miRTarBase - #MIRT669858 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BROX   
Synonyms C1orf58
Description BRO1 domain and CAAX motif containing
Transcript NM_144695   
Expression
Putative miRNA Targets on BROX
3'UTR of BROX
(miRNA target sites are highlighted)
>BROX|NM_144695|3'UTR
   1 AATACAACTTGCACTTAGAATTTCTCTAGCAGTAAATAAGATAAACCACAGAATTTCAGTTCTTATTTCTCAAAATGATT
  81 TCTCTGAAGCTTGTAGAATAACTATTATATTCAGAGGGTTATCTGCCTTCAGCTTACTTGTTCTTAATTTTTAATACAGC
 161 GGAGATGTTTCTTGCTTTGTTTTCAGACTCTCCTTTTTAATCAGGACAACATTTGAAAGATTTTATTGTGCCTCTAAAGG
 241 GTATATTTGGGGGTTGGGTCTTTTTGTTAAACTCTGGATAGTAATAAGTTTCAGGTCAGTATAGGCCCGAATCATGTGGT
 321 TTCAGGTATGTTTTTCTTTTTTCTTTTTCTTTTTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTGAGGTGGAGTCTCCCTC
 401 TGTTGCCCAGGCTGGAGTGCAGTGGCATGATCTCGGCTCACTGCAACCCTCCACCTCCTGAATTAAAGTGATTCTCCTGC
 481 CTCAGCCTCCCGAGTAGCTGGGATTACAGGCACGCACCACTACACCCAGATAATTTTTGTATTTTTAGTAGAGACGTGAT
 561 TTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAGCTGATCTGCCCGCCTTGGCCTCCCAAAGTGCTGGGATT
 641 ACAGGCGTGATCCACTGCACCTGGCCTCAGGTATGTTTTTCTATCTACACACAAAAAGTTTATTTTCCTTCCTCTTATTT
 721 GATATCAGAAGAATGACAGGAATCAGTTTTTAACAGAGATAGTTTTTCCGTTTCTCCATTGTGTTAATCAGAGCGCAGAC
 801 TTACATTCTCAGTCATTTATCTTTTCTGGTGGAGAATAAAAAGTCACTTATAGTTAAAGATCAGAAAATTATCACACCAA
 881 ATCCATTACATATGTTAGAATCAATAATTTACTCAAAAATCAGCTTTTATAGGTATGTTGGCACCTTATCCAAGAACTTA
 961 TCCCTGTTCCAGTACCCCTGTGCTTCATTCAGTATCAGTAACCCTGCAATGATTTTTACAAATATCTTTTTCTAGTGGGT
1041 TTTTTACTTAGAGGAAAGAACTTTGTAATAGCTCTTAATGTTTATATATAAGAGAAGACAGAATGGAAAATGTTTTTTGA
1121 AGTCAAATATTGCATGATGTAAAGAAAAAACTTTAAACTTAAATGAGTAGGTTGTCCTGAATTACACTGGTAACTCTCTA
1201 CTTCTTTATTAAAGAAGTTATAGTAAGATGCCTTTGTTACCTGATTTCAGTGTACATTGTTTTTATGTGGTTTTCTGATA
1281 ATGTCCTGTCAGAATTGTATTGGTTTAGGCCAAAGGCCATAGCAAAAACATAGAGAACAAATATGATCTTAAAAATAGAT
1361 TGTAACATTTTAAACAATTAGTTTAGTAATTTGGGAAATAGTGGATGCATAATACTTTAACAGAAGTCACACATCTGTAG
1441 GTTTATCTTTTGATTATTCTCCTGAGGCATTAGATAGTTTTTCTATTATAAGTGACAGATTGACTCACTTAATATAAATA
1521 AGTAGCATACACTAAAAGCTTACTATGTGCCAGATACTGTGCTGGACACTTACATAGATAAGCCATTGAATCCACACAGC
1601 AGCCCTGTAAGAAATAAGTAAAATCTGCATAAAGTGTTGAAATAGGAATATACATTTCATTATGAAAAATGAATAGATTA
1681 TGCCTATCTGAATCAATATTGCATTCAAATAAGTGATTACTTAAATCATATATCATAGTTTACACTCCTTAAAAAAAGGT
1761 ACATAAATTCAGTGAGGTTTTTTTCTTAACATACAGAAGTACTAAATACTGCTTGCAGTATAATATTGATATTGGAAGCT
1841 GCAGTTTCCAGAATAAGTGGAGTAATAACTAAACAGACATTTAATTTTATTTCAATATCTATGGAAAAAACACTTATTAA
1921 ATCTCCCTGTATTTTATGTTGTCTTTATTACAGAATCACTTGTCTGTTTGTTGTGTGCCACTTACTGACAAAACTTTAAA
2001 CAGTACTTGATGCCAGCTCTCTACTCTGTGGCTGTGGGACCTGTTTCTTTTAGGTACTTGTGCTTATTAATCTACTTACT
2081 AAATTTTCACATTGACATTTTTGGGGATGATACTACCATATACGAAATGGAAAATGTAATATGCTCAGTGCTTCTGTAAA
