTTCTACTGATGAAGAACTGAGGTACTTCATAAAACCACTTACCCAAGGTGTCTTGAGTCTGGTACAACT
1281 GGCATTCAAATCTAGGTCAGTCTGCCCCCAGAGCCACTACCCTTACCCCTCACTGAATCTGCCTTTATATTGTTGAGCCC
1361 ATGACCCCAAACTGCTCTTTCCAATTTGAACTTCCAGGGATTTTATTGTGAACTTACATAGCAACATTAAAATGAAGTTG
1441 AATTGTTTTTAATGGCAACGCCGTCTGTCTCCTCTAGCTTACCGCTTCTCACCTTTCAACCCCATCTGTGGCCTTTGTCC
1521 AGGCCCACAGCTTAGCCATGGCTTCCCTCCTGCATCCCTGCCGTGGGTTGCTGGCCTCACACTTGCAGCAGCTGGACAGT
1601 GATTTTAGAAGGCCACCAGTCCCCATAGCTATGTGACAATGAGAAGCAAACTTTTTTGTGACAGATTGTATTGGCATAGG
1681 CATGATAGATGGGGATTGGTACGTTTTGAATCAGCATTTGCAAAAAAATTGTCTTGAATTTTAAAATAAACAACAAAGAT
1761 TTGTTCATTGAGTGCAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGgu 5'
            || ||  ||| ||||||:  
Target 5' ttAAAAC--TTGCCACACTTat 3'
366 - 385 128.00 -8.90
2
miRNA  3' guuUGUGGUAACAG--UGUGAggu 5'
             |::|||  ||:  |||||   
Target 5' ggcATGCCAGAGTTCAACACTgtt 3'
180 - 203 117.00 -9.30
3
miRNA  3' guuugugguaACAG-UGUGAGGu 5'
                    |||: :|||||: 
Target 5' cttatggaggTGTTAGCACTCTt 3'
1190 - 1212 116.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31585155 17 COSMIC
COSN31598050 21 COSMIC
COSN30577852 59 COSMIC
COSN30494902 65 COSMIC
COSN30447875 68 COSMIC
COSN31602377 79 COSMIC
COSN30103175 81 COSMIC
COSN30454977 92 COSMIC
COSN31508981 125 COSMIC
COSN8230199 126 COSMIC
COSN30577714 144 COSMIC
COSN31602539 188 COSMIC
COSN23641719 488 COSMIC
COSN23191467 1050 COSMIC
COSN6081170 1182 COSMIC
COSN32150645 1219 COSMIC
COSN8391077 1245 COSMIC
COSN24952865 1453 COSMIC
COSN21516386 1768 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747575581 5 dbSNP
rs770737790 5 dbSNP
rs1341784379 7 dbSNP
rs201160961 8 dbSNP
rs757947752 9 dbSNP
rs1325676021 11 dbSNP
rs778448691 14 dbSNP
rs562476032 16 dbSNP
rs1044644814 17 dbSNP
rs372112650 19 dbSNP
rs1412238952 21 dbSNP
rs764064115 22 dbSNP
rs756105412 31 dbSNP
rs202202853 35 dbSNP
rs766545567 36 dbSNP
rs762964578 40 dbSNP
rs1167532071 42 dbSNP
rs930997096 44 dbSNP
rs773445992 48 dbSNP
rs1257398108 50 dbSNP
rs765383538 51 dbSNP
rs972523456 54 dbSNP
rs1041582880 60 dbSNP
rs574197701 61 dbSNP
rs1011452499 66 dbSNP
rs943852302 67 dbSNP
rs1157531849 72 dbSNP
rs555491834 76 dbSNP
rs534239283 77 dbSNP
rs985291658 78 dbSNP
rs953958930 79 dbSNP
rs184843372 83 dbSNP
rs1403983999 84 dbSNP
rs1433148309 91 dbSNP
rs1261759104 93 dbSNP
rs1279809884 97 dbSNP
rs1056070256 106 dbSNP
rs1221914962 108 dbSNP
rs1283465668 109 dbSNP
rs558011192 117 dbSNP
rs1021579793 124 dbSNP
rs937095927 126 dbSNP
rs1484653298 137 dbSNP
rs1294074606 145 dbSNP
rs1284867535 150 dbSNP
rs1198389541 153 dbSNP
