miRTarBase - #MIRT672217 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DCAF7   
Synonyms AN11, HAN11, SWAN-1, WDR68
Description DDB1 and CUL4 associated factor 7
Transcript NM_005828   
Expression
Putative miRNA Targets on DCAF7
3'UTR of DCAF7
(miRNA target sites are highlighted)
>DCAF7|NM_005828|3'UTR
   1 TGTTGGTGGCGCTGTGCCCACGAGGCAGGGGCTTTTGTATTTCCTGCCTCTGCCCCACCCCCAAAGTAAGAAGAAACATG
  81 TTTCCAGTGGCCAGTATGTCTTTCATTGCTTTGCACCCACTGTTACCAGAAGCTGCTCTAGGAGTTCCTGGCCAGTCACC
 161 CCATCGCCCTCTGTGGCAGACTCAGTGCTGTGTGGCGCCTCCTCAGCCCAGGGCTGAGTTTTAAGATTTTCTCTCCTTTC
 241 CTCTTCTCCTTTGGTTCCTCAATTAAAAAATGTGTGTATATTTGTTTGTCAGGCGTTGTGTTGAGGAGCAGTTCACGCAC
 321 TGGCTGTGTCTATTCCTCTGCCCAGGTGTCTCTGTTTGCTGCCCAAGGCAGCAGTTCATGTCTCGTCCATGTCCATGTTC
 401 GTGTTAGCACTTACGTGGGAACAAATACCAATTTGTCTTTTCTCCTAGTATCAGTGTGTTTAACAAATTTTAACTTTGTA
 481 TATTTGTTATCTATCAGGCTAATTTTTTTATGAAAAGAATTTTACTCTCCTGCTTCATTTCTTTGTCTTATAGTCCTCCC
 561 TCTTTGCACCTTCTTCTCTTCCCTCAGTGCCTGGAGCTGGTACTGGGCCCCTGGCCCCATGAGCAGTTTGCCTTCTTGAG
 641 TCACTGCCTGTGTAGTACATACCTGACCGGGAGTCCAAACCACCTTGGTGCTCTGAAGTCCACTGACTCATCACACCTTT
 721 CTTAGCCTGGCTCCTCTCAAGGGCATTCTGGGCTTGTAAACAGACATAGGAAGCCTCTGTTTACCCTGAAGCACCACTGT
 801 CCAGCCCATTGGTTCCCACTGGCAGCATGGTAGAGCTGAGAGAAACAGGCTCTCAGGGTACCTGACTTGAGGGGAATCGT
 881 TTCATGAAGCTGAACTTCAAGCATATTTCCAGTACATTCTTTCAGAGTCTGTTTTTCCATCCAAATATAAGCCCCAGGCC
 961 ATTCCACTTAGTGTCTTTTCAATGATAGGCAAGAATGATATCTGAGTTGAACTTCGGTGCTTCTGTTGTTTGAGTTTACT
1041 GTGCCTGGTGGTATATTGGGCATTCTTTGGATTGAGTGTTCTGAGGTGAGAGAGTCTTCCCGAGGCATCCTGTCTGTGCT
1121 TCCAACCCTGAACAAGACCTTACATGAGAGATGGACTGATGGACTGCGGCAATCCTGGGCTGTCAAGTGGATAGATAGTT
1201 AAAAAGCATTATACTGTGGGTAATGAAAAGGGAGGAAAAAAAAAGAAGGAAAAGGAATTATAGACCCCCAGGGTCAGCCA
1281 GTTAAGAGCTCTACCCACACCTGTCAACCCCTCTCTCCCCCAGTTTAGGTTCTGAGCAGTATTGGACTTGTAGCCTGCAG
1361 TTGTCTTTTGACTTGCAGGCCGCAGGTGTCTTTCTGTTATGTGAATGAGTTCCATGGAGGGGCATATGTGTGATTCCACC
1441 GTTAGATGAGCCCTTGGGGCAGGCAGTTTGGGATGTGCTCTTGGGGGAAAGTTGGCTGTTTCCTTGCGCTCTGCTCCTAC
1521 CCGAAGGTTTTTAAGTCCCTCTGAATTGCTCATCTGAGATTAGTAGAGTAGCAGGCCTGAAGGATGATGGTTTTGTCCTC
1601 TTTGGTTCTCACCTGCTTGAGAAGTAAAACAGTAACTTTGTTCTTCTGGGCCCTTAAGCTTTTTTGGTTAAGTCTTCCTT
1681 TTCAGAAGTAGATGTCATTATATGCCAAAAGTCTAGCTCTTTGCTTTACCATACAGGGACCTGTCCCAAAGAAAAAGGCT
1761 CTTTTTTTAGCCAGCATATTTCCCCTTCTACCCTTTTACTTTGTTGTTCTGATTTTAGGACTCTGGCTGGCCATGTGCTT
1841 GTGGTTGCCTCTCCTGCATTTGCCACTGGATTTGCACTGCATCGTTTGGAGATACAAAGCGAGCAGTTCTTGGTCAGAAC
1921 CCTCCTCTGCTTTTCATTGTGTTTGATAATGGTTACTGGGTCCTTCTCTCAAGGGTAGCAAGGCCAAGCTGATGGCTGCT
2001 TGTTTAGGAGGCCATCAGTTCCTTCCTGTGGAGAAGGGTCTGAAATGGAAGTCAGTGGTAGAAGGGGCTGGTCTGCTGGG
2081 CAGGGCTTACATCCACTGAGTTCTAAGATTCCTTTCCTGATCTGCACCTACGCCTGGTCTGTATGGTGGAATTTGTCAGC
2161 TGGAACTCAGAAACAACAACTTGAAAAAAAAATAATAATTAGAACATATTTGCATAAGATAGCTATTTACTCTGGAAACC
2241 AACAACTTTTGAGATTTCCCTTGCCCTGTGGACGCCCAGCTCCTGTCATCCTTCCTTAGGTCCTGCAGTACAGTCTTCCC
2321 CTGAATGCCACCGGGGACCCAGGGGGACTCCACCCCCCTAAGCAAGCACACACATACTCACAGTTGATGAGTTGCTGGTC
2401 TTTGAGTCCCAGCTCTCTTACCCTCCCTTTACTCCACCAGCCCGACGACCCATGACTGAGGAGGGGATTTCTACAGTCTC
2481 AGGATTTAGAAAGTCTGTAAGCCATCCATGCTCCAGAAAGCACCGATCTGTTGTAGTTGCAAAAACAACTCTGTAATTTG
2561 TTGAGGTTCTCAAACTGACAGCCAGCGAGACTGGGTGGGAGGCCCTGGATCTGTTCTCCCTGACTGCGGGAGGAGCAGCC
2641 ACTAGGACTTTAGCAGGAAGCCCACATGGAGGCTCCGCCAGGCTGTGGCCCAGCTGGTGATGGCCCTTTTGCTCCTGGCA
2721 GCCTGAGGCACAGCTGCCTGTATTGTCCTCATCTGTTCTGACTGAAGGATGGAGGTGCTGAATAAATTAGGCCTCAGGCC
2801 TCTACCACCAGAGAGCTGGAGAATGGGTCCACGTCATTCAAGGACCTGAATTTTTTATGCTCAGGAGCATTGGAATCCTC
2881 TTCTTCCAGGGAGGAATTAGCCTGCAAGGTTAGGACTTGAAGAGGGAAGGTATTTAATAACTGGGCGAGGATGGGTGTGG
2961 TGGCTCACACCTGTAATCCCAGCATTTTGGGAGGCTGAGGTGGCCAGATCCCAAGGTCAGAAGATCGAGACCATCCTGGC
3041 TAACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAAAAATTAGCCGGGGGTGGTGGCGGGTACCTGTAGTCCTAGC
