miRTarBase - #MIRT669778 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CNDP1   
Synonyms CN1, CPGL2, HsT2308
Description carnosine dipeptidase 1
Transcript NM_032649   
Expression
Putative miRNA Targets on CNDP1
3'UTR of CNDP1
(miRNA target sites are highlighted)
>CNDP1|NM_032649|3'UTR
   1 TCACAAGAACCTTCTAGTCTGATCTGATCCACTGACAGATTCACCTCCCCCACATCCCTAGACAGGGATGGAATGTAAAT
  81 ATCCAGAGAATTTGGGTCTAGTATAGTACATTTTCCCTTCCATTTAAAATGTCTTGGGATATCTGGATCAGTAATAAAAT
 161 ATTTCAAAGGCACAGATGTTGGAAATGGTTTAAGGTCCCCCACTGCACACCTTCCTCAAGTCATAGCTGCTTGCAGCAAC
 241 TTGATTTCCCCAAGTCCTGTGCAATAGCCCCAGGATTGGATTCCTTCAAACCTTTTAGCATATCTCCAACCTTGCAATTT
 321 GATTGGCATAATCACTCCAGTTTGCTTTCTAGGTCCTCAAGTGCTCGTGACACATAATCATTCCATCCAATGATCGCCTT
 401 TGCTTTACCACTCTTTCCTTTTATCTTATTAATAAAAATGTTGGTCTCCACCACTGACTACAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAAC---AGU-GUGAGGu 5'
            ||: : ||||   | | |||||| 
Target 5' gcAATTTGATTGGCATAATCACTCCa 3'
314 - 339 124.00 -14.10
2
miRNA  3' guuuGUGGUAACAGUGUG--AGGu 5'
              | ||| || |||||  ||| 
Target 5' ggtcCCCCACTG-CACACCTTCCt 3'
194 - 216 121.00 -11.20
3
miRNA  3' guUUGUGGUAAC--AGU-GUGAGGu 5'
            | |:|| |||  |:| |||||: 
Target 5' tgATCGCCTTTGCTTTACCACTCTt 3'
391 - 415 118.00 -12.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28857026 19 COSMIC
COSN30472572 59 COSMIC
COSN30172767 84 COSMIC
COSN28652981 153 COSMIC
COSN31530249 159 COSMIC
COSN31574760 170 COSMIC
COSN32058080 340 COSMIC
COSN27369442 643 COSMIC
COSN9844402 910 COSMIC
COSN24817211 975 COSMIC
COSN16046830 1173 COSMIC
COSN24332094 1433 COSMIC
COSN9344740 1471 COSMIC
COSN26716562 1853 COSMIC
COSN7350412 2233 COSMIC
COSN15807765 2253 COSMIC
COSN6551482 2410 COSMIC
COSN5848531 2559 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1488564442 5 dbSNP
rs1192627360 7 dbSNP
rs1247780622 11 dbSNP
rs371132641 12 dbSNP
rs772345101 17 dbSNP
rs969616750 24 dbSNP
rs1237718313 26 dbSNP
rs773568683 31 dbSNP
rs1459300593 34 dbSNP
rs1433354397 40 dbSNP
rs760942367 48 dbSNP
rs1349735181 49 dbSNP
rs771525808 52 dbSNP
rs1458588713 53 dbSNP
rs188035914 54 dbSNP
rs1179942858 55 dbSNP
rs369650332 56 dbSNP
rs773321987 76 dbSNP
rs79183691 95 dbSNP
rs1310413641 97 dbSNP
rs923294568 103 dbSNP
rs924755531 104 dbSNP
rs954590512 116 dbSNP
rs1316850943 127 dbSNP
rs541437369 135 dbSNP
rs148671098 137 dbSNP
rs1168071195 140 dbSNP
rs1330840643 140 dbSNP
rs1462502002 145 dbSNP
rs75005821 153 dbSNP