rs773525301 158 dbSNP
rs539484386 159 dbSNP
rs1175916839 160 dbSNP
rs1380163294 172 dbSNP
rs990515336 175 dbSNP
rs1349752694 177 dbSNP
rs1045496121 180 dbSNP
rs956071572 187 dbSNP
rs772292696 189 dbSNP
rs192796293 190 dbSNP
rs1428180596 201 dbSNP
rs550842789 203 dbSNP
rs535898301 204 dbSNP
rs1355979802 214 dbSNP
rs1232389537 231 dbSNP
rs186701458 231 dbSNP
rs564469686 232 dbSNP
rs1248123489 233 dbSNP
rs1002975674 242 dbSNP
rs1357345872 245 dbSNP
rs1384001322 254 dbSNP
rs1338598485 255 dbSNP
rs549164343 260 dbSNP
rs1273970843 266 dbSNP
rs1435617049 268 dbSNP
rs1202806733 271 dbSNP
rs1237985670 272 dbSNP
rs1023125522 282 dbSNP
rs1445659391 286 dbSNP
rs1013124594 297 dbSNP
rs887987465 298 dbSNP
rs774783879 301 dbSNP
rs7135 309 dbSNP
rs1383983368 310 dbSNP
rs146678235 324 dbSNP
rs920077977 334 dbSNP
rs976009112 340 dbSNP
rs896837329 344 dbSNP
rs1465931655 346 dbSNP
rs758729768 355 dbSNP
rs570056516 358 dbSNP
rs1454422331 375 dbSNP
rs1020088710 379 dbSNP
rs374313286 382 dbSNP
rs1037130376 389 dbSNP
rs1008320913 392 dbSNP
rs943778174 407 dbSNP
rs779919317 408 dbSNP
rs967313338 409 dbSNP
rs1341686234 414 dbSNP
rs1426202965 422 dbSNP
rs1261896788 426 dbSNP
rs183920599 428 dbSNP
rs1257720137 430 dbSNP
rs1188179753 440 dbSNP
rs76065554 441 dbSNP
rs1011442784 452 dbSNP
rs1053138 467 dbSNP
rs893085977 483 dbSNP
rs543974197 484 dbSNP
rs573647601 485 dbSNP
rs561967642 488 dbSNP
rs1169492284 492 dbSNP
rs540454479 494 dbSNP
rs914436684 496 dbSNP
rs990095650 512 dbSNP
rs1173997657 513 dbSNP
rs1401348213 515 dbSNP
rs1382740428 518 dbSNP
rs1320251705 531 dbSNP
rs956209393 535 dbSNP
rs760470244 536 dbSNP
rs1225216074 542 dbSNP
rs1277798802 545 dbSNP
rs1324536569 548 dbSNP
rs924616404 554 dbSNP
rs1254655945 555 dbSNP
rs1277683121 563 dbSNP
rs981468136 571 dbSNP
rs971463332 576 dbSNP
rs1206209525 579 dbSNP
rs1357620320 585 dbSNP
rs1444768072 590 dbSNP
rs1332533903 592 dbSNP
rs1045850684 593 dbSNP
rs1023058493 594 dbSNP
rs745819260 606 dbSNP
rs1397735482 613 dbSNP
rs1048787490 615 dbSNP
rs1464554085 626 dbSNP
rs1454162159 629 dbSNP
rs1160210319 637 dbSNP
rs1422232781 641 dbSNP
rs1382780528 649 dbSNP
rs2521795 651 dbSNP
rs1475949975 657 dbSNP
rs1028299613 669 dbSNP
rs756817784 675 dbSNP
rs975703923 676 dbSNP
rs1299524066 677 dbSNP
rs1330865761 682 dbSNP
rs993747934 684 dbSNP
rs1352160846 685 dbSNP
rs964527165 689 dbSNP
rs898102539 692 dbSNP
rs912734301 697 dbSNP
rs1438163337 700 dbSNP
rs987288924 708 dbSNP
rs1490708726 710 dbSNP
rs1036650974 714 dbSNP
rs1219768860 715 dbSNP
rs1007890432 716 dbSNP
rs890834144 732 dbSNP
rs1020231062 733 dbSNP