3121 TACTTGGGAGGCTGAGGCAGGAGAATGGCGTGAACCTGGGAGGTGGAGCTTGCAGTGAGCCAAGATCGTGCCACTGCACT
3201 CCAGCCTGGGCGACAGAGCAAGACTCCGTCTCAAAAAATAAAAAAAAAAAAAAAATAGGTGAAAATTCCTTATAAATCCA
3281 GGATTGGCTCTGAGAGAACTGGCTAAGATTCAGGAAGAAACAAAAAATTCAGAATCCTACAAGGTTTTGATGACAATTAG
3361 GGCCAAAATTTTAGGAGGAGATGTAGGATGCAGGAGAAAATTAAAGTGTTTTCTTTATATCAGAGGAGGAAATAGTAGAG
3441 GTCAGTGAAGGTCTGGGGTAGGGAAACATTCAGACTGTCCATTGCATGGCTGTGGAGTGAGACTGCCCTTAGCCTGGGTC
3521 AGCCTTCCTGGGCCATAAATTGGGCATCCGTGATGCTAGGTAACTGTGGGAACAAAATGACAGCTTAGAGCAGCCATGGG
3601 TGATGTTTGGTGGTAAAAAACCTACAGGCGTTTGGGGTCCCATGATTGTTCCAGACCATGACTCTTCCTGGTTGTGGGTT
3681 TGTTACAGAGCAGGAGAAGCAGAGGTTATGACAGTTATGCAGACTTTCCCCCTCCTTTTTCTCTTTTCTCTTCCCCTTGC
3761 TTTTCCACTGTTTCTTCCTGCTGCCACCTGGGCCTTGAATTCCTGGGCTGTGAAGACATGTAGCAGCTGCAGGGTTTACC
3841 ACACGTGGGAGGGCAGCCCAGTACTGTCCCTCTGCCTTCCCCACTTTGAGAATATGGCAGCCCCTTTCATTCCTGGCTTG
3921 GGGTAGGGGAGACCATTGAAGTAGAAGCCTCAAAGCAGACTTTTCCCTTTACTGTGTGTACTCCAGGACGAAGAAGGAAG
4001 ATCATGCTTGATACTTAGATTGGTTTTCCCAGGGAAGAGGGCGGAGCAGAGCAAAGTCACTGTGAACCCTGGGCCAGGCC
4081 CTGGCTGGGCCAGCTCCTGAGAGCGTCTCGTGTTGCAGACCCTTGCCCACTTCACCCACCTGCACCTTCTCCCCCTCTCA
4161 CAGTGTCACTGCTGCTAATGGTCAAAGTCAAATGTGTGGCCACATGGGATGGGCCAGGTCCTCTCAGGCTACTTTCTGGA
4241 TGTCATTTTTAAAATATGGAAACATGCAGGTGCCTTCCCAAAGAGGCTTGGACTGGTATATCCAACGAGAAACAAATAAG
4321 CTAAAGAAAGTTTAAACTCAAGAAGAAAGATGTTGACAGTCTATGTAACAGCTGGAAAGTTTATAGGCACCCACCTTTGG
4401 GACAACCCAGTGATTATGAACATGTGATATCTACTATTTAAAAGAAATGTTCTCACCTTGGGTTGATTGTGGTATACCAT
4481 GTGTTATGAAAATTGTTGAGCTGAAGCTTTGAATCGATTTAGTTGAGTCTGACTCACTTGCTTTGGTTCCTGTGTATTTT
4561 ACTACCCCTCTTGTCAGTGACCTTCCTTCCCCACCCCACCCAGAGTGAATTTGTAGCATGATTGTATAAACCTCTATGTA
4641 GAAAATGGAGATTTCTTGCTCTGAAATGTTAAGCTCTAACTGATCCATTTCTGTGTCCTTTAGCCTAGTATGTCTGAACT
4721 TCCATTCTTGTTATATATTTAAACTTTCCCTCTATATTATAGGTTTTGTGGCATCCACGGTCAGGTGTAGAGGAAGCTGC
4801 CCCTTGCAGAACTGTACTGTAATATTTTTCTTTTATAAATATTTTCACAGGACTGATTGTACACAGGGCTTGTAATAAAA
4881 TTTTAACACTGTGCTGTGAAACAACTATGGGGAATCTCCATTGAAGGCTACTTCATGGGCACCTGAAAGTGGAGTGTTAT
4961 AGCTATGACTTTCTATTTCTTGTTTCCTAAGTAAATTAAACCTAATTTTCACCCTTTCATTCTGTTTCAGCCTCCTGTAT
5041 AAGAAGTACCGTATTTTCTGCCCATCATACTTTGTAATAAAACTTGAACATGTATAGATTGACTGAAAAAAAAAAAAAAA
5121 AA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG---UGUGAGGu 5'
            || |:|: || |   :|||||| 
Target 5' ccAAGATCG-TGCCACTGCACTCCa 3'
3180 - 3203 135.00 -15.50
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |  ||| |:|| |||| 
Target 5' tgAAAAGAATT-TTACTCTCCt 3'
511 - 531 127.00 -7.20
3
miRNA  3' guUUGUGGUAACAGUGUGAggu 5'
            ||:|  ||| | |||||   
Target 5' gtAATAAAATTTTAACACTgtg 3'
4872 - 4893 124.00 -6.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN1199691 12 COSMIC
COSN31500971 12 COSMIC
COSN30489720 19 COSMIC
COSN26573470 27 COSMIC
COSN30119003 33 COSMIC
COSN30166631 59 COSMIC
COSN30452561 60 COSMIC
COSN16130797 172 COSMIC
COSN8603598 196 COSMIC
COSN20060429 198 COSMIC
COSN31611275 220 COSMIC
COSN9672241 389 COSMIC
COSN26556607 631 COSMIC
COSN31489694 719 COSMIC
COSN30159469 762 COSMIC
COSN19017640 853 COSMIC
COSN30163755 899 COSMIC
COSN31601153 991 COSMIC
COSN29459952 1065 COSMIC
COSN30163744 1066 COSMIC
COSN30163757 1290 COSMIC
COSN8245018 1382 COSMIC
COSN31661230 1389 COSMIC
COSN1725539 1724 COSMIC
COSN16315908 1948 COSMIC
COSN16220272 1979 COSMIC
COSN22857689 2193 COSMIC
COSN22773850 2379 COSMIC
COSN29154472 2511 COSMIC
COSN22710266 2793 COSMIC
COSN19422043 2811 COSMIC
COSN1199692 3240 COSMIC
COSN9223152 3270 COSMIC
COSN22786919 3314 COSMIC
COSN16063456 4110 COSMIC
COSN5419138 4225 COSMIC
COSN31595226 4353 COSMIC
COSN16131653 4466 COSMIC
COSN16130707 4654 COSMIC
COSN1725540 4785 COSMIC
COSN26464990 4868 COSMIC
COSN31583921 4868 COSMIC
