miRTarBase - #MIRT671925 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PLEKHS1   
Synonyms C10orf81, HEL185, bA211N11.2
Description pleckstrin homology domain containing S1
Transcript NM_024889   
Expression
Putative miRNA Targets on PLEKHS1
3'UTR of PLEKHS1
(miRNA target sites are highlighted)
>PLEKHS1|NM_024889|3'UTR
   1 AATTAAAGCTTACCATCGGCAGGATCCCAAATTCAGAGACATTCCATGCTGCATCCTGTATGTGTCCCTCAAAATGCCAA
  81 AGTGCTGCACCTTCTCAGCTGGATAAGCCTAGACTGAACAGAGCTCCCAAGAGGAGTCCGGCCATTAAAAAGAGCCAGCA
 161 GAAAGGAGCCAGGGAGTAACGCACCCCAGACCCATGGCAGCAGAACCAGGATGGAGCTGGGACTGTCCAGCTCTGCCCCC
 241 TGCTGCTGCCATGTGATAGGAGACAGTCGGCACCCCCCTCTGAATTTCTGCATCTGCATCTTAACAATGGGGATGACTAT
 321 CCCCTCTCTGGTTATTGTATCAGAGATGCTAAGAGGGTCATGTGGCATGATTGGAGAACCTGGGGGAATTGGAAGGCCTT
 401 ATTATCTCAGCTATTGTCCCAAACACCACAGACACAGATTGGGTCAGTCCTTCATGTAATACATGCTGTGTTCTGTGAGG
 481 ATGTGGTCCACACAATTCCTTCTTTGTTAAGGGACATACAGTTGCAAATACTCACTGCATGAAGGCAAGATTCCCAAGGG
 561 AGATGTGATAGCTGATCAGGCTTCCCAGACACCTCCTTCCCAAACACCTCCTTCCCAACACCTCCTTCCCCAACATCCTT
 641 CCCAACACCTCCTTCCCAACACCTCCTTCCCAAACACCTCCTTCCCAAACACCTCCTTCCCAACACCTCCTTCCCCAACA
 721 CCTCCTTCCCAAACACCTCTTTCCCAAACACCTCCTTCCCAGACACCTCCTTCCCAACACCTCCTTCCCAACACCTCCTT
 801 CCCAAACCCCTCTTTCCCAAACACCTCCTTCCCCAACACCTCCTTCCCAACACCTCCTTCCCCCTTCCCCAACACCTCCT
 881 TCCCCAACACCTCCTTCCCAACACCTCCTTCCCAAACCCCTCCTTCCCCAACATCCTTCCCAACACCTCCTTCCCAACAC
 961 CTCCTTCCCAAACACCTCCTTCCCAAACACCTCCTTCCCAACACCTCCTTCCCCAACACCTCCTTCCCAAACACCTCTTT
1041 CCCAAACACCTCCTTCCCAGACACCTCCTTCCCAACACCGCCTTCCCAACACCTCCTTCCCAAACCCCTCTTTCCCAAAC
1121 ACCTCCTTCCCCAACACCTCCTTCCCCAACACCTCCTTCCCAACACCTCCTTCCCCCTTCCCCAACAACTCCTTCCCCAA
1201 CACCTCCTTCCCAAACATCCCCTTCCCAAACACCTGCCTCTCTTCAACCCCACAGGCCAGAGTGCTGAGACAGAGTGGCC
1281 TTTTGGATTCAATAAGTATCTTGTTCTCTTAAAGACTCAGCAACGATTTTAGAAGTCGCAGCAGTTTTACATCACATGCA
1361 GCCAAGATCAGCTTGCTCTACAAGCAATAACAGAACTACTTAGCACTTCAAGGTTGAAAGTTCTTCACTAATGGATCCAT
1441 TGACTAATTGATCCTGGAAGGCCAAAGGAATAAAATTCTTTTATATAAATAGGAAAACAAAGGCAGAGAGCTAAAGCACT
1521 AATCAAATCGGGGGGTGTTAGAGCAAAAACAGGCTTCAGAAAGAGTATTTTACCATGCTTCACATGGAAAAAATCGAGCC
1601 CCGGAGCGATGAAAGGCATATTTTCTTTGTTTCTCCAAGTTTCATAACCGTTCAGTTGCAGAACCAAGAATCTAAAACCA
1681 GCTCTGGGAAACAAATGTCCAGATGCCAGCCTCATAGTTGAACTTGGATTTGAAAATACCTTCAGCACTTAGAAGAGACA
1761 TTCAAATACATTTCATTTCCTGTTACCCAGATTGTTCGGAAAGTATTAAAAATTTTTCATTTACATGCTGAAAAAAAAAA
1841 AAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGG--UAA--CAGUGUGAGGu 5'
            :|: ||  |||  |  |||:||| 
Target 5' agGATCCCAAATTCAGAGACATTCCa 3'
21 - 46 132.00 -12.20
2
miRNA  3' guUUGUGGUAACAG-UGU-GAGGu 5'
            ||||:| ||  | ||| |||| 
Target 5' ccAACATCCTTCCCAACACCTCCt 3'
630 - 653 132.00 -11.12
3
miRNA  3' guUUGUGGUAACAG-UGU-GAGGu 5'
            ||||:| ||  | ||| |||| 
Target 5' ccAACATCCTTCCCAACACCTCCt 3'
928 - 951 132.00 -11.12
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM4607457 10 COSMIC
COSM427089 16 COSMIC
COSM201844 18 COSMIC
COSM6750065 20 COSMIC
COSM427090 27 COSMIC
COSM7967007 27 COSMIC
COSM7088682 30 COSMIC