2161 ATGCAGCAATACTGGTATTACTTTACATCAGTAGGCATCTTTGACATGAGCATATAAATATTTTGTTGACTCAGCAAAGG
2241 TGACACTTTGTGACTAAAGTATCCCATTATATATAATGTTTTTTGAAATGTTGGAAATTTTGGGGAATTATCAAATGTAT
2321 AGAAGTTGCATGAAGGTTATAGAGAGGTGTAACTGTTTGTTAACTATTACATGGATTTCATACTAGGCAGTGACAACTAA
2401 CATGTTACTTCAACTAAAAGTGTATAATGGGTTGTCTTTTTATTTATGAAAATAAAAGTAATTTTACTTACAATTTCATT
2481 GA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAAC-AGUGUGAGGu 5'
             |:|:||| | |:||||||| 
Target 5' catATATCATAGTTTACACTCCt 3'
1727 - 1749 167.00 -18.20
2
miRNA  3' guuUGUGGUAACAG--UGUGAGGu 5'
             :| :::|| ||  || |||| 
Target 5' cttGCTTTGTTTTCAGACTCTCCt 3'
171 - 194 121.00 -7.00
3
miRNA  3' guuuguGGUAACAGUGUGAGGu 5'
                :|| ||  || |||| 
Target 5' ctcggcTCACTGCAACCCTCCa 3'
432 - 453 120.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31484810 27 COSMIC
COSN30122843 47 COSMIC
COSN31578169 52 COSMIC
COSN1433290 105 COSMIC
COSN30105476 162 COSMIC
COSN7205413 307 COSMIC
COSN27279862 350 COSMIC
COSN8435322 552 COSMIC
COSN17726000 701 COSMIC
COSN23347935 706 COSMIC
COSN17317737 781 COSMIC
COSN6024668 1056 COSMIC
COSN16933278 1083 COSMIC
COSN1098498 1410 COSMIC
COSN7205415 1413 COSMIC
COSN17913118 2068 COSMIC
COSN5166538 2095 COSMIC
COSN21526687 2354 COSMIC
COSN22885807 2359 COSMIC
COSN30353018 2428 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs991300043 3 dbSNP
rs1181677260 6 dbSNP
rs1362449064 8 dbSNP
rs770846086 14 dbSNP
rs776603337 19 dbSNP
rs373931794 22 dbSNP
rs761459323 22 dbSNP
rs759292345 25 dbSNP
rs112469321 26 dbSNP
rs1215134893 32 dbSNP
rs1459995980 33 dbSNP
rs199674355 39 dbSNP
rs1299945469 52 dbSNP
rs183063133 57 dbSNP
rs377331553 60 dbSNP
rs558623443 67 dbSNP
rs1021970446 75 dbSNP
rs917216982 75 dbSNP
rs1207996858 76 dbSNP
rs574545249 83 dbSNP
rs968659907 86 dbSNP
rs977532942 90 dbSNP
rs1227263104 103 dbSNP
rs778371692 105 dbSNP
rs1294781235 114 dbSNP
rs769787681 118 dbSNP
rs1380415492 119 dbSNP
rs987231164 126 dbSNP
rs910277599 132 dbSNP
rs542338907 139 dbSNP
rs1223048865 142 dbSNP
rs930461067 161 dbSNP
rs1409794559 162 dbSNP
rs1047630095 163 dbSNP
rs1424591437 169 dbSNP
rs749708967 193 dbSNP
rs1039839019 195 dbSNP
rs898776376 208 dbSNP
rs563617270 211 dbSNP
rs931579061 212 dbSNP
rs368882953 217 dbSNP
rs1207991000 222 dbSNP
rs1326487326 231 dbSNP
rs1009252243 235 dbSNP
rs531001262 237 dbSNP
rs12043288 239 dbSNP
rs1394670032 248 dbSNP
rs1057150054 268 dbSNP
rs74943767 277 dbSNP
rs1321840787 281 dbSNP
rs1480567039 304 dbSNP
rs1197637579 306 dbSNP
rs77420252 309 dbSNP
rs1021457671 310 dbSNP
rs969061375 315 dbSNP
rs967807890 316 dbSNP
rs998767144 320 dbSNP
rs1430121396 325 dbSNP
rs1248360172 326 dbSNP
rs1031562946 327 dbSNP
rs1463467693 329 dbSNP
rs1417704549 331 dbSNP