COSN26465312 4869 COSMIC
COSN20770761 4877 COSMIC
COSN17407134 5035 COSMIC
rs72845888 475 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751802058 5 dbSNP
rs755534865 10 dbSNP
rs372353252 11 dbSNP
rs753175361 12 dbSNP
rs538415233 19 dbSNP
rs1467654903 20 dbSNP
rs139063781 22 dbSNP
rs755859093 23 dbSNP
rs770993671 26 dbSNP
rs779929439 27 dbSNP
rs746730114 31 dbSNP
rs768475109 35 dbSNP
rs952890884 37 dbSNP
rs1018799163 44 dbSNP
rs1278627647 46 dbSNP
rs776749449 48 dbSNP
rs985625967 49 dbSNP
rs1216793486 54 dbSNP
rs761834537 57 dbSNP
rs1030838088 59 dbSNP
rs181669731 62 dbSNP
rs772787935 65 dbSNP
rs1239242036 69 dbSNP
rs1482412227 71 dbSNP
rs762668907 72 dbSNP
rs1264351243 77 dbSNP
rs770611742 78 dbSNP
rs975790520 79 dbSNP
rs1224783246 82 dbSNP
rs989365671 84 dbSNP
rs370521854 92 dbSNP
rs914928620 93 dbSNP
rs765902096 95 dbSNP
rs751204357 97 dbSNP
rs1323662722 98 dbSNP
rs1356879619 99 dbSNP
rs1409269351 105 dbSNP
rs922952271 108 dbSNP
rs759862233 115 dbSNP
rs767923247 117 dbSNP
rs753261300 118 dbSNP
rs1277534402 119 dbSNP
rs1368252200 120 dbSNP
rs1375670614 121 dbSNP
rs774239563 121 dbSNP
rs988720769 123 dbSNP
rs1280843025 127 dbSNP
rs1175132786 128 dbSNP
rs756556382 136 dbSNP
rs1325306392 139 dbSNP
rs914486181 140 dbSNP
rs1472840547 142 dbSNP
rs1210515069 143 dbSNP
rs1286989106 144 dbSNP
rs777836283 145 dbSNP
rs1489502314 153 dbSNP
rs72845886 154 dbSNP
rs1241846465 160 dbSNP
rs1478653077 162 dbSNP
rs1280690300 163 dbSNP
rs1193366068 166 dbSNP
rs1341652680 167 dbSNP
rs368191256 167 dbSNP
rs1422530489 169 dbSNP
rs1044587689 177 dbSNP
rs1413396442 180 dbSNP
rs927413302 182 dbSNP
rs1158928333 186 dbSNP
rs143091753 190 dbSNP
rs1229406375 197 dbSNP
rs1331726151 198 dbSNP
rs939101205 199 dbSNP
rs1057231852 201 dbSNP
rs1351445986 205 dbSNP
rs1057199292 206 dbSNP
rs61154039 207 dbSNP
rs994161821 218 dbSNP
rs1301985202 235 dbSNP
rs1049098703 238 dbSNP
rs888686746 242 dbSNP
rs1048718024 244 dbSNP
rs888663083 247 dbSNP
rs1007332072 249 dbSNP
rs1189021109 250 dbSNP
rs1007069646 263 dbSNP
rs1255026686 265 dbSNP
rs544922871 266 dbSNP
rs998234022 274 dbSNP
rs1030849500 277 dbSNP
rs1357710944 281 dbSNP
rs184771159 281 dbSNP
rs1267230502 287 dbSNP
rs572791423 288 dbSNP
rs116425232 296 dbSNP
rs965553465 298 dbSNP
rs1438191936 300 dbSNP
rs189505261 302 dbSNP
rs1030072060 307 dbSNP
rs955742830 310 dbSNP
rs980883927 315 dbSNP
rs540097291 317 dbSNP
rs367763509 318 dbSNP
rs968576787 328 dbSNP
rs1391376691 329 dbSNP
rs1164987031 330 dbSNP
rs1291224099 331 dbSNP
rs1455926323 331 dbSNP
rs757087709 333 dbSNP
rs979977805 337 dbSNP
rs1188779986 343 dbSNP
rs927143032 346 dbSNP
rs550741508 347 dbSNP
rs1450965941 349 dbSNP
rs1246531598 351 dbSNP
rs1188333485 352 dbSNP
rs1208650465 353 dbSNP
rs960452107 353 dbSNP
rs1355695691 355 dbSNP
rs918773977 362 dbSNP
rs1230827329 364 dbSNP
rs1340348472 376 dbSNP
rs930168743 385 dbSNP
rs778974732 386 dbSNP
rs938515236 388 dbSNP
rs180684025 391 dbSNP
rs1364352014 396 dbSNP
rs918673560 401 dbSNP
rs191819589 402 dbSNP
rs1323367380 410 dbSNP
rs998296427 414 dbSNP
rs1048394696 415 dbSNP
rs888716784 416 dbSNP
rs1488186916 442 dbSNP
rs1248861003 445 dbSNP
rs1052542334 448 dbSNP
rs781138099 452 dbSNP
rs1207396556 467 dbSNP
rs1482146448 474 dbSNP
rs72845888 475 dbSNP
rs1220071428 479 dbSNP
rs1039940403 480 dbSNP
rs1022090647 483 dbSNP
rs1345424899 483 dbSNP
rs371711204 486 dbSNP
rs969750609 487 dbSNP
rs901370284 494 dbSNP
rs770028003 500 dbSNP
rs1308055345 510 dbSNP
rs773405525 525 dbSNP
rs955754197 530 dbSNP
rs1415164528 538 dbSNP
rs1009871003 542 dbSNP
rs1368241166 551 dbSNP
rs1327731686 552 dbSNP
rs73333812 553 dbSNP
rs960344970 556 dbSNP
rs1171228052 560 dbSNP
rs1162118987 561 dbSNP
rs968337133 572 dbSNP