rs1193965467 735 dbSNP
rs1183723337 736 dbSNP
rs567896122 747 dbSNP
rs990135409 756 dbSNP
rs1257443765 760 dbSNP
rs999618385 764 dbSNP
rs371782878 774 dbSNP
rs1282634082 775 dbSNP
rs1291990905 775 dbSNP
rs1390375704 778 dbSNP
rs575555435 781 dbSNP
rs1336692001 782 dbSNP
rs1375266975 785 dbSNP
rs1316409811 789 dbSNP
rs1360959583 802 dbSNP
rs1218825715 803 dbSNP
rs914427925 816 dbSNP
rs1480760064 821 dbSNP
rs1054718345 825 dbSNP
rs191486957 830 dbSNP
rs1024175320 833 dbSNP
rs542703368 834 dbSNP
rs1184109284 836 dbSNP
rs1325914025 839 dbSNP
rs1446521009 848 dbSNP
rs368324124 865 dbSNP
rs1411069351 871 dbSNP
rs1162249407 877 dbSNP
rs1462709732 884 dbSNP
rs3179016 897 dbSNP
rs1048860529 908 dbSNP
rs930267944 919 dbSNP
rs1365276670 920 dbSNP
rs1385620252 927 dbSNP
rs971396340 931 dbSNP
rs915969419 932 dbSNP
rs900174176 938 dbSNP
rs1229122902 940 dbSNP
rs1040322023 942 dbSNP
rs1215551080 943 dbSNP
rs758070615 945 dbSNP
rs3179017 954 dbSNP
rs952252653 957 dbSNP
rs3179018 958 dbSNP
rs946118632 959 dbSNP
rs143264388 961 dbSNP
rs374108871 962 dbSNP
rs1421842604 967 dbSNP
rs565644523 969 dbSNP
rs1019159815 970 dbSNP
rs1177613300 976 dbSNP
rs553479416 981 dbSNP
rs957560186 986 dbSNP
rs534009195 989 dbSNP
rs766771810 996 dbSNP
rs11551688 1001 dbSNP
rs1302814530 1004 dbSNP
rs890802496 1007 dbSNP
rs1049444049 1010 dbSNP
rs187785060 1019 dbSNP
rs996588418 1024 dbSNP
rs551433202 1026 dbSNP
rs1156533654 1027 dbSNP
rs1438840350 1038 dbSNP
rs1223836782 1042 dbSNP
rs1395515219 1049 dbSNP
rs1264794877 1050 dbSNP
rs1054287350 1052 dbSNP
rs1195387346 1063 dbSNP
rs1310329929 1064 dbSNP
rs866008778 1064 dbSNP
rs3179019 1067 dbSNP
rs980417669 1070 dbSNP
rs1486232516 1071 dbSNP
rs934528271 1077 dbSNP
rs1477016027 1083 dbSNP
rs1245002418 1087 dbSNP
rs1198264433 1088 dbSNP
rs1447730175 1089 dbSNP
rs1288419869 1093 dbSNP
rs1214792526 1094 dbSNP
rs1353409168 1095 dbSNP
rs1175964010 1096 dbSNP
rs1200545439 1096 dbSNP
rs1218495782 1096 dbSNP
rs1218815977 1096 dbSNP
rs1223472099 1096 dbSNP
rs1284008180 1096 dbSNP
rs1295828282 1096 dbSNP
rs1307540387 1096 dbSNP
rs1318669956 1096 dbSNP
rs1339391418 1096 dbSNP
rs1346382255 1096 dbSNP
rs1365207635 1096 dbSNP
rs1405214970 1096 dbSNP
rs1413172899 1096 dbSNP
rs1427657080 1096 dbSNP
rs1454836025 1096 dbSNP
rs1479124664 1096 dbSNP
rs59519757 1096 dbSNP
rs1248736495 1098 dbSNP
rs1281534309 1098 dbSNP
rs1477243615 1098 dbSNP
rs1237083701 1101 dbSNP
rs148514696 1101 dbSNP
rs971367540 1103 dbSNP
rs924488676 1106 dbSNP
rs1273664187 1121 dbSNP
rs1442111930 1125 dbSNP
rs1045692231 1129 dbSNP
rs556721350 1143 dbSNP