rs1163233846 164 dbSNP
rs1429574419 174 dbSNP
rs1386293852 178 dbSNP
rs1043161680 179 dbSNP
rs1377837251 187 dbSNP
rs35604255 197 dbSNP
rs924404064 205 dbSNP
rs1237113048 207 dbSNP
rs557685343 209 dbSNP
rs1481317654 217 dbSNP
rs1056713725 227 dbSNP
rs1051231722 231 dbSNP
rs1338734281 232 dbSNP
rs895510762 235 dbSNP
rs142861152 244 dbSNP
rs1045327373 251 dbSNP
rs905319483 259 dbSNP
rs1270932872 267 dbSNP
rs1308786300 269 dbSNP
rs151073962 277 dbSNP
rs1202810993 281 dbSNP
rs1375583804 282 dbSNP
rs1282171165 283 dbSNP
rs1291816736 284 dbSNP
rs1457859961 285 dbSNP
rs1036507902 288 dbSNP
rs4891564 289 dbSNP
rs994438610 291 dbSNP
rs1027289208 293 dbSNP
rs1420464845 294 dbSNP
rs1264684632 297 dbSNP
rs759189279 302 dbSNP
rs1190064883 304 dbSNP
rs1013253180 305 dbSNP
rs879347983 310 dbSNP
rs1372209398 311 dbSNP
rs1431555861 315 dbSNP
rs993603094 316 dbSNP
rs765097709 328 dbSNP
rs774235296 333 dbSNP
rs1285626616 338 dbSNP
rs547168984 339 dbSNP
rs2887 340 dbSNP
rs191500538 347 dbSNP
rs759354179 353 dbSNP
rs1302709054 357 dbSNP
rs762704047 359 dbSNP
rs910474924 364 dbSNP
rs555832526 368 dbSNP
rs968934033 370 dbSNP
rs1360328680 373 dbSNP
rs978631780 374 dbSNP
rs1455038307 376 dbSNP
rs1384053667 377 dbSNP
rs1375503668 378 dbSNP
rs1319031056 391 dbSNP
rs763486527 396 dbSNP
rs1226396305 397 dbSNP
rs540022423 411 dbSNP
rs1191376896 413 dbSNP
rs990122956 414 dbSNP
rs1487898004 417 dbSNP
rs1262194632 418 dbSNP
rs1305398177 418 dbSNP
rs1486973400 420 dbSNP
rs1348248647 428 dbSNP
rs1254477101 441 dbSNP
rs140022444 445 dbSNP
rs1324341657 446 dbSNP
rs558097636 446 dbSNP
rs1217363533 451 dbSNP
rs1352740287 456 dbSNP
rs1319397507 457 dbSNP
rs1205243861 466 dbSNP
rs932676302 476 dbSNP
rs1056842668 480 dbSNP
rs916879207 492 dbSNP
rs1167854177 506 dbSNP
rs987449684 511 dbSNP
rs751062060 520 dbSNP
rs573262669 524 dbSNP
rs1255292287 526 dbSNP
rs912840250 532 dbSNP
rs940164696 533 dbSNP
rs1254387267 537 dbSNP
rs1203314387 538 dbSNP
rs1454936065 539 dbSNP
rs1037219462 544 dbSNP
rs538001917 550 dbSNP
rs1265096704 555 dbSNP
rs1196755268 561 dbSNP
rs756857724 564 dbSNP
rs540389203 568 dbSNP
rs183564772 569 dbSNP
rs1339043780 570 dbSNP
rs1312404448 582 dbSNP
rs1048671727 589 dbSNP
rs894143688 595 dbSNP
rs1006911376 612 dbSNP
rs1159240568 615 dbSNP
rs1037853273 620 dbSNP
rs898033598 627 dbSNP
rs1433171993 629 dbSNP
rs1445476087 632 dbSNP
rs199621822 632 dbSNP
rs75510935 632 dbSNP