rs1413322622 573 dbSNP
rs1185052603 578 dbSNP
rs1482095572 590 dbSNP
rs116901530 594 dbSNP
rs1211025258 607 dbSNP
rs1465661380 610 dbSNP
rs1034264081 613 dbSNP
rs919019680 617 dbSNP
rs960185879 622 dbSNP
rs751333208 624 dbSNP
rs754775402 625 dbSNP
rs1198527502 634 dbSNP
rs552625156 644 dbSNP
rs992637815 645 dbSNP
rs774715457 648 dbSNP
rs1397652800 651 dbSNP
rs1288905945 668 dbSNP
rs918683768 669 dbSNP
rs1337068522 670 dbSNP
rs930017889 676 dbSNP
rs1381286679 677 dbSNP
rs1394271994 678 dbSNP
rs1311884295 680 dbSNP
rs1321270489 682 dbSNP
rs1331853114 683 dbSNP
rs1469604638 689 dbSNP
rs759962441 698 dbSNP
rs984142004 699 dbSNP
rs563789945 705 dbSNP
rs1339583993 708 dbSNP
rs1182524589 709 dbSNP
rs1316225751 710 dbSNP
rs942705905 717 dbSNP
rs1198449214 721 dbSNP
rs186146253 722 dbSNP
rs113188376 734 dbSNP
rs1039940389 736 dbSNP
rs1210462488 738 dbSNP
rs934160466 757 dbSNP
rs1180664262 767 dbSNP
rs922828672 774 dbSNP
rs780095468 779 dbSNP
rs1052403254 787 dbSNP
rs752170331 803 dbSNP
rs1256061994 810 dbSNP
rs1451524021 811 dbSNP
rs1477895240 820 dbSNP
rs1323001987 824 dbSNP
rs891564910 836 dbSNP
rs760237855 853 dbSNP
rs147493649 857 dbSNP
rs191388671 859 dbSNP
rs1009965224 860 dbSNP
rs1407150491 869 dbSNP
rs111823019 872 dbSNP
rs1176550372 873 dbSNP
rs1360726686 874 dbSNP
rs1450350435 877 dbSNP
rs753535132 879 dbSNP
rs1190281100 880 dbSNP
rs1484821969 882 dbSNP
rs1445541535 891 dbSNP
rs1302257005 899 dbSNP
rs1322973378 901 dbSNP
rs1287156257 902 dbSNP
rs1244735428 911 dbSNP
rs1002554443 914 dbSNP
rs1299670737 932 dbSNP
rs904221763 937 dbSNP
rs1433329666 942 dbSNP
rs1361781613 945 dbSNP
rs1294600859 957 dbSNP
rs576853611 961 dbSNP
rs149706712 983 dbSNP
rs1163044595 990 dbSNP
rs558619491 995 dbSNP
rs757177688 997 dbSNP
rs1167013257 1001 dbSNP
rs764955684 1002 dbSNP
rs575490952 1004 dbSNP
rs1025461534 1016 dbSNP
rs1218305883 1017 dbSNP
rs544132168 1024 dbSNP
rs1221108343 1028 dbSNP
rs1483129838 1029 dbSNP
rs750167206 1034 dbSNP
rs1225775716 1039 dbSNP
rs984235842 1045 dbSNP
rs561147750 1049 dbSNP
rs1307261515 1057 dbSNP
rs1302440300 1061 dbSNP
rs1221399443 1077 dbSNP
rs1366121565 1079 dbSNP
rs35782150 1081 dbSNP
rs758300542 1082 dbSNP
rs1302567756 1083 dbSNP
rs909963872 1090 dbSNP
rs1306379467 1095 dbSNP
rs984546659 1095 dbSNP
rs1017546221 1100 dbSNP
rs964265311 1102 dbSNP
rs1255931130 1103 dbSNP
rs374600213 1107 dbSNP
rs529882011 1108 dbSNP
rs111638367 1113 dbSNP
rs1260341396 1115 dbSNP
rs922857661 1134 dbSNP
rs934192916 1140 dbSNP
rs988181189 1143 dbSNP
rs748278855 1145 dbSNP
rs1253409482 1146 dbSNP
rs1193669191 1151 dbSNP
rs1426818403 1161 dbSNP
rs1052618032 1168 dbSNP
rs892664339 1169 dbSNP
rs946878108 1180 dbSNP
rs946819938 1185 dbSNP
rs1321931733 1191 dbSNP
rs1283203970 1194 dbSNP
rs1043799907 1218 dbSNP
rs367767886 1220 dbSNP
rs1390968948 1225 dbSNP
rs1403193974 1225 dbSNP
rs1361126089 1234 dbSNP
rs1421389759 1236 dbSNP
rs1467385387 1236 dbSNP
rs780761252 1237 dbSNP
rs1175589911 1249 dbSNP
rs904233990 1255 dbSNP
rs1413481755 1269 dbSNP
rs1001617111 1272 dbSNP
rs560269997 1273 dbSNP
rs778039576 1277 dbSNP
rs895742092 1279 dbSNP
rs896407983 1281 dbSNP
rs993370844 1287 dbSNP
rs1014206575 1289 dbSNP
rs1025968351 1290 dbSNP
rs887435339 1296 dbSNP
rs1369929387 1299 dbSNP
rs1341213447 1300 dbSNP
rs1025557935 1305 dbSNP
rs34694780 1308 dbSNP
rs144552836 1310 dbSNP
rs1005349317 1311 dbSNP
rs1380243324 1316 dbSNP
rs181422029 1318 dbSNP
rs1435644110 1319 dbSNP
rs568709457 1320 dbSNP
rs1390766492 1321 dbSNP
rs1219492666 1322 dbSNP
rs1284501943 1330 dbSNP
rs115903735 1342 dbSNP
rs1029836089 1344 dbSNP
rs753288461 1345 dbSNP
rs955643364 1349 dbSNP
rs1442426270 1355 dbSNP
rs1242843453 1358 dbSNP
rs1440999793 1367 dbSNP