COSM8299138 37 COSMIC
COSM1703060 46 COSMIC
COSM8158442 46 COSMIC
COSM9456516 46 COSMIC
COSM6065107 47 COSMIC
COSM6287226 49 COSMIC
COSM3751540 51 COSMIC
COSM7384586 52 COSMIC
COSM914956 52 COSMIC
COSM8357347 60 COSMIC
COSM6128511 69 COSMIC
COSM7258322 75 COSMIC
COSM9010181 78 COSMIC
COSM5734521 79 COSMIC
COSM3367899 117 COSMIC
COSM4457511 127 COSMIC
COSM5418532 140 COSMIC
COSM914957 141 COSMIC
COSM2053735 143 COSMIC
COSM9057976 159 COSMIC
COSN26644882 215 COSMIC
COSN24775889 269 COSMIC
COSN15792136 278 COSMIC
COSN30129959 361 COSMIC
COSN1112692 411 COSMIC
COSN21988045 465 COSMIC
COSN8530064 503 COSMIC
COSN15652975 636 COSMIC
COSN20107560 644 COSMIC
COSN32063933 650 COSMIC
COSN20107561 658 COSMIC
COSN20092197 673 COSMIC
COSN20092198 674 COSMIC
COSN20092200 688 COSMIC
COSN28997923 692 COSMIC
COSN20092201 717 COSMIC
COSN20092202 721 COSMIC
COSN20092203 732 COSMIC
COSN20092205 741 COSMIC
COSN20092207 747 COSMIC
COSN20092209 753 COSMIC
COSN20092211 762 COSMIC
COSN20107562 763 COSMIC
COSN26303424 793 COSMIC
COSN15649585 813 COSMIC
COSN20092212 814 COSMIC
COSN20092213 820 COSMIC
COSN20092214 886 COSMIC
COSN15652323 958 COSMIC
COSN27337725 1054 COSMIC
COSN20107566 1111 COSMIC
COSN20092215 1122 COSMIC
COSN20107568 1126 COSMIC
COSN31778837 1133 COSMIC
COSN6475685 1133 COSMIC
COSN27329941 1148 COSMIC
COSN6475686 1156 COSMIC
COSN17925524 1170 COSMIC
COSN23427560 1189 COSMIC
COSN27286487 1189 COSMIC
COSN20092217 1199 COSMIC
COSN20092218 1204 COSMIC
COSN20092219 1206 COSMIC
COSN22775511 1331 COSMIC
COSN23141144 1485 COSMIC
COSN31960551 1531 COSMIC
COSN27964590 1673 COSMIC
COSN17294252 1912 COSMIC
COSN32062018 2640 COSMIC
COSN19367582 2649 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1329362277 6 dbSNP
rs761585859 14 dbSNP
rs1412629288 17 dbSNP
rs201435892 18 dbSNP
rs370338009 19 dbSNP
rs756368761 25 dbSNP
rs753377659 27 dbSNP
rs754577830 29 dbSNP
rs778701397 34 dbSNP
rs375920460 39 dbSNP
rs1484912076 40 dbSNP
rs1213420117 41 dbSNP
rs758082384 47 dbSNP
rs777933095 48 dbSNP
rs888870347 49 dbSNP
rs11196483 51 dbSNP
rs989936724 52 dbSNP
rs1169154935 60 dbSNP
rs771290195 62 dbSNP
rs777241261 70 dbSNP
rs371574088 71 dbSNP
rs769922226 78 dbSNP
rs1480999941 79 dbSNP
rs775563659 80 dbSNP
rs1316414139 81 dbSNP
rs768957651 85 dbSNP
rs1431513546 86 dbSNP
rs1303359263 95 dbSNP
rs1346306389 96 dbSNP
rs367689615 99 dbSNP
rs147568090 100 dbSNP
rs1345362724 115 dbSNP
rs1026669631 117 dbSNP
rs1259158408 123 dbSNP
rs1448244742 124 dbSNP
rs573461694 125 dbSNP
rs753896107 127 dbSNP
rs1252340239 129 dbSNP
rs1290750232 138 dbSNP
rs200866926 140 dbSNP
rs764781444 141 dbSNP
rs1366217867 142 dbSNP
rs1377997852 144 dbSNP
rs757947091 145 dbSNP
rs1157072305 146 dbSNP
rs1291309561 150 dbSNP
rs912140861 153 dbSNP
rs555109084 154 dbSNP
rs1457874781 160 dbSNP
rs1319534570 162 dbSNP
rs1350078958 162 dbSNP
rs944396348 167 dbSNP
rs751844912 169 dbSNP
rs1443745124 170 dbSNP
rs757677616 174 dbSNP
rs868038632 175 dbSNP
rs573578485 176 dbSNP
rs1237271688 177 dbSNP