rs954377064 331 dbSNP
rs1304717766 337 dbSNP
rs796252390 337 dbSNP
rs1365905757 340 dbSNP
rs987093903 340 dbSNP
rs1263316140 342 dbSNP
rs1229103978 343 dbSNP
rs372700180 343 dbSNP
rs1298763900 344 dbSNP
rs369101624 344 dbSNP
rs1386432387 346 dbSNP
rs1228362405 350 dbSNP
rs1390058757 350 dbSNP
rs1491486733 350 dbSNP
rs372818118 350 dbSNP
rs796814438 350 dbSNP
rs1491319826 351 dbSNP
rs1299419414 352 dbSNP
rs1463702203 353 dbSNP
rs1337635728 354 dbSNP
rs1410429216 356 dbSNP
rs1239820352 357 dbSNP
rs1447648977 357 dbSNP
rs1279553325 359 dbSNP
rs1352126684 360 dbSNP
rs1225292816 361 dbSNP
rs1396830221 361 dbSNP
rs868117877 362 dbSNP
rs1204871063 363 dbSNP
rs1275881047 363 dbSNP
rs1340407236 363 dbSNP
rs1450568308 363 dbSNP
rs200745349 363 dbSNP
rs550811790 363 dbSNP
rs1292965511 365 dbSNP
rs1234547059 367 dbSNP
rs1490276945 368 dbSNP
rs1032282296 369 dbSNP
rs1264802417 370 dbSNP
rs1159251965 371 dbSNP
rs1307592223 373 dbSNP
rs1427588501 374 dbSNP
rs1181901929 375 dbSNP
rs1379678670 376 dbSNP
rs1437768260 377 dbSNP
rs1165325121 380 dbSNP
rs1385672519 382 dbSNP
rs201432516 384 dbSNP
rs1456007543 385 dbSNP
rs1292041816 386 dbSNP
rs1398898650 387 dbSNP
rs1392090562 388 dbSNP
rs1183347726 389 dbSNP
rs1472747283 391 dbSNP
rs1250629935 395 dbSNP
rs1179483833 399 dbSNP
rs1330774898 401 dbSNP
rs1201571499 402 dbSNP
rs1344920217 416 dbSNP
rs1374672345 420 dbSNP
rs1230325148 435 dbSNP
rs149847057 436 dbSNP
rs956252711 444 dbSNP
rs1316284304 447 dbSNP
rs1342091617 461 dbSNP
rs562756493 466 dbSNP
rs1413900964 468 dbSNP
rs1399962242 474 dbSNP
rs1160168924 477 dbSNP
rs1457313536 490 dbSNP
rs964485463 492 dbSNP
rs1179633066 493 dbSNP
rs976025403 498 dbSNP
rs920093440 499 dbSNP
rs931445050 509 dbSNP
rs776202187 514 dbSNP
rs529449596 515 dbSNP
rs1442149208 521 dbSNP
rs970008200 525 dbSNP
rs980138683 527 dbSNP
rs1047322136 533 dbSNP
rs551118190 547 dbSNP
rs920670063 550 dbSNP
rs144691720 552 dbSNP
rs908760111 556 dbSNP
rs759215918 557 dbSNP
rs199864686 561 dbSNP
rs930743993 561 dbSNP
rs1237040138 564 dbSNP
rs1447030170 568 dbSNP
rs1047576913 569 dbSNP
rs907676672 576 dbSNP
rs1435696719 578 dbSNP
rs1185373580 580 dbSNP
rs938694256 587 dbSNP
rs569673315 588 dbSNP
rs867052447 592 dbSNP
rs1057054356 595 dbSNP
rs1414088459 595 dbSNP
rs766952319 601 dbSNP
rs1472695392 609 dbSNP
rs1367040165 614 dbSNP
rs1043404502 620 dbSNP
rs28433094 631 dbSNP
rs537095733 645 dbSNP
rs1043308004 646 dbSNP
rs904366898 647 dbSNP
rs999210585 648 dbSNP
rs1182247352 651 dbSNP
rs998664248 656 dbSNP
rs1354019894 660 dbSNP
rs370507125 665 dbSNP
rs1299508528 669 dbSNP
rs1229138875 672 dbSNP
rs1031594115 684 dbSNP
rs1318396516 686 dbSNP
rs954575867 694 dbSNP
rs1008601344 696 dbSNP