rs796086157 632 dbSNP
rs80252491 633 dbSNP
rs1012620165 641 dbSNP
rs1328100974 644 dbSNP
rs1371979521 653 dbSNP
rs1437292756 654 dbSNP
rs1274371455 655 dbSNP
rs1024630706 658 dbSNP
rs1198110590 673 dbSNP
rs1354800848 675 dbSNP
rs1291520744 680 dbSNP
rs1247085510 682 dbSNP
rs578005310 687 dbSNP
rs555694148 693 dbSNP
rs1030430774 694 dbSNP
rs1440895759 695 dbSNP
rs1298887997 696 dbSNP
rs999073701 697 dbSNP
rs1403550888 698 dbSNP
rs954657141 703 dbSNP
rs552724510 704 dbSNP
rs1017910902 707 dbSNP
rs968651881 723 dbSNP
rs979112343 724 dbSNP
rs1469781283 726 dbSNP
rs1031464135 729 dbSNP
rs1215193081 731 dbSNP
rs955880395 734 dbSNP
rs1273491186 735 dbSNP
rs1223761059 736 dbSNP
rs1362006273 736 dbSNP
rs992496685 736 dbSNP
rs188448753 741 dbSNP
rs1350874337 743 dbSNP
rs1280793819 748 dbSNP
rs948359531 751 dbSNP
rs957401003 757 dbSNP
rs990228750 761 dbSNP
rs1358423731 767 dbSNP
rs1157776569 788 dbSNP
rs942292409 793 dbSNP
rs1028443986 803 dbSNP
rs1183080150 811 dbSNP
rs1411341866 820 dbSNP
rs954170008 824 dbSNP
rs897963270 827 dbSNP
rs1200738118 833 dbSNP
rs77885827 835 dbSNP
rs912782156 837 dbSNP
rs111614362 841 dbSNP
rs573702940 861 dbSNP
rs1008085743 871 dbSNP
rs755283575 887 dbSNP
rs1217019573 890 dbSNP
rs575165342 891 dbSNP
rs1322174297 893 dbSNP
rs920096317 896 dbSNP
rs931520941 901 dbSNP
rs904562112 903 dbSNP
rs1375208017 905 dbSNP
rs1048790809 909 dbSNP
rs1338260849 913 dbSNP
rs779402829 914 dbSNP
rs915691697 915 dbSNP
rs948373280 925 dbSNP
rs1288076526 938 dbSNP
rs1000082871 939 dbSNP
rs1045422310 961 dbSNP
rs1346071886 964 dbSNP
rs1320506614 965 dbSNP
rs543818674 974 dbSNP
rs775188245 974 dbSNP
rs907088652 978 dbSNP
rs748289524 979 dbSNP
rs998793251 983 dbSNP
rs192815192 988 dbSNP
rs1481710359 989 dbSNP
rs564209590 990 dbSNP
rs115623496 991 dbSNP
rs1243530175 992 dbSNP
rs1218871456 995 dbSNP
rs1207625445 996 dbSNP
rs1460563811 997 dbSNP
rs1264052169 999 dbSNP
rs1263232429 1000 dbSNP
rs1011442952 1001 dbSNP
rs1214991626 1002 dbSNP
rs398120685 1002 dbSNP
rs66644603 1002 dbSNP
rs79896212 1002 dbSNP
rs536310906 1009 dbSNP
rs1028391828 1016 dbSNP
rs1382227305 1023 dbSNP
rs980296665 1025 dbSNP
rs1470991175 1032 dbSNP
rs558656524 1035 dbSNP
rs747055804 1036 dbSNP
rs1410978788 1040 dbSNP
rs1422122394 1041 dbSNP
rs1471876807 1042 dbSNP
rs1019619708 1043 dbSNP
rs1443636519 1046 dbSNP
rs1243370631 1060 dbSNP
rs1184961512 1062 dbSNP
rs961889919 1063 dbSNP
rs941033699 1069 dbSNP