rs1414000246 178 dbSNP
rs781657801 181 dbSNP
rs543929872 182 dbSNP
rs1208859598 183 dbSNP
rs1271969459 185 dbSNP
rs201438085 187 dbSNP
rs780073494 190 dbSNP
rs548008350 192 dbSNP
rs1418320498 193 dbSNP
rs1179360107 195 dbSNP
rs768739293 198 dbSNP
rs774676383 201 dbSNP
rs577283183 207 dbSNP
rs1418237692 210 dbSNP
rs1392381676 215 dbSNP
rs1463026645 220 dbSNP
rs1410031886 221 dbSNP
rs1022278547 222 dbSNP
rs930424797 226 dbSNP
rs1390066568 227 dbSNP
rs1309573005 229 dbSNP
rs1299869565 236 dbSNP
rs966661977 236 dbSNP
rs745758152 240 dbSNP
rs1472025803 243 dbSNP
rs1220434430 246 dbSNP
rs1191559560 254 dbSNP
rs1049262120 258 dbSNP
rs894330447 259 dbSNP
rs141913965 261 dbSNP
rs79439030 263 dbSNP
rs1321009661 266 dbSNP
rs1465391187 269 dbSNP
rs368264846 270 dbSNP
rs911390681 271 dbSNP
rs542907778 272 dbSNP
rs1250245417 273 dbSNP
rs1030967659 274 dbSNP
rs898893500 277 dbSNP
rs540711791 283 dbSNP
rs3750900 292 dbSNP
rs1011016778 293 dbSNP
rs1022788847 299 dbSNP
rs111479559 299 dbSNP
rs1225674628 305 dbSNP
rs1366873695 309 dbSNP
rs1405737917 309 dbSNP
rs1395221296 310 dbSNP
rs906447484 320 dbSNP
rs1304448374 323 dbSNP
rs1466500903 325 dbSNP
rs1376093966 326 dbSNP
rs1295674519 332 dbSNP
rs953606446 334 dbSNP
rs1427952933 348 dbSNP
rs1219198583 349 dbSNP
rs3750899 350 dbSNP
rs1019086277 362 dbSNP
rs1342324320 363 dbSNP
rs1184052140 372 dbSNP
rs894966545 375 dbSNP
rs1229988038 381 dbSNP
rs1010967060 387 dbSNP
rs966292548 388 dbSNP
rs1271773847 390 dbSNP
rs1022352119 396 dbSNP
rs1482538424 397 dbSNP
rs972282599 402 dbSNP
rs918942177 404 dbSNP
rs1314671859 406 dbSNP
rs1415290037 428 dbSNP
rs1349753852 432 dbSNP
rs1248287528 435 dbSNP
rs1306129239 442 dbSNP
rs1408012860 443 dbSNP
rs951781617 444 dbSNP
rs984582671 456 dbSNP
rs1398731450 461 dbSNP
rs193266357 463 dbSNP
rs1457643150 466 dbSNP
rs1367060419 468 dbSNP
rs1167396596 480 dbSNP
rs978504022 484 dbSNP
rs567448349 485 dbSNP
rs1411803598 486 dbSNP
rs1180657720 492 dbSNP
rs1029624034 503 dbSNP
rs72837404 521 dbSNP
rs1390726460 532 dbSNP
rs12218072 541 dbSNP
rs934590892 553 dbSNP
rs1389577554 559 dbSNP
rs184131827 560 dbSNP
rs534271164 566 dbSNP
rs1325739249 569 dbSNP
rs1328238896 574 dbSNP
rs892497751 576 dbSNP
rs1337595091 581 dbSNP
rs941528718 586 dbSNP
rs974210361 587 dbSNP
rs12782657 600 dbSNP
rs1388790790 602 dbSNP
rs1328194939 603 dbSNP
rs1436185592 608 dbSNP
rs1289753561 612 dbSNP
rs1462236140 614 dbSNP
rs1388454184 616 dbSNP
rs1367977870 617 dbSNP
rs1433475266 621 dbSNP
rs1294833682 623 dbSNP
rs1340810560 625 dbSNP
rs1228603369 628 dbSNP
rs773257445 629 dbSNP
rs1291568695 631 dbSNP
rs1319493435 632 dbSNP
rs1220564330 634 dbSNP
rs1491271538 635 dbSNP
rs1197501237 636 dbSNP
rs1268951399 636 dbSNP
rs1430974565 636 dbSNP
rs1483839957 636 dbSNP
rs372603508 636 dbSNP
rs1466218286 637 dbSNP
rs1186570867 638 dbSNP
rs1171658146 639 dbSNP
rs1247535223 639 dbSNP
rs1464268626 641 dbSNP
rs199649640 641 dbSNP
rs1210486020 645 dbSNP
rs1165279246 648 dbSNP
rs1411914539 650 dbSNP