rs1338006767 707 dbSNP
rs1322504966 708 dbSNP
rs1379077503 713 dbSNP
rs1403218944 715 dbSNP
rs1394713270 723 dbSNP
rs1383817406 726 dbSNP
rs373627654 735 dbSNP
rs1450698730 741 dbSNP
rs150472185 755 dbSNP
rs370361841 755 dbSNP
rs1308385418 760 dbSNP
rs752189472 764 dbSNP
rs761344478 770 dbSNP
rs1256979189 771 dbSNP
rs970332141 775 dbSNP
rs531564864 777 dbSNP
rs964841204 779 dbSNP
rs973190889 789 dbSNP
rs762342610 790 dbSNP
rs1315583347 792 dbSNP
rs980086407 792 dbSNP
rs577055605 795 dbSNP
rs1220831490 796 dbSNP
rs1243733276 796 dbSNP
rs1367758609 815 dbSNP
rs1482891503 825 dbSNP
rs982881379 830 dbSNP
rs1174209896 835 dbSNP
rs534964862 841 dbSNP
rs144908838 846 dbSNP
rs1057086593 848 dbSNP
rs944496833 848 dbSNP
rs758804085 851 dbSNP
rs535904523 852 dbSNP
rs1426045090 857 dbSNP
rs780464102 863 dbSNP
rs921841967 864 dbSNP
rs1471036412 871 dbSNP
rs1183119787 878 dbSNP
rs574612184 882 dbSNP
rs1272188664 886 dbSNP
rs1212197825 889 dbSNP
rs948698466 891 dbSNP
rs370031057 905 dbSNP
rs1277368902 915 dbSNP
rs564614030 921 dbSNP
rs1216978297 930 dbSNP
rs1351725373 932 dbSNP
rs1043163583 937 dbSNP
rs1288621058 939 dbSNP
rs1408787237 945 dbSNP
rs1043645412 954 dbSNP
rs1358590403 958 dbSNP
rs375390760 959 dbSNP
rs903501662 962 dbSNP
rs999157426 967 dbSNP
rs1464988340 976 dbSNP
rs1052576940 979 dbSNP
rs896276669 991 dbSNP
rs76782851 992 dbSNP
rs1248230101 997 dbSNP
rs906095420 998 dbSNP
rs934488120 1001 dbSNP
rs1399763137 1010 dbSNP
rs1001763014 1012 dbSNP
rs1277226955 1021 dbSNP
rs1268182318 1025 dbSNP
rs1227443213 1026 dbSNP
rs1326625099 1027 dbSNP
rs1027920549 1035 dbSNP
rs1398163019 1039 dbSNP
rs376200156 1040 dbSNP
rs1380301336 1048 dbSNP
rs1224904938 1050 dbSNP
rs557094497 1066 dbSNP
rs1278715840 1069 dbSNP
rs575340449 1070 dbSNP
rs1390981347 1071 dbSNP
rs149032890 1088 dbSNP
rs1321289586 1089 dbSNP
rs1456965271 1092 dbSNP
rs1362290690 1098 dbSNP
rs755170105 1099 dbSNP
rs951991045 1109 dbSNP
rs1424208209 1113 dbSNP
rs983472717 1125 dbSNP
rs1015419026 1135 dbSNP
rs890416138 1138 dbSNP
rs1248170623 1140 dbSNP
rs966185878 1144 dbSNP
rs1008801004 1151 dbSNP
rs976306186 1155 dbSNP
rs1245008767 1161 dbSNP
rs1266876124 1161 dbSNP
rs1322753244 1164 dbSNP
rs1312421653 1186 dbSNP
rs1244510869 1188 dbSNP
rs1367951964 1191 dbSNP
rs1395639364 1192 dbSNP
rs1017909614 1201 dbSNP
rs1434466545 1201 dbSNP
rs921747717 1208 dbSNP
rs900184240 1219 dbSNP
rs931831782 1222 dbSNP
rs979285260 1224 dbSNP
rs925207412 1225 dbSNP
rs994873195 1226 dbSNP
rs1261377461 1228 dbSNP
rs1451036442 1230 dbSNP
rs1027415169 1232 dbSNP
rs1390717391 1239 dbSNP
rs1187808318 1249 dbSNP
rs1426243552 1254 dbSNP
rs1481549589 1269 dbSNP
rs1200325172 1271 dbSNP
rs950513586 1283 dbSNP