rs1250727841 1074 dbSNP
rs1423496105 1078 dbSNP
rs973614266 1080 dbSNP
rs1244975741 1089 dbSNP
rs919530856 1093 dbSNP
rs972957689 1112 dbSNP
rs1051921314 1114 dbSNP
rs920212579 1120 dbSNP
rs952870285 1126 dbSNP
rs1307176768 1127 dbSNP
rs943465976 1135 dbSNP
rs990972483 1142 dbSNP
rs1416490133 1147 dbSNP
rs771007469 1155 dbSNP
rs904483160 1158 dbSNP
rs183205885 1159 dbSNP
rs529643725 1160 dbSNP
rs527917788 1161 dbSNP
rs1226269313 1162 dbSNP
rs891700721 1164 dbSNP
rs1221538329 1181 dbSNP
rs1307709262 1186 dbSNP
rs1359849605 1187 dbSNP
rs769442163 1189 dbSNP
rs928315606 1192 dbSNP
rs934354249 1193 dbSNP
rs1274333822 1199 dbSNP
rs1053009931 1200 dbSNP
rs186616861 1204 dbSNP
rs1001259048 1207 dbSNP
rs113124315 1208 dbSNP
rs538249959 1209 dbSNP
rs1305287297 1211 dbSNP
rs1482935492 1212 dbSNP
rs962385436 1213 dbSNP
rs762939446 1215 dbSNP
rs1159273468 1220 dbSNP
rs1049601550 1223 dbSNP
rs551443428 1224 dbSNP
rs1008314414 1226 dbSNP
rs1490479099 1228 dbSNP
rs571737845 1229 dbSNP
rs1203090826 1231 dbSNP
rs1020156186 1232 dbSNP
rs534012114 1236 dbSNP
rs1313349837 1239 dbSNP
rs1358490479 1242 dbSNP
rs961394494 1246 dbSNP
rs994159105 1249 dbSNP
rs1346628248 1250 dbSNP
rs1027176267 1251 dbSNP
rs952986253 1253 dbSNP
rs376476230 1261 dbSNP
rs1297370738 1262 dbSNP
rs950927184 1268 dbSNP
rs987762770 1269 dbSNP
rs199798176 1271 dbSNP
rs1280024720 1272 dbSNP
rs1404163708 1275 dbSNP
rs376029147 1279 dbSNP
rs912057083 1285 dbSNP
rs763992944 1287 dbSNP
rs570672720 1296 dbSNP
rs1312120401 1316 dbSNP
rs916764865 1321 dbSNP
rs564140985 1325 dbSNP
rs981204593 1326 dbSNP
rs1205973990 1329 dbSNP
rs535398982 1331 dbSNP
rs1261352450 1347 dbSNP
rs111997848 1348 dbSNP
rs575401266 1350 dbSNP
rs1455465178 1352 dbSNP
rs1265520775 1354 dbSNP
rs1225752987 1355 dbSNP
rs1326245372 1359 dbSNP
rs1296678255 1361 dbSNP
rs1172940197 1363 dbSNP
rs774149867 1364 dbSNP
rs914461593 1365 dbSNP
rs947293325 1377 dbSNP
rs1049987512 1389 dbSNP
rs889625187 1390 dbSNP
rs544216204 1392 dbSNP
rs1345232647 1397 dbSNP
rs1433914804 1408 dbSNP
rs943902705 1411 dbSNP
rs1451562062 1412 dbSNP
rs1241519037 1414 dbSNP
rs1183120823 1418 dbSNP
rs1280781785 1419 dbSNP
rs1372710831 1419 dbSNP
rs1443658956 1427 dbSNP
rs191412321 1428 dbSNP
rs1053028283 1429 dbSNP
rs1231068433 1430 dbSNP
rs1367578421 1431 dbSNP
rs1217935712 1432 dbSNP
rs1452781865 1432 dbSNP
rs1491296506 1432 dbSNP
rs1163216787 1433 dbSNP
rs1169496183 1433 dbSNP