rs1415065867 650 dbSNP
rs1232554447 655 dbSNP
rs1274211983 655 dbSNP
rs1404916526 656 dbSNP
rs1305899161 658 dbSNP
rs142169841 658 dbSNP
rs760690813 658 dbSNP
rs1441993725 659 dbSNP
rs1160409449 662 dbSNP
rs113002529 664 dbSNP
rs1319013188 665 dbSNP
rs1391264014 667 dbSNP
rs1456152898 672 dbSNP
rs371412235 673 dbSNP
rs866635839 674 dbSNP
rs374849927 677 dbSNP
rs1396429710 680 dbSNP
rs1285384632 682 dbSNP
rs1376561443 685 dbSNP
rs1227339100 687 dbSNP
rs879096982 688 dbSNP
rs1190220987 692 dbSNP
rs1245926608 692 dbSNP
rs1330907297 692 dbSNP
rs1206814407 694 dbSNP
rs1267408573 697 dbSNP
rs1198730206 702 dbSNP
rs1342948834 703 dbSNP
rs1282627218 704 dbSNP
rs1235261526 706 dbSNP
rs1364679263 707 dbSNP
rs1433256012 709 dbSNP
rs1202724860 717 dbSNP
rs777743289 717 dbSNP
rs746970211 721 dbSNP
rs1442874588 723 dbSNP
rs1189711362 724 dbSNP
rs1394859414 726 dbSNP
rs1235766826 729 dbSNP
rs796165759 732 dbSNP
rs1472603701 735 dbSNP
rs1183129933 736 dbSNP
rs1428572161 737 dbSNP
rs368324243 741 dbSNP
rs920352541 744 dbSNP
rs878980605 747 dbSNP
rs1236745633 748 dbSNP
rs1403548893 752 dbSNP
rs796789461 753 dbSNP
rs1335651566 759 dbSNP
rs1356910992 762 dbSNP
rs1413829035 763 dbSNP
rs372532320 763 dbSNP
rs1341561341 766 dbSNP
rs1216616026 768 dbSNP
rs1340480003 771 dbSNP
rs56297551 772 dbSNP
rs1284022404 774 dbSNP
rs1446418493 777 dbSNP
rs1357867824 778 dbSNP
rs1288579824 782 dbSNP
rs151219233 783 dbSNP
rs1330462313 784 dbSNP
rs1410235083 785 dbSNP
rs770929613 787 dbSNP
rs1161203155 794 dbSNP
rs1226360107 794 dbSNP
rs1418415661 797 dbSNP
rs1287413679 799 dbSNP
rs1482767409 801 dbSNP
rs1231307198 803 dbSNP
rs1206862678 804 dbSNP
rs1438645985 804 dbSNP
rs1248851394 805 dbSNP
rs1226911459 806 dbSNP
rs1337418821 806 dbSNP
rs1294443715 807 dbSNP
rs1345667693 809 dbSNP
rs201500247 810 dbSNP
rs749237042 810 dbSNP
rs1280827848 812 dbSNP
rs1437539846 814 dbSNP
rs1348891569 819 dbSNP
rs1321191125 820 dbSNP
rs1462759139 821 dbSNP
rs1395029522 824 dbSNP
rs1158317610 826 dbSNP
rs1441914388 831 dbSNP
rs1206211470 832 dbSNP
rs1405846154 832 dbSNP
rs1182999992 835 dbSNP
rs1470564937 839 dbSNP
rs1212132443 846 dbSNP
rs1246283622 846 dbSNP
rs1470100081 851 dbSNP
rs1274254572 853 dbSNP
rs1315614367 854 dbSNP
rs1254261102 856 dbSNP
rs1309814789 856 dbSNP
rs112156772 857 dbSNP
rs1272712311 861 dbSNP
rs1319688255 863 dbSNP
rs1371432113 863 dbSNP
rs1442723353 863 dbSNP
rs1453154854 876 dbSNP
rs1159755772 878 dbSNP
rs1346841827 878 dbSNP
rs1401287459 883 dbSNP
rs1424626147 884 dbSNP
rs1171168624 886 dbSNP
rs1394008522 891 dbSNP
rs189766045 892 dbSNP
rs1175197728 893 dbSNP
rs1422524929 897 dbSNP
rs1433545157 902 dbSNP
rs181275850 903 dbSNP
rs1262945013 904 dbSNP
rs1217216346 905 dbSNP
rs1308049887 906 dbSNP
rs1277635425 907 dbSNP
rs112840429 908 dbSNP
rs1372027074 914 dbSNP
rs1235998072 915 dbSNP
rs1407571058 924 dbSNP
rs1327961594 930 dbSNP
rs1348103885 934 dbSNP
rs929033656 941 dbSNP
rs1031438012 943 dbSNP
rs1363816233 944 dbSNP
rs1289368207 953 dbSNP