rs1327745049 1152 dbSNP
rs915897293 1154 dbSNP
rs991517652 1159 dbSNP
rs3180351 1163 dbSNP
rs930738800 1176 dbSNP
rs920718366 1182 dbSNP
rs533205972 1198 dbSNP
rs1027374306 1219 dbSNP
rs972221566 1224 dbSNP
rs1279942453 1228 dbSNP
rs1375386697 1228 dbSNP
rs1237828029 1229 dbSNP
rs994592090 1248 dbSNP
rs1353065124 1249 dbSNP
rs148644736 1258 dbSNP
rs550523796 1264 dbSNP
rs1450102486 1266 dbSNP
rs1221234489 1267 dbSNP
rs1233849144 1274 dbSNP
rs987700158 1276 dbSNP
rs1412630380 1295 dbSNP
rs1177292690 1296 dbSNP
rs1380294261 1297 dbSNP
rs1444641073 1301 dbSNP
rs942935162 1302 dbSNP
rs1404425928 1310 dbSNP
rs891403306 1312 dbSNP
rs1187106021 1315 dbSNP
rs953651972 1317 dbSNP
rs1027932187 1321 dbSNP
rs1402167924 1327 dbSNP
rs1051307720 1333 dbSNP
rs946182368 1339 dbSNP
rs1383448001 1342 dbSNP
rs996950107 1346 dbSNP
rs913403632 1359 dbSNP
rs144020066 1361 dbSNP
rs1191727897 1365 dbSNP
rs1274041765 1367 dbSNP
rs1320434439 1368 dbSNP
rs370395981 1370 dbSNP
rs561481932 1374 dbSNP
rs1462172154 1392 dbSNP
rs1188968488 1396 dbSNP
rs149921525 1399 dbSNP
rs1472204716 1422 dbSNP
rs998671930 1425 dbSNP
rs183890769 1428 dbSNP
rs1168120036 1434 dbSNP
rs927272095 1454 dbSNP
rs2856615 1459 dbSNP
rs771327832 1460 dbSNP
rs564295381 1462 dbSNP
rs367803566 1463 dbSNP
rs575857848 1472 dbSNP
rs193031971 1476 dbSNP
rs1275796056 1483 dbSNP
rs577484272 1484 dbSNP
rs1027529122 1485 dbSNP
rs930643653 1493 dbSNP
rs574867373 1501 dbSNP
rs45457396 1503 dbSNP
rs1217129606 1505 dbSNP
rs1257856463 1508 dbSNP
rs1324761542 1509 dbSNP
rs1202676592 1511 dbSNP
rs1277188831 1516 dbSNP
rs964523268 1519 dbSNP
rs1193285925 1520 dbSNP
rs557743284 1522 dbSNP
rs1017672226 1528 dbSNP
rs553544849 1531 dbSNP
rs1008542731 1536 dbSNP
rs890123513 1543 dbSNP
rs1170730176 1551 dbSNP
rs1401494692 1554 dbSNP
rs114006199 1562 dbSNP
rs188542040 1563 dbSNP
rs1362648396 1570 dbSNP
rs1398345239 1571 dbSNP
rs891955351 1574 dbSNP
rs1054579923 1586 dbSNP
rs1411630637 1623 dbSNP
rs10572 1625 dbSNP
rs912041234 1633 dbSNP
rs1273520496 1635 dbSNP
rs1344944305 1639 dbSNP
rs987626669 1651 dbSNP
rs927377234 1659 dbSNP
rs1287585940 1666 dbSNP
rs1487045828 1675 dbSNP
rs1215414414 1683 dbSNP
rs1269230322 1686 dbSNP
rs183273232 1687 dbSNP
rs569162447 1694 dbSNP
rs1196495453 1699 dbSNP
rs550586177 1702 dbSNP
rs528897579 1703 dbSNP
rs567717515 1710 dbSNP
rs1418839788 1715 dbSNP
rs745636834 1719 dbSNP
rs950046634 1721 dbSNP
rs1297812982 1728 dbSNP
rs917258053 1729 dbSNP
rs1388832529 1754 dbSNP
rs1237303481 1757 dbSNP
rs1205784463 1758 dbSNP
rs1330994982 1759 dbSNP
rs1459499553 1763 dbSNP