rs1179670392 1433 dbSNP
rs1207796686 1433 dbSNP
rs1239300492 1433 dbSNP
rs1251855881 1433 dbSNP
rs1384403741 1433 dbSNP
rs1437829722 1433 dbSNP
rs1445417348 1433 dbSNP
rs1491307208 1433 dbSNP
rs35859995 1433 dbSNP
rs756787796 1433 dbSNP
rs763107284 1433 dbSNP
rs770946471 1433 dbSNP
rs781656068 1433 dbSNP
rs1489952508 1434 dbSNP
rs1491220335 1434 dbSNP
rs1041122406 1435 dbSNP
rs897256772 1443 dbSNP
rs1357951499 1451 dbSNP
rs891834478 1453 dbSNP
rs1237693984 1456 dbSNP
rs1266542538 1457 dbSNP
rs1309745350 1458 dbSNP
rs994106851 1458 dbSNP
rs1469964990 1459 dbSNP
rs1199363689 1460 dbSNP
rs1026957456 1461 dbSNP
rs1245860834 1462 dbSNP
rs1364761845 1463 dbSNP
rs1477020218 1465 dbSNP
rs888666608 1466 dbSNP
rs1303472294 1467 dbSNP
rs1014115730 1469 dbSNP
rs1416226992 1472 dbSNP
rs374139719 1474 dbSNP
rs1012458206 1477 dbSNP
rs577847471 1479 dbSNP
rs1156312118 1480 dbSNP
rs1016658094 1482 dbSNP
rs1268638095 1484 dbSNP
rs1396279926 1488 dbSNP
rs540309417 1491 dbSNP
rs970905152 1492 dbSNP
rs1349592682 1494 dbSNP
rs1434963990 1495 dbSNP
rs1204081558 1496 dbSNP
rs1350807917 1497 dbSNP
rs1281834997 1498 dbSNP
rs982709023 1499 dbSNP
rs1351638373 1500 dbSNP
rs1227904805 1501 dbSNP
rs1344724919 1504 dbSNP
rs1283764505 1509 dbSNP
rs1438332295 1515 dbSNP
rs1286504861 1516 dbSNP
rs1337247116 1518 dbSNP
rs1351887823 1521 dbSNP
rs1316452054 1524 dbSNP
rs1035419691 1531 dbSNP
rs955785785 1532 dbSNP
rs1288888283 1549 dbSNP
rs1429190617 1550 dbSNP
rs1200670773 1563 dbSNP
rs988441244 1564 dbSNP
rs1479192862 1565 dbSNP
rs1449604094 1571 dbSNP
rs1206344931 1573 dbSNP
rs1252536491 1579 dbSNP
rs1192056333 1589 dbSNP
rs1472207410 1590 dbSNP
rs140704546 1593 dbSNP
rs993942001 1611 dbSNP
rs1472924373 1614 dbSNP
rs67444626 1619 dbSNP
rs955059967 1620 dbSNP
rs1359642493 1625 dbSNP
rs78689912 1630 dbSNP
rs1404017648 1631 dbSNP
rs1310202309 1633 dbSNP
rs1430293926 1633 dbSNP
rs947075546 1637 dbSNP
rs184617499 1646 dbSNP
rs1371765532 1649 dbSNP
rs1468284713 1654 dbSNP
rs767192368 1662 dbSNP
rs987689333 1663 dbSNP
rs912147696 1673 dbSNP
rs1417835446 1681 dbSNP
rs985387325 1707 dbSNP
rs1167638571 1712 dbSNP
rs1475576017 1712 dbSNP
rs1249492182 1713 dbSNP
rs146866006 1715 dbSNP
rs189214730 1718 dbSNP
rs1460461909 1723 dbSNP
rs1243174443 1726 dbSNP
rs1342278224 1762 dbSNP
rs1245821470 1764 dbSNP
rs1283886139 1765 dbSNP
rs563202040 1768 dbSNP
rs1305636290 1769 dbSNP
rs1354505904 1772 dbSNP
rs754295221 1778 dbSNP