rs563212267 953 dbSNP
rs199809594 956 dbSNP
rs759161030 956 dbSNP
rs1331450560 960 dbSNP
rs1235419043 961 dbSNP
rs1272991085 963 dbSNP
rs1344147916 965 dbSNP
rs531577260 970 dbSNP
rs1393885163 971 dbSNP
rs1436686247 975 dbSNP
rs1276818622 976 dbSNP
rs1168204491 982 dbSNP
rs1482212005 983 dbSNP
rs1427106300 985 dbSNP
rs1264367240 986 dbSNP
rs1187591294 987 dbSNP
rs1483230870 990 dbSNP
rs567183066 991 dbSNP
rs1212341161 993 dbSNP
rs1485719235 994 dbSNP
rs368356294 995 dbSNP
rs551752327 997 dbSNP
rs1309020033 1000 dbSNP
rs1197439194 1001 dbSNP
rs1246648783 1002 dbSNP
rs1296081414 1002 dbSNP
rs1227565310 1003 dbSNP
rs1450566477 1007 dbSNP
rs1168709584 1011 dbSNP
rs1416627788 1013 dbSNP
rs1376211912 1015 dbSNP
rs1391425874 1015 dbSNP
rs1307643481 1017 dbSNP
rs1427475916 1018 dbSNP
rs1460702321 1019 dbSNP
rs1375108479 1022 dbSNP
rs1171514464 1024 dbSNP
rs1390554733 1030 dbSNP
rs1200602623 1031 dbSNP
rs1166960452 1033 dbSNP
rs1485709183 1037 dbSNP
rs1329329206 1039 dbSNP
rs1337430330 1045 dbSNP
rs1388311703 1046 dbSNP
rs1481390444 1049 dbSNP
rs56003522 1050 dbSNP
rs1251557539 1054 dbSNP
rs1220483420 1060 dbSNP
rs1332419568 1061 dbSNP
rs1295049914 1065 dbSNP
rs1321262300 1067 dbSNP
rs555709610 1067 dbSNP
rs1356144224 1075 dbSNP
rs577319973 1080 dbSNP
rs1435668540 1081 dbSNP
rs1299980250 1089 dbSNP
rs1340104026 1092 dbSNP
rs1392821920 1095 dbSNP
rs1227049461 1099 dbSNP
rs1189449243 1104 dbSNP
rs1392319287 1105 dbSNP
rs140442536 1108 dbSNP
rs1475845212 1108 dbSNP
rs1178990002 1110 dbSNP
rs1358662314 1110 dbSNP
rs1208430886 1112 dbSNP
rs1250710202 1112 dbSNP
rs1190338339 1117 dbSNP
rs1185030625 1118 dbSNP
rs1438685836 1118 dbSNP
rs1214211652 1122 dbSNP
rs1258913994 1125 dbSNP
rs1328337850 1125 dbSNP
rs1236897265 1127 dbSNP
rs1047892311 1133 dbSNP
rs867971926 1133 dbSNP
rs1465762537 1135 dbSNP
rs1191031326 1136 dbSNP
rs1249387874 1137 dbSNP
rs1447120680 1142 dbSNP
rs527768838 1144 dbSNP
rs1369203802 1145 dbSNP
rs1328299934 1148 dbSNP
rs1462317488 1149 dbSNP
rs1384806375 1150 dbSNP
rs1368692225 1152 dbSNP
rs544947235 1153 dbSNP
rs185639306 1154 dbSNP
rs1371900210 1156 dbSNP
rs1363936543 1159 dbSNP
rs1457744900 1159 dbSNP
rs148942959 1159 dbSNP
rs1254526366 1160 dbSNP
rs201504164 1162 dbSNP
rs777982272 1162 dbSNP
rs1363184989 1167 dbSNP
rs1193975018 1169 dbSNP
rs113564456 1170 dbSNP
rs547535236 1176 dbSNP
rs1342514555 1178 dbSNP
rs370868355 1183 dbSNP
rs1206891560 1188 dbSNP
rs111639513 1189 dbSNP
rs1261433611 1195 dbSNP
rs553722032 1198 dbSNP
rs1339009854 1199 dbSNP
rs1022923293 1219 dbSNP
rs572186549 1222 dbSNP
rs1043856809 1230 dbSNP
rs188883380 1232 dbSNP
rs970123111 1233 dbSNP
rs141304627 1241 dbSNP
rs1010705481 1248 dbSNP
rs531609642 1250 dbSNP
rs1485789764 1251 dbSNP
rs1384473754 1260 dbSNP
rs966178449 1261 dbSNP
rs181634166 1268 dbSNP
rs1385014097 1270 dbSNP
rs993772104 1274 dbSNP
rs1026552700 1280 dbSNP
rs951777821 1285 dbSNP
rs1173881182 1294 dbSNP
rs1425243409 1295 dbSNP
rs984860329 1299 dbSNP
rs747067405 1301 dbSNP