rs781135963 1289 dbSNP
rs1487954058 1297 dbSNP
rs564184215 1304 dbSNP
rs1291576085 1306 dbSNP
rs1431467030 1320 dbSNP
rs748194201 1324 dbSNP
rs533277922 1329 dbSNP
rs916122895 1331 dbSNP
rs370873910 1332 dbSNP
rs1324809791 1334 dbSNP
rs979135549 1338 dbSNP
rs1303458810 1340 dbSNP
rs1387628975 1352 dbSNP
rs1367186387 1362 dbSNP
rs1367769728 1364 dbSNP
rs1301455722 1371 dbSNP
rs926091928 1373 dbSNP
rs1370888450 1376 dbSNP
rs1406419778 1376 dbSNP
rs1167940540 1384 dbSNP
rs1275024746 1400 dbSNP
rs1366349793 1406 dbSNP
rs1216937802 1424 dbSNP
rs777903254 1429 dbSNP
rs1001710497 1435 dbSNP
rs1309141302 1442 dbSNP
rs1432029242 1449 dbSNP
rs1354312730 1451 dbSNP
rs1183840691 1459 dbSNP
rs1215735752 1459 dbSNP
rs934729727 1462 dbSNP
rs1484252595 1465 dbSNP
rs547041632 1471 dbSNP
rs1195770692 1472 dbSNP
rs1338013426 1478 dbSNP
rs1490768082 1486 dbSNP
rs1257893073 1490 dbSNP
rs1234062812 1509 dbSNP
rs1322864611 1511 dbSNP
rs547618745 1516 dbSNP
rs1281642141 1530 dbSNP
rs1027868281 1532 dbSNP
rs1350928533 1535 dbSNP
rs75081222 1539 dbSNP
rs890280238 1546 dbSNP
rs1005282918 1548 dbSNP
rs944499286 1558 dbSNP
rs1404280065 1566 dbSNP
rs1014952442 1567 dbSNP
rs1246325564 1573 dbSNP
rs1487570814 1578 dbSNP
rs966461068 1584 dbSNP
rs1038953802 1594 dbSNP
rs900384413 1595 dbSNP
rs1472695689 1604 dbSNP
rs1253070733 1609 dbSNP
rs1181519275 1624 dbSNP
rs1436365503 1626 dbSNP
rs1029043314 1641 dbSNP
rs1391549750 1649 dbSNP
rs1258916528 1654 dbSNP
rs796237782 1656 dbSNP
rs1322985541 1681 dbSNP
rs1261305428 1685 dbSNP
rs994548002 1693 dbSNP
rs1230542053 1698 dbSNP
rs1027733171 1702 dbSNP
rs1279131768 1710 dbSNP
rs1236611949 1713 dbSNP
rs1380932263 1714 dbSNP
rs1334768178 1723 dbSNP
rs1451796372 1729 dbSNP
rs143706441 1730 dbSNP
rs1157336177 1736 dbSNP
rs1387492307 1741 dbSNP
rs1457496928 1744 dbSNP
rs1425663943 1745 dbSNP
rs1410789987 1750 dbSNP
rs1156407529 1751 dbSNP
rs1468944864 1751 dbSNP
rs953178602 1755 dbSNP
rs979275158 1756 dbSNP
rs886214844 1759 dbSNP
rs1461258261 1760 dbSNP
rs200032897 1770 dbSNP
rs1210682052 1776 dbSNP
rs1465353202 1778 dbSNP
rs935291471 1785 dbSNP
rs1348935400 1791 dbSNP
rs1203567781 1793 dbSNP
rs1004579100 1794 dbSNP
rs770691516 1795 dbSNP
rs1284541907 1796 dbSNP
rs1245241743 1798 dbSNP
rs540556841 1806 dbSNP
rs1376910488 1826 dbSNP
rs548646547 1828 dbSNP
rs1344043475 1829 dbSNP
rs1239376312 1832 dbSNP
rs17532981 1849 dbSNP
rs1393414090 1851 dbSNP
rs1361395011 1853 dbSNP
rs1164183272 1854 dbSNP
rs759119609 1858 dbSNP
rs1383926537 1889 dbSNP
rs186724507 1895 dbSNP
rs1450195732 1899 dbSNP
rs1023222923 1902 dbSNP
rs1213968984 1913 dbSNP
rs115533158 1914 dbSNP
rs563057911 1918 dbSNP
rs1356923174 1928 dbSNP
rs1049290783 1932 dbSNP