rs1218441437 1370 dbSNP
rs988380660 1379 dbSNP
rs975837077 1382 dbSNP
rs1357118227 1383 dbSNP
rs548564873 1387 dbSNP
rs1244004018 1391 dbSNP
rs1359004942 1394 dbSNP
rs922651973 1395 dbSNP
rs955361221 1401 dbSNP
rs988388021 1406 dbSNP
rs774607601 1428 dbSNP
rs1316100260 1438 dbSNP
rs1381632195 1440 dbSNP
rs1190430694 1441 dbSNP
rs552541015 1442 dbSNP
rs185789508 1447 dbSNP
rs979813012 1466 dbSNP
rs1043840197 1471 dbSNP
rs1441284643 1473 dbSNP
rs190397461 1474 dbSNP
rs1451683238 1475 dbSNP
rs1371751791 1483 dbSNP
rs938058124 1483 dbSNP
rs1452726214 1487 dbSNP
rs1056265756 1489 dbSNP
rs772503291 1490 dbSNP
rs1220372306 1491 dbSNP
rs1490224483 1493 dbSNP
rs1275619820 1495 dbSNP
rs937084546 1497 dbSNP
rs776032314 1502 dbSNP
rs1055935727 1503 dbSNP
rs553882052 1508 dbSNP
rs895514564 1509 dbSNP
rs1351863553 1517 dbSNP
rs201246937 1518 dbSNP
rs1013922677 1519 dbSNP
rs760327841 1523 dbSNP
rs763683416 1532 dbSNP
rs1394700917 1533 dbSNP
rs1242753164 1539 dbSNP
rs887664935 1540 dbSNP
rs1478614359 1543 dbSNP
rs1005401375 1560 dbSNP
rs1379853558 1567 dbSNP
rs776223992 1569 dbSNP
rs1480146284 1573 dbSNP
rs555566607 1584 dbSNP
rs1252695909 1589 dbSNP
rs1207483924 1591 dbSNP
rs1005895748 1592 dbSNP
rs1039072760 1601 dbSNP
rs1016743297 1606 dbSNP
rs1194993648 1607 dbSNP
rs761562720 1608 dbSNP
rs570901759 1609 dbSNP
rs117156514 1611 dbSNP
rs556523657 1614 dbSNP
rs1288434343 1618 dbSNP
rs955507043 1625 dbSNP
rs1458968042 1627 dbSNP
rs1176480996 1634 dbSNP
rs1327824313 1637 dbSNP
rs1415369715 1640 dbSNP
rs955413190 1646 dbSNP
rs1473062487 1650 dbSNP
rs1469747001 1652 dbSNP
rs144164602 1678 dbSNP
rs750210418 1687 dbSNP
rs1468715423 1698 dbSNP
rs1232490343 1700 dbSNP
rs1403644536 1713 dbSNP
rs1188592285 1714 dbSNP
rs1442776320 1718 dbSNP
rs1264784647 1723 dbSNP
rs778694141 1742 dbSNP
rs1201618425 1754 dbSNP
rs1164557401 1757 dbSNP
rs146418478 1759 dbSNP
rs368450553 1762 dbSNP
rs980029691 1772 dbSNP
rs1224943495 1773 dbSNP
rs554876702 1777 dbSNP
rs926612581 1795 dbSNP
rs1278582294 1798 dbSNP
rs748389499 1801 dbSNP
rs1329679779 1802 dbSNP
rs1335713486 1810 dbSNP
rs11551211 1815 dbSNP
rs1448372309 1817 dbSNP
rs1385361228 1830 dbSNP
rs1335142573 1831 dbSNP
rs959480997 1834 dbSNP
rs1389994593 1845 dbSNP
rs1161967230 1849 dbSNP
rs1399022373 1862 dbSNP
rs1407426157 1863 dbSNP
rs1163993937 1866 dbSNP
rs926837646 1867 dbSNP
rs938167189 1884 dbSNP
rs917770757 1885 dbSNP
rs1286439608 1889 dbSNP
rs574714543 1897 dbSNP
rs1055584963 1901 dbSNP
rs1248532965 1902 dbSNP
rs1232134874 1906 dbSNP
rs1314597680 1907 dbSNP
rs1282954263 1909 dbSNP
rs916944851 1921 dbSNP
rs1319475772 1937 dbSNP
rs909136538 1940 dbSNP
rs1361183166 1951 dbSNP
rs1312531829 1953 dbSNP
rs766271952 1960 dbSNP
rs1291133158 1967 dbSNP
rs1429256134 1967 dbSNP
rs1344614774 1969 dbSNP
rs1324318951 1983 dbSNP
rs1426731741 1988 dbSNP
rs949705560 2004 dbSNP
rs1038733460 2011 dbSNP
rs1046733477 2015 dbSNP
rs887041274 2016 dbSNP
rs1420031928 2019 dbSNP
rs1188137242 2021 dbSNP
rs11551212 2023 dbSNP
rs997290947 2025 dbSNP
rs1005494726 2059 dbSNP
rs1222561864 2062 dbSNP
rs1490709955 2067 dbSNP
rs1051529141 2068 dbSNP
rs1221359210 2072 dbSNP
rs1187228064 2081 dbSNP
rs1343248060 2083 dbSNP
rs1038678647 2091 dbSNP
rs1213284297 2113 dbSNP
rs540416491 2120 dbSNP
rs538180787 2129 dbSNP
rs1276011116 2130 dbSNP
rs560333318 2132 dbSNP
rs867974406 2133 dbSNP
rs1302764516 2138 dbSNP
rs1430656509 2140 dbSNP
rs143268549 2146 dbSNP
rs868284996 2158 dbSNP
rs1001515625 2175 dbSNP
rs1029749927 2177 dbSNP
rs1415402379 2178 dbSNP
rs1418670768 2180 dbSNP
rs1200146003 2181 dbSNP
rs878879484 2184 dbSNP
rs959346976 2184 dbSNP
rs992093901 2184 dbSNP
rs891177038 2191 dbSNP
rs545537071 2193 dbSNP
rs950765739 2194 dbSNP