rs372929910 1303 dbSNP
rs955383633 1307 dbSNP
rs1007279504 1311 dbSNP
rs1018551244 1312 dbSNP
rs1235373246 1313 dbSNP
rs533506016 1319 dbSNP
rs1386361740 1325 dbSNP
rs1452915834 1326 dbSNP
rs769716916 1336 dbSNP
rs1303520587 1338 dbSNP
rs764739965 1339 dbSNP
rs1412307947 1345 dbSNP
rs1376813090 1349 dbSNP
rs1313093797 1351 dbSNP
rs928495548 1352 dbSNP
rs934482921 1360 dbSNP
rs1292899819 1364 dbSNP
rs1417084331 1367 dbSNP
rs1351280155 1372 dbSNP
rs1475628183 1374 dbSNP
rs11196484 1381 dbSNP
rs914472389 1382 dbSNP
rs1474260050 1388 dbSNP
rs1259759703 1390 dbSNP
rs1316866286 1394 dbSNP
rs947287501 1397 dbSNP
rs755464448 1412 dbSNP
rs1271172682 1417 dbSNP
rs927641327 1433 dbSNP
rs571943418 1434 dbSNP
rs1340505448 1439 dbSNP
rs1044126124 1453 dbSNP
rs1293207342 1454 dbSNP
rs1256120613 1455 dbSNP
rs939046571 1464 dbSNP
rs889095591 1479 dbSNP
rs1440875349 1480 dbSNP
rs1352348337 1481 dbSNP
rs374047183 1487 dbSNP
rs1208357716 1491 dbSNP
rs767942016 1507 dbSNP
rs1040462404 1516 dbSNP
rs1162676002 1517 dbSNP
rs902039998 1528 dbSNP
rs1256381213 1530 dbSNP
rs1483139009 1531 dbSNP
rs368435217 1533 dbSNP
rs993655098 1543 dbSNP
rs1184111369 1545 dbSNP
rs1026605042 1556 dbSNP
rs1409422840 1569 dbSNP
rs1469703849 1574 dbSNP
rs2419875 1577 dbSNP
rs1176661329 1581 dbSNP
rs1006440147 1583 dbSNP
rs1184331741 1586 dbSNP
rs1379511180 1586 dbSNP
rs1458481849 1588 dbSNP
rs527870380 1596 dbSNP
rs549275722 1597 dbSNP
rs981186929 1599 dbSNP
rs1043578473 1603 dbSNP
rs138816127 1604 dbSNP
rs11196485 1608 dbSNP
rs1323600247 1609 dbSNP
rs11196486 1611 dbSNP
rs570898355 1617 dbSNP
rs1395050262 1619 dbSNP
rs1158294115 1622 dbSNP
rs538386485 1635 dbSNP
rs1400188300 1639 dbSNP
rs73361874 1644 dbSNP
rs1160485580 1645 dbSNP
rs1440588869 1650 dbSNP
rs1373018261 1660 dbSNP
rs1192087063 1663 dbSNP
rs1220382583 1675 dbSNP
rs1470112429 1680 dbSNP
rs74874608 1683 dbSNP
rs1314595171 1693 dbSNP
rs1285794191 1694 dbSNP
rs910568612 1695 dbSNP
rs1018249865 1702 dbSNP
rs1231443282 1704 dbSNP
rs943336159 1706 dbSNP
rs1278937432 1712 dbSNP
rs1371543217 1715 dbSNP
rs542831989 1730 dbSNP
rs1040514510 1736 dbSNP
rs1369773218 1751 dbSNP
rs1288203056 1755 dbSNP
rs1428603945 1764 dbSNP
rs1342456382 1766 dbSNP
rs778997270 1772 dbSNP
rs2419874 1787 dbSNP
rs995752688 1797 dbSNP
rs1394637769 1798 dbSNP
rs772014301 1799 dbSNP
rs564943635 1802 dbSNP
rs141917249 1808 dbSNP
rs1048369020 1812 dbSNP
rs1426376930 1813 dbSNP
rs775455230 1813 dbSNP
rs1191756367 1814 dbSNP
rs2419873 1826 dbSNP
rs1244359700 1827 dbSNP
rs1216630857 1833 dbSNP
rs981997000 1835 dbSNP
rs927750409 1836 dbSNP
rs960703800 1842 dbSNP
rs1452458305 1845 dbSNP
rs1312533325 1847 dbSNP
rs1006901732 1853 dbSNP
rs1212616765 1866 dbSNP
rs1363925950 1869 dbSNP
rs768504839 1883 dbSNP
rs185954531 1884 dbSNP
rs578055566 1894 dbSNP
rs946669889 1900 dbSNP
rs1354381398 1905 dbSNP
rs1359999661 1908 dbSNP
rs1002491689 1910 dbSNP
rs1427125198 1921 dbSNP
rs879111148 1928 dbSNP
rs4431982 1930 dbSNP
rs923830504 1932 dbSNP