rs4892248 1780 dbSNP
rs867350527 1793 dbSNP
rs1382158204 1796 dbSNP
rs4892249 1798 dbSNP
rs950058542 1803 dbSNP
rs72981769 1804 dbSNP
rs1442551678 1815 dbSNP
rs1430782965 1816 dbSNP
rs888448086 1831 dbSNP
rs1001490316 1833 dbSNP
rs193114010 1841 dbSNP
rs1476175818 1858 dbSNP
rs1183030466 1860 dbSNP
rs1479653091 1865 dbSNP
rs1170898096 1869 dbSNP
rs140729735 1870 dbSNP
rs1483894875 1878 dbSNP
rs1491449880 1879 dbSNP
rs1491257371 1880 dbSNP
rs1429675735 1884 dbSNP
rs1167202108 1889 dbSNP
rs1358917191 1890 dbSNP
rs567380022 1891 dbSNP
rs758721650 1900 dbSNP
rs1230090195 1904 dbSNP
rs1023869009 1905 dbSNP
rs1396747859 1906 dbSNP
rs535271469 1914 dbSNP
rs150490687 1915 dbSNP
rs1338977222 1916 dbSNP
rs1437486022 1926 dbSNP
rs1003692897 1939 dbSNP
rs569148308 1940 dbSNP
rs4891565 1941 dbSNP
rs1166366111 1945 dbSNP
rs955742159 1946 dbSNP
rs1407215602 1947 dbSNP
rs539768708 1958 dbSNP
rs114919577 1971 dbSNP
rs757318128 1979 dbSNP
rs1266515724 1986 dbSNP
rs968354662 1987 dbSNP
rs1490265805 1991 dbSNP
rs1282467702 1994 dbSNP
rs1345588407 1997 dbSNP
rs1223923396 2000 dbSNP
rs1315235539 2005 dbSNP
rs1306317945 2009 dbSNP
rs1007909570 2013 dbSNP
rs1352794198 2014 dbSNP
rs1017968615 2016 dbSNP
rs1391062879 2019 dbSNP
rs1199433325 2025 dbSNP
rs577709702 2037 dbSNP
rs540371587 2038 dbSNP
rs1033585867 2039 dbSNP
rs1458819430 2040 dbSNP
rs185119504 2045 dbSNP
rs1198489775 2058 dbSNP
rs745767878 2063 dbSNP
rs1269157507 2074 dbSNP
rs1193167365 2077 dbSNP
rs976571128 2079 dbSNP
rs1267585431 2080 dbSNP
rs1209432083 2083 dbSNP
rs1331910088 2090 dbSNP
rs1261791012 2113 dbSNP
rs918425499 2114 dbSNP
rs553915909 2116 dbSNP
rs371618825 2126 dbSNP
rs910001271 2131 dbSNP
rs1380176808 2133 dbSNP
rs1379924645 2135 dbSNP
rs1466986689 2144 dbSNP
rs1436623652 2145 dbSNP
rs1172091814 2146 dbSNP
rs1175659145 2149 dbSNP
rs1400108190 2155 dbSNP
rs1466443888 2156 dbSNP
rs779883277 2157 dbSNP
rs927342856 2159 dbSNP
rs558300440 2161 dbSNP
rs1038325108 2171 dbSNP
rs898298684 2173 dbSNP
rs768584512 2182 dbSNP
rs145333277 2184 dbSNP
rs113711751 2185 dbSNP
rs1225683864 2189 dbSNP
rs890865425 2190 dbSNP
rs1297844680 2194 dbSNP
rs1052721950 2195 dbSNP
rs190001089 2197 dbSNP
rs1018354927 2206 dbSNP
rs1335424923 2207 dbSNP
rs899529196 2212 dbSNP
rs1232388150 2216 dbSNP
rs1253741205 2226 dbSNP
rs996795395 2227 dbSNP
rs181339455 2233 dbSNP
rs376276813 2234 dbSNP
rs1267177788 2237 dbSNP
rs1033225588 2247 dbSNP