rs867156422 2203 dbSNP
rs1253396838 2205 dbSNP
rs1202838379 2219 dbSNP
rs1009537631 2237 dbSNP
rs1302820865 2239 dbSNP
rs983345238 2258 dbSNP
rs1020890083 2260 dbSNP
rs909033550 2264 dbSNP
rs542537783 2274 dbSNP
rs531178328 2275 dbSNP
rs751498148 2277 dbSNP
rs1375821628 2281 dbSNP
rs754848605 2287 dbSNP
rs1460276890 2301 dbSNP
rs1177002920 2309 dbSNP
rs959567602 2309 dbSNP
rs1470919252 2318 dbSNP
rs992700202 2326 dbSNP
rs753969031 2333 dbSNP
rs758222009 2333 dbSNP
rs1198094647 2334 dbSNP
rs1419201622 2337 dbSNP
rs921823402 2340 dbSNP
rs949758154 2343 dbSNP
rs1175185467 2345 dbSNP
rs982509654 2351 dbSNP
rs1276424144 2353 dbSNP
rs1244141380 2354 dbSNP
rs1322066919 2355 dbSNP
rs1239828812 2357 dbSNP
rs547285374 2358 dbSNP
rs867734552 2361 dbSNP
rs1391054837 2367 dbSNP
rs1372260674 2384 dbSNP
rs1337187151 2389 dbSNP
rs1454464629 2405 dbSNP
rs1403789118 2413 dbSNP
rs779508284 2420 dbSNP
rs1453849161 2421 dbSNP
rs1187341193 2422 dbSNP
rs1365091952 2426 dbSNP
rs1156417591 2428 dbSNP
rs891554406 2432 dbSNP
rs1386206678 2433 dbSNP
rs182946453 2438 dbSNP
rs945783394 2444 dbSNP
rs777831892 2447 dbSNP
rs1243072193 2452 dbSNP
rs1264061617 2453 dbSNP
rs1486857891 2457 dbSNP
rs908236730 2459 dbSNP
rs1360468940 2471 dbSNP
rs199737405 2475 dbSNP
rs568782868 2476 dbSNP
rs1380393645 2484 dbSNP
rs1335985283 2488 dbSNP
rs1382722303 2489 dbSNP
rs899708500 2509 dbSNP
rs1386404246 2512 dbSNP
rs1372709409 2513 dbSNP
rs904004616 2526 dbSNP
rs1478567103 2549 dbSNP
rs932509907 2550 dbSNP
rs1443152887 2552 dbSNP
rs1174607315 2554 dbSNP
rs1051345159 2556 dbSNP
rs1259687285 2564 dbSNP
rs1400727825 2578 dbSNP
rs1490545973 2587 dbSNP
rs891230955 2588 dbSNP
rs1299321543 2592 dbSNP
rs1220610868 2593 dbSNP
rs1356933015 2613 dbSNP
rs1361944018 2615 dbSNP
rs1034363083 2616 dbSNP
rs1294427091 2624 dbSNP
rs895371638 2628 dbSNP
rs1398811906 2635 dbSNP
rs1343676622 2636 dbSNP
rs1365726019 2647 dbSNP
rs1304526051 2656 dbSNP
rs1013544957 2662 dbSNP
rs1365301650 2677 dbSNP
rs749324148 2678 dbSNP
rs983930593 2679 dbSNP
rs1016122648 2681 dbSNP
rs1193178986 2686 dbSNP
rs527921016 2698 dbSNP
rs1346857352 2700 dbSNP
rs547581903 2717 dbSNP
rs187541098 2729 dbSNP
rs903900618 2732 dbSNP
rs539931851 2746 dbSNP
rs1001233489 2751 dbSNP
rs74736108 2759 dbSNP
rs987174007 2770 dbSNP
rs1489346845 2785 dbSNP
rs1249534499 2792 dbSNP
rs372269419 2803 dbSNP
rs1217954270 2808 dbSNP
rs561272281 2811 dbSNP
rs1261296978 2816 dbSNP
rs868522792 2819 dbSNP
rs1345528734 2824 dbSNP
rs1284687390 2827 dbSNP
rs1452359054 2832 dbSNP
rs912893754 2833 dbSNP
rs779171894 2834 dbSNP
rs746257675 2837 dbSNP
rs950846711 2844 dbSNP
rs1411997431 2850 dbSNP
rs1454083478 2863 dbSNP
rs1159853354 2868 dbSNP
rs982562134 2870 dbSNP
rs1043179032 2875 dbSNP
rs1431489913 2879 dbSNP
rs908288764 2883 dbSNP
rs904247155 2889 dbSNP
rs151157691 2894 dbSNP
rs1184327977 2897 dbSNP
rs974113380 2902 dbSNP
rs1391032658 2907 dbSNP
rs140203454 2914 dbSNP
rs1248158209 2922 dbSNP
rs145489741 2933 dbSNP
rs762131549 2933 dbSNP
rs78303750 2935 dbSNP
rs932539552 2944 dbSNP
rs1050951891 2947 dbSNP
rs1343757498 2951 dbSNP
rs755613658 2960 dbSNP
rs534029619 2967 dbSNP
rs886424242 2971 dbSNP
rs1334281862 3011 dbSNP
rs1331135196 3014 dbSNP
rs1453940055 3016 dbSNP
rs1408907075 3024 dbSNP
rs1311394451 3026 dbSNP
rs1004862883 3027 dbSNP
rs772479783 3028 dbSNP
rs776197228 3034 dbSNP
rs996414125 3046 dbSNP
rs945206068 3047 dbSNP
rs1211897747 3051 dbSNP
rs573400387 3054 dbSNP
rs987371882 3064 dbSNP
rs1468364011 3067 dbSNP
rs1284350134 3074 dbSNP
rs1225073703 3075 dbSNP
rs1308138024 3075 dbSNP
rs912923360 3075 dbSNP
rs1247127727 3076 dbSNP
rs1179580470 3090 dbSNP
rs747531892 3091 dbSNP
rs554015890 3092 dbSNP
rs1345824288 3097 dbSNP