rs988493468 1935 dbSNP
rs1483347811 1946 dbSNP
rs560651029 1948 dbSNP
rs1366151110 1949 dbSNP
rs1051338860 1951 dbSNP
rs1021896874 1960 dbSNP
rs1309111544 1964 dbSNP
rs143841199 1970 dbSNP
rs1232656497 1972 dbSNP
rs11196487 1978 dbSNP
rs549556280 1983 dbSNP
rs1039758793 1984 dbSNP
rs11196488 1988 dbSNP
rs1230247388 1990 dbSNP
rs1297828050 1997 dbSNP
rs995779457 1999 dbSNP
rs1025916671 2000 dbSNP
rs887331939 2002 dbSNP
rs1325058325 2006 dbSNP
rs1461411874 2008 dbSNP
rs148166408 2010 dbSNP
rs1306493445 2013 dbSNP
rs976082134 2017 dbSNP
rs1036229923 2022 dbSNP
rs1266937707 2028 dbSNP
rs1467121402 2029 dbSNP
rs1192900047 2030 dbSNP
rs923232643 2036 dbSNP
rs1212870627 2037 dbSNP
rs1332532420 2038 dbSNP
rs1274994008 2039 dbSNP
rs1248800854 2053 dbSNP
rs534850833 2056 dbSNP
rs1184801045 2059 dbSNP
rs990522768 2064 dbSNP
rs1419076336 2065 dbSNP
rs1306540342 2068 dbSNP
rs1023287249 2074 dbSNP
rs570947544 2077 dbSNP
rs386747797 2081 dbSNP
rs967670183 2081 dbSNP
rs11196489 2082 dbSNP
rs11196490 2083 dbSNP
rs1207686363 2089 dbSNP
rs11196491 2090 dbSNP
rs986688903 2097 dbSNP
rs1047782781 2112 dbSNP
rs887966025 2114 dbSNP
rs112167659 2116 dbSNP
rs1045082743 2117 dbSNP
rs1457959795 2119 dbSNP
rs1362763960 2123 dbSNP
rs906128731 2129 dbSNP
rs1156456299 2135 dbSNP
rs1003046409 2145 dbSNP
rs1056740573 2161 dbSNP
rs1420462948 2163 dbSNP
rs1238436310 2164 dbSNP
rs1192717857 2166 dbSNP
rs1466975947 2168 dbSNP
rs1436660360 2181 dbSNP
rs1267857282 2185 dbSNP
rs1254811801 2186 dbSNP
rs141961898 2193 dbSNP
rs1357112365 2197 dbSNP
rs554845696 2198 dbSNP
rs1237007986 2213 dbSNP
rs1010427425 2214 dbSNP
rs1228512976 2216 dbSNP
rs1021364089 2220 dbSNP
rs1310278854 2223 dbSNP
rs1314660246 2228 dbSNP
rs756546609 2229 dbSNP
rs1387901267 2231 dbSNP
rs1384912302 2236 dbSNP
rs10885502 2247 dbSNP
rs1018484297 2262 dbSNP
rs372999030 2268 dbSNP
rs931318284 2270 dbSNP
rs10885503 2273 dbSNP
rs976635376 2284 dbSNP
rs1452329696 2294 dbSNP
rs1003535263 2301 dbSNP
rs1241537880 2301 dbSNP
rs1035897768 2303 dbSNP
rs1259600222 2304 dbSNP
rs1011974581 2306 dbSNP
rs530251009 2306 dbSNP
rs1287003347 2311 dbSNP
rs1023354395 2312 dbSNP
rs558875479 2313 dbSNP
rs1276934449 2324 dbSNP
rs967737271 2325 dbSNP
rs1326301387 2330 dbSNP
rs979122657 2332 dbSNP
rs1401306390 2333 dbSNP
rs150663105 2336 dbSNP
rs1311873318 2341 dbSNP
rs1432519146 2343 dbSNP
rs372626206 2343 dbSNP
rs1475076300 2351 dbSNP
rs1172891819 2354 dbSNP
rs1160290194 2355 dbSNP
rs750879953 2358 dbSNP
rs1371202153 2360 dbSNP
rs983976368 2361 dbSNP
rs1478835010 2364 dbSNP
rs545405206 2367 dbSNP
rs942071814 2371 dbSNP
rs1344063272 2372 dbSNP
rs1281013562 2377 dbSNP
rs370847579 2378 dbSNP
rs1339219162 2380 dbSNP
rs572509982 2381 dbSNP
rs927438761 2387 dbSNP
rs758630714 2391 dbSNP
rs542742876 2393 dbSNP
rs938957196 2400 dbSNP
rs1057299501 2401 dbSNP
rs1412404750 2414 dbSNP
rs1341832102 2419 dbSNP
rs7086994 2422 dbSNP
rs139851777 2423 dbSNP
rs1331162266 2424 dbSNP
rs1172695421 2425 dbSNP
rs10885504 2427 dbSNP