rs1451508015 2248 dbSNP
rs957513471 2266 dbSNP
rs1443557849 2272 dbSNP
rs545370876 2286 dbSNP
rs988954109 2299 dbSNP
rs1020440476 2301 dbSNP
rs971439062 2302 dbSNP
rs1275737930 2309 dbSNP
rs1463248535 2311 dbSNP
rs761623909 2314 dbSNP
rs1244861440 2317 dbSNP
rs200802411 2319 dbSNP
rs968468663 2333 dbSNP
rs1304744013 2334 dbSNP
rs1390709018 2342 dbSNP
rs1309557873 2352 dbSNP
rs1370961336 2352 dbSNP
rs1269853314 2353 dbSNP
rs1363932128 2355 dbSNP
rs367942111 2358 dbSNP
rs1162792368 2361 dbSNP
rs68034028 2364 dbSNP
rs1018359547 2365 dbSNP
rs965288958 2370 dbSNP
rs1370230210 2380 dbSNP
rs1180320295 2388 dbSNP
rs937367093 2389 dbSNP
rs1252998295 2390 dbSNP
rs974358308 2395 dbSNP
rs527686937 2397 dbSNP
rs1489751935 2406 dbSNP
rs1288667005 2412 dbSNP
rs1209952282 2416 dbSNP
rs1357885127 2427 dbSNP
rs149202502 2428 dbSNP
rs918540102 2431 dbSNP
rs951207566 2435 dbSNP
rs1473650964 2444 dbSNP
rs943051718 2446 dbSNP
rs1159962265 2448 dbSNP
rs772103418 2449 dbSNP
rs929906405 2453 dbSNP
rs1402850661 2454 dbSNP
rs1040097925 2455 dbSNP
rs983934864 2457 dbSNP
rs1388242284 2459 dbSNP
rs1046912086 2460 dbSNP
rs909948465 2463 dbSNP
rs567441514 2472 dbSNP
rs891004315 2476 dbSNP
rs943775279 2477 dbSNP
rs948139801 2479 dbSNP
rs1391093306 2481 dbSNP
rs1045039418 2482 dbSNP
rs1184843371 2486 dbSNP
rs1479641230 2493 dbSNP
rs1039461917 2502 dbSNP
rs143079130 2503 dbSNP
rs1452914979 2506 dbSNP
rs549194552 2507 dbSNP
rs568936811 2508 dbSNP
rs185862689 2510 dbSNP
rs375476636 2517 dbSNP
rs1318683872 2518 dbSNP
rs557760373 2518 dbSNP
rs1434430721 2523 dbSNP
rs971624349 2524 dbSNP
rs1326666755 2530 dbSNP
rs188232121 2541 dbSNP
rs904232278 2542 dbSNP
rs1223260846 2544 dbSNP
rs1173451651 2548 dbSNP
rs765736076 2557 dbSNP
rs1003336060 2558 dbSNP
rs1034442332 2562 dbSNP
rs1007058502 2563 dbSNP
rs958934924 2565 dbSNP
rs1249296282 2569 dbSNP
rs1201709225 2572 dbSNP
rs138729041 2578 dbSNP
rs919947101 2583 dbSNP
rs951274542 2587 dbSNP
rs965412441 2591 dbSNP
rs997838264 2601 dbSNP
rs1347457893 2616 dbSNP
rs1295634805 2620 dbSNP
rs1227890455 2623 dbSNP
rs1265926585 2649 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::||| |   :|||||| 
Target 5' aucAUGCCACU---GCACUCCa 3'
4 - 22
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000582365.1 | 3UTR | GGGAUCAUGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000582365.1 | 3UTR | ACUGGGAUCAUGCCACUGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*