rs1320399428 3098 dbSNP
rs967465101 3100 dbSNP
rs903910587 3102 dbSNP
rs1000884815 3103 dbSNP
rs1445006010 3104 dbSNP
rs1458994459 3105 dbSNP
rs1386876611 3107 dbSNP
rs1055511074 3109 dbSNP
rs1179977431 3110 dbSNP
rs1472443433 3112 dbSNP
rs895128834 3113 dbSNP
rs576925927 3126 dbSNP
rs1242140931 3127 dbSNP
rs1161158237 3132 dbSNP
rs1217279401 3137 dbSNP
rs978420359 3142 dbSNP
rs536029061 3150 dbSNP
rs1136324 3151 dbSNP
rs1361958623 3158 dbSNP
rs943313690 3165 dbSNP
rs1055257245 3168 dbSNP
rs182789217 3176 dbSNP
rs1374594510 3179 dbSNP
rs950900748 3186 dbSNP
rs1313304356 3189 dbSNP
rs377155965 3195 dbSNP
rs949663233 3198 dbSNP
rs1340016367 3201 dbSNP
rs1322474090 3202 dbSNP
rs1005015606 3206 dbSNP
rs1046650526 3207 dbSNP
rs187705003 3212 dbSNP
rs1334394157 3213 dbSNP
rs1162458425 3215 dbSNP
rs1199688291 3215 dbSNP
rs1420100964 3216 dbSNP
rs1260448466 3220 dbSNP
rs1479845271 3221 dbSNP
rs1177205255 3226 dbSNP
rs1188274668 3227 dbSNP
rs1257470321 3228 dbSNP
rs1042942319 3229 dbSNP
rs1199648526 3233 dbSNP
rs1389266235 3233 dbSNP
rs1185072875 3235 dbSNP
rs1037669151 3239 dbSNP
rs1221261917 3239 dbSNP
rs1284035990 3240 dbSNP
rs1318463735 3240 dbSNP
rs1339853142 3240 dbSNP
rs1343850809 3240 dbSNP
rs1406940614 3240 dbSNP
rs151109655 3240 dbSNP
rs1293196729 3241 dbSNP
rs1465772821 3241 dbSNP
rs1172339227 3242 dbSNP
rs1464030308 3243 dbSNP
rs9893841 3243 dbSNP
rs996254282 3244 dbSNP
rs962748099 3245 dbSNP
rs1264821380 3246 dbSNP
rs527982280 3246 dbSNP
rs1008710869 3247 dbSNP
rs954509004 3247 dbSNP
rs547645198 3248 dbSNP
rs953726020 3249 dbSNP
rs986716166 3250 dbSNP
rs1225395392 3251 dbSNP
rs1321579459 3251 dbSNP
rs879430504 3255 dbSNP
rs1260235408 3257 dbSNP
rs945217365 3259 dbSNP
rs998696797 3261 dbSNP
rs1204200475 3271 dbSNP
rs564356522 3279 dbSNP
rs978834560 3283 dbSNP
rs1337391240 3286 dbSNP
rs1470662681 3288 dbSNP
rs1375443061 3297 dbSNP
rs533336855 3315 dbSNP
rs925636060 3320 dbSNP
rs1419336332 3323 dbSNP
rs192867946 3326 dbSNP
rs1484500680 3330 dbSNP
rs1208126279 3331 dbSNP
rs936773879 3335 dbSNP
rs1244288879 3340 dbSNP
rs1055201487 3342 dbSNP
rs540283084 3345 dbSNP
rs916975004 3349 dbSNP
rs1216711243 3350 dbSNP
rs1477842370 3377 dbSNP
rs1318938040 3380 dbSNP
rs949568876 3387 dbSNP
rs1013589844 3391 dbSNP
rs1416931765 3399 dbSNP
rs1237687768 3403 dbSNP
rs1375952686 3405 dbSNP
rs184046958 3418 dbSNP
rs886657255 3419 dbSNP
rs908123593 3420 dbSNP
rs535886135 3427 dbSNP
rs1005068066 3452 dbSNP
rs57252763 3459 dbSNP
rs963560775 3465 dbSNP
rs1346564185 3466 dbSNP
rs995695635 3470 dbSNP
rs996284763 3475 dbSNP
rs761360367 3480 dbSNP
rs1185889252 3482 dbSNP
rs1422612270 3486 dbSNP
rs1360850963 3487 dbSNP
rs1050516872 3496 dbSNP
rs1486930922 3497 dbSNP
rs146914204 3498 dbSNP
rs953885129 3509 dbSNP
rs986393797 3518 dbSNP
rs1374997435 3519 dbSNP
rs1352628313 3532 dbSNP
rs554078672 3533 dbSNP
rs764849493 3545 dbSNP
rs568931298 3550 dbSNP
rs1382293527 3551 dbSNP
rs1363529764 3556 dbSNP
rs1295895679 3564 dbSNP
rs966574444 3566 dbSNP
rs1020075049 3578 dbSNP
rs903134643 3582 dbSNP
rs977959053 3597 dbSNP
rs925122565 3606 dbSNP
rs187233392 3611 dbSNP
rs936484525 3626 dbSNP
rs1456751693 3628 dbSNP
rs191992341 3629 dbSNP
rs1194597427 3630 dbSNP
rs556263833 3631 dbSNP
rs1430322865 3640 dbSNP
rs576053137 3642 dbSNP
rs1193168269 3644 dbSNP
rs1490581844 3646 dbSNP
rs1274462210 3656 dbSNP
rs1271380668 3657 dbSNP
rs1211379103 3661 dbSNP
rs916667338 3670 dbSNP
rs991086983 3689 dbSNP
rs1264779820 3691 dbSNP
rs1319297398 3692 dbSNP
rs949398832 3699 dbSNP
rs1398949799 3713 dbSNP
rs1046417663 3719 dbSNP
rs1385446385 3727 dbSNP
rs886714375 3729 dbSNP
rs766187362 3733 dbSNP
rs139027305 3746 dbSNP
rs1421513245 3746 dbSNP
rs143055144 3749 dbSNP