rs565261813 2432 dbSNP
rs758464781 2433 dbSNP
rs1007015956 2443 dbSNP
rs779961178 2444 dbSNP
rs532651399 2450 dbSNP
rs746880760 2452 dbSNP
rs965183232 2457 dbSNP
rs547379798 2462 dbSNP
rs143527752 2464 dbSNP
rs1013046522 2471 dbSNP
rs768595374 2472 dbSNP
rs1043167535 2473 dbSNP
rs950817356 2478 dbSNP
rs983474391 2485 dbSNP
rs1001013816 2488 dbSNP
rs1485428821 2496 dbSNP
rs1273118875 2501 dbSNP
rs909172356 2507 dbSNP
rs536394477 2514 dbSNP
rs1183383512 2531 dbSNP
rs963508253 2541 dbSNP
rs1333653773 2553 dbSNP
rs572025118 2557 dbSNP
rs1158494089 2558 dbSNP
rs1007868724 2563 dbSNP
rs367693535 2564 dbSNP
rs3206207 2565 dbSNP
rs938842633 2569 dbSNP
rs963925179 2575 dbSNP
rs1403668041 2579 dbSNP
rs3206208 2582 dbSNP
rs1416116757 2583 dbSNP
rs1314113647 2585 dbSNP
rs1164021894 2591 dbSNP
rs1469779353 2598 dbSNP
rs1373274755 2603 dbSNP
rs1236603288 2610 dbSNP
rs368367449 2611 dbSNP
rs975249304 2613 dbSNP
rs1057351893 2614 dbSNP
rs1252916261 2616 dbSNP
rs1220079040 2624 dbSNP
rs1308457029 2627 dbSNP
rs3206209 2628 dbSNP
rs1289925291 2633 dbSNP
rs1452810762 2633 dbSNP
rs760723872 2633 dbSNP
rs199773424 2637 dbSNP
rs1323786522 2638 dbSNP
rs538878125 2638 dbSNP
rs1278868230 2639 dbSNP
rs56896156 2640 dbSNP
rs7086925 2641 dbSNP
rs1278232546 2642 dbSNP
rs946249697 2642 dbSNP
rs908564979 2643 dbSNP
rs1400202862 2646 dbSNP
rs1378624800 2647 dbSNP
rs1160747640 2648 dbSNP
rs77600887 2649 dbSNP
rs78417531 2650 dbSNP
rs938699983 2651 dbSNP
rs1057098138 2654 dbSNP
rs537258662 2655 dbSNP
rs904156286 2656 dbSNP
rs1254502733 2657 dbSNP
rs1436421761 2658 dbSNP
rs1487061334 2661 dbSNP
rs1287707141 2671 dbSNP
rs1216954044 2679 dbSNP
rs1346844421 2680 dbSNP
rs942482154 2683 dbSNP
rs1065209 2685 dbSNP
rs1269520738 2687 dbSNP
rs901034184 2689 dbSNP
rs1358765601 2693 dbSNP
rs1300248568 2699 dbSNP
rs1174993532 2707 dbSNP
rs1392693313 2709 dbSNP
rs1375096137 2710 dbSNP
rs1174330165 2713 dbSNP
rs147155533 2714 dbSNP
rs904685389 2727 dbSNP
rs534572302 2733 dbSNP
rs887040301 2737 dbSNP
rs769458174 2738 dbSNP
rs1016286299 2739 dbSNP
rs1253893441 2745 dbSNP
rs1327861173 2746 dbSNP
rs191847675 2754 dbSNP
rs1272185859 2755 dbSNP
rs1331640748 2761 dbSNP
rs1216774014 2762 dbSNP
rs1442983626 2771 dbSNP
rs1280128158 2773 dbSNP
rs554176414 2779 dbSNP
rs1400705648 2786 dbSNP
rs1354987426 2796 dbSNP
rs1301394014 2810 dbSNP
rs963691954 2811 dbSNP
rs1370334466 2813 dbSNP
rs1467889705 2814 dbSNP
rs1360163151 2817 dbSNP
rs1170327190 2819 dbSNP
rs892183698 2824 dbSNP
rs1426441437 2825 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::|||||   :|||||| 
Target 5' aucAUGCCAUU---GCACUCCa 3'
4 - 22
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::|||||   :|||||| 
Target 5' aucAUGCCAUU---GCACUCCa 3'
10 - 28
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000354462.3 | 3UTR | AAGAUCAUGCCAUUGCACUCCAGCCUGGGCAACAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000354462.3 | 3UTR | UGAGCCAAGAUCAUGCCAUUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*