rs1255541667 1767 dbSNP
rs983366129 1768 dbSNP
rs1217491084 1775 dbSNP
rs546294407 1778 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       ::|||||| 
Target 5' ------------cUGCACUCCa 3'
1 - 10
2
miRNA  3' guuUGUGGUAAC-AG-UGUGAGGu 5'
             | :|||  |  | | ||||: 
Target 5' ccuAGGCCAGAGAGCAAGACUCUg 3'
12 - 35
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000353258.3 | 3UTR | CUGCACUCCAGCCUAGGCCAGAGAGCAAGACUCUGUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.945 5.7e-7 -0.797 5.5e-4 13 Click to see details
GSE28544 Breast cancer 0.492 7.3e-3 0.587 1.3e-3 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.347 4.8e-2 -0.340 5.2e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.275 6.4e-2 -0.386 1.5e-2 32 Click to see details
GSE17498 Multiple myeloma 0.235 7.2e-2 0.110 2.5e-1 40 Click to see details
GSE27834 Pluripotent stem cells -0.336 1.0e-1 -0.247 1.8e-1 16 Click to see details
GSE21687 Ependynoma primary tumors -0.155 1.1e-1 -0.155 1.1e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.213 1.5e-1 -0.270 9.6e-2 25 Click to see details
GSE19350 CNS germ cell tumors -0.322 1.5e-1 -0.042 4.5e-1 12 Click to see details
GSE38226 Liver fibrosis 0.221 1.7e-1 0.254 1.3e-1 21 Click to see details
GSE17306 Multiple myeloma -0.133 1.8e-1 -0.115 2.2e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.159 2.2e-1 -0.204 1.6e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.041 3.5e-1 0.037 3.6e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.19 3.6e-1 -0.371 2.3e-1 6 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.052 4.1e-1 -0.186 2.2e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.022 4.6e-1 0.065 3.8e-1 23 Click to see details
GSE42095 Differentiated embryonic stem cells -0.022 4.6e-1 0.065 3.8e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.196 0.09 0.197 0.09 49 Click to see details
THCA 0.6 0.14 0.600 0.14 5 Click to see details
KICH 0.419 0.15 0.548 0.08 8 Click to see details
KIRP -0.384 0.15 -0.467 0.1 9 Click to see details
ESCA 0.548 0.17 0.600 0.14 5 Click to see details
KIRC 0.146 0.22 0.087 0.33 29 Click to see details
CHOL -0.285 0.23 -0.433 0.12 9 Click to see details
STAD -0.213 0.31 -0.214 0.31 8 Click to see details
HNSC -0.274 0.41 -0.500 0.33 3 Click to see details
HNSC -0.274 0.41 -0.500 0.33 3 Click to see details
HNSC -0.274 0.41 -0.500 0.33 3 Click to see details
HNSC -0.274 0.41 -0.500 0.33 3 Click to see details
HNSC -0.274 0.41 -0.500 0.33 3 Click to see details
HNSC -0.274 0.41 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*