rs925927444 1958 dbSNP
rs934760986 1960 dbSNP
rs1005155938 1965 dbSNP
rs778975948 1965 dbSNP
rs988913067 1972 dbSNP
rs1037037446 1983 dbSNP
rs751389309 1988 dbSNP
rs558013599 2001 dbSNP
rs1331338409 2027 dbSNP
rs1177367044 2029 dbSNP
rs1424455215 2033 dbSNP
rs530664313 2036 dbSNP
rs374742641 2045 dbSNP
rs901811622 2048 dbSNP
rs954657984 2048 dbSNP
rs190390948 2053 dbSNP
rs774885595 2056 dbSNP
rs114163358 2057 dbSNP
rs1184843154 2058 dbSNP
rs944531877 2064 dbSNP
rs143101764 2068 dbSNP
rs1163026844 2073 dbSNP
rs1489812384 2075 dbSNP
rs921912012 2082 dbSNP
rs1205866330 2089 dbSNP
rs1306832028 2115 dbSNP
rs1032160453 2124 dbSNP
rs146698601 2125 dbSNP
rs1345054838 2129 dbSNP
rs988046285 2139 dbSNP
rs752924089 2143 dbSNP
rs1048750514 2145 dbSNP
rs1172036651 2162 dbSNP
rs1402699706 2165 dbSNP
rs886121589 2176 dbSNP
rs1310238159 2178 dbSNP
rs747092056 2178 dbSNP
rs756236694 2178 dbSNP
rs1354481365 2185 dbSNP
rs1168872103 2192 dbSNP
rs1416272451 2193 dbSNP
rs1004479117 2194 dbSNP
rs554901438 2208 dbSNP
rs1176029413 2225 dbSNP
rs896205175 2226 dbSNP
rs1445378680 2240 dbSNP
rs1177582665 2241 dbSNP
rs372233473 2246 dbSNP
rs1014456845 2247 dbSNP
rs980471922 2250 dbSNP
rs1212085569 2252 dbSNP
rs546543102 2256 dbSNP
rs1023551178 2270 dbSNP
rs1221381554 2274 dbSNP
rs370086960 2282 dbSNP
rs1330760540 2296 dbSNP
rs931078293 2309 dbSNP
rs1349282958 2315 dbSNP
rs568287651 2316 dbSNP
rs763435923 2318 dbSNP
rs557937789 2323 dbSNP
rs909356521 2331 dbSNP
rs1450775743 2337 dbSNP
rs556890075 2339 dbSNP
rs1033234068 2347 dbSNP
rs751883482 2350 dbSNP
rs988777360 2353 dbSNP
rs1468242452 2354 dbSNP
rs769678858 2354 dbSNP
rs1160047893 2356 dbSNP
rs1405499987 2360 dbSNP
rs1317416536 2367 dbSNP
rs1196825087 2372 dbSNP
rs1265602447 2375 dbSNP
rs17163466 2391 dbSNP
rs1187378624 2395 dbSNP
rs1465809302 2402 dbSNP
rs1236119003 2403 dbSNP
rs1214572116 2413 dbSNP
rs1476566940 2417 dbSNP
rs966116813 2421 dbSNP
rs987811209 2422 dbSNP
rs1230587577 2425 dbSNP
rs1384198008 2433 dbSNP
rs1036578610 2437 dbSNP
rs1195465846 2437 dbSNP
rs867713138 2438 dbSNP
rs1390859724 2447 dbSNP
rs1289715919 2453 dbSNP
rs1423861403 2453 dbSNP
rs1464710666 2467 dbSNP
rs1167904984 2470 dbSNP
rs767726218 2472 dbSNP
rs1403631585 2474 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::||| |   :|||||| 
Target 5' gucAUGCCACU---GCACUCCa 3'
3 - 21
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::||| |   :|||||| 
Target 5' gucAUGCCACU---GCACUCCa 3'
3 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + A
Location of target site ENST00000537020.1 | 3UTR | CAGUCAUGCCACUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000537020.1 | 3UTR | CAGUCAUGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*