rs899335405 3750 dbSNP
rs908027815 3754 dbSNP
rs1240005314 3755 dbSNP
rs1485313251 3756 dbSNP
rs996318310 3758 dbSNP
rs1028527234 3761 dbSNP
rs1266413866 3769 dbSNP
rs889521930 3771 dbSNP
rs1007874226 3778 dbSNP
rs539197572 3783 dbSNP
rs1256128349 3795 dbSNP
rs973662487 3799 dbSNP
rs371500015 3811 dbSNP
rs1276195080 3818 dbSNP
rs79743233 3820 dbSNP
rs1050381823 3825 dbSNP
rs1173000872 3835 dbSNP
rs1329999775 3842 dbSNP
rs890546294 3845 dbSNP
rs944769002 3846 dbSNP
rs1320326466 3848 dbSNP
rs1343671828 3856 dbSNP
rs1430336429 3862 dbSNP
rs1294304465 3887 dbSNP
rs1373728657 3888 dbSNP
rs1170970971 3891 dbSNP
rs1232532517 3896 dbSNP
rs1041972207 3902 dbSNP
rs902999876 3903 dbSNP
rs533611464 3921 dbSNP
rs1197949209 3922 dbSNP
rs1236275098 3922 dbSNP
rs1032942926 3949 dbSNP
rs1303330947 3951 dbSNP
rs1198326369 3961 dbSNP
rs894362877 3961 dbSNP
rs550100144 3981 dbSNP
rs1032221960 3990 dbSNP
rs753964816 3991 dbSNP
rs1242759046 3995 dbSNP
rs1375216612 4001 dbSNP
rs1309091986 4004 dbSNP
rs958150452 4004 dbSNP
rs1453987149 4006 dbSNP
rs1360925208 4017 dbSNP
rs1332298957 4020 dbSNP
rs990661660 4021 dbSNP
rs1160741688 4024 dbSNP
rs1385942331 4024 dbSNP
rs916680669 4043 dbSNP
rs1315781490 4044 dbSNP
rs1023923817 4047 dbSNP
rs1445192556 4049 dbSNP
rs1239190707 4090 dbSNP
rs1184744006 4094 dbSNP
rs1441404515 4100 dbSNP
rs1284499402 4102 dbSNP
rs758889725 4105 dbSNP
rs184548942 4106 dbSNP
rs982538047 4110 dbSNP
rs1015530449 4111 dbSNP
rs1381941271 4127 dbSNP
rs1282983512 4139 dbSNP
rs962254719 4140 dbSNP
rs973949580 4144 dbSNP
rs7218981 4145 dbSNP
rs907888265 4156 dbSNP
rs1157809556 4179 dbSNP
rs148102923 4185 dbSNP
rs1038359964 4186 dbSNP
rs911884785 4188 dbSNP
rs566099351 4195 dbSNP
rs1263274483 4202 dbSNP
rs1238751258 4207 dbSNP
rs899410275 4210 dbSNP
rs1487117028 4217 dbSNP
rs1262081870 4219 dbSNP
rs1441415465 4221 dbSNP
rs1223644363 4222 dbSNP
rs1255478849 4225 dbSNP
rs1288281177 4232 dbSNP
rs1156718151 4236 dbSNP
rs73992309 4254 dbSNP
rs1280202907 4256 dbSNP
rs547746169 4257 dbSNP
rs1398286034 4258 dbSNP
rs1340087753 4265 dbSNP
rs1050601075 4266 dbSNP
rs1400185012 4271 dbSNP
rs1436912912 4276 dbSNP
rs1351415506 4280 dbSNP
rs1162515710 4285 dbSNP
rs141900202 4294 dbSNP
rs1396887526 4299 dbSNP
rs750643745 4307 dbSNP
rs758491213 4310 dbSNP
rs935856824 4314 dbSNP
rs1476577129 4315 dbSNP
rs1019289864 4334 dbSNP
rs1191427951 4335 dbSNP
rs780571253 4336 dbSNP
rs189454662 4354 dbSNP
rs780455530 4356 dbSNP
rs574147332 4361 dbSNP
rs1378319550 4364 dbSNP
rs747337788 4372 dbSNP
rs902191732 4373 dbSNP
rs894437972 4383 dbSNP
rs1278292607 4395 dbSNP
rs1372057213 4396 dbSNP
rs1012778928 4407 dbSNP
rs1045401120 4411 dbSNP
rs1228340012 4415 dbSNP
rs906859207 4419 dbSNP
rs1317438582 4423 dbSNP
rs1004262656 4436 dbSNP
rs556086725 4440 dbSNP
rs1221158026 4445 dbSNP
rs1332171842 4448 dbSNP
rs1212866703 4449 dbSNP
rs1291590611 4453 dbSNP
rs1435559254 4459 dbSNP
rs1400903981 4461 dbSNP
rs1333358080 4467 dbSNP
rs1015356334 4475 dbSNP
rs962739558 4496 dbSNP
rs995016106 4499 dbSNP
rs1027820717 4501 dbSNP
rs1458899744 4502 dbSNP
rs1434568388 4510 dbSNP
rs542830464 4511 dbSNP
rs1190949950 4516 dbSNP
rs569791991 4517 dbSNP
rs1232217477 4520 dbSNP
rs7219516 4522 dbSNP
rs957968069 4532 dbSNP
rs780929111 4536 dbSNP
rs912126111 4545 dbSNP
rs1197314776 4546 dbSNP
rs1182450157 4562 dbSNP
rs866723833 4569 dbSNP
rs1256692785 4574 dbSNP
rs991083250 4577 dbSNP
rs1460027006 4587 dbSNP
rs977791571 4592 dbSNP
rs535191164 4594 dbSNP
rs924722713 4595 dbSNP
rs1377437544 4596 dbSNP
rs1023486070 4597 dbSNP
rs970518703 4598 dbSNP
rs1444515465 4618 dbSNP
rs982199228 4623 dbSNP
rs1411990013 4627 dbSNP
rs555017457 4632 dbSNP
rs781759472 4635 dbSNP
rs1302894887 4637 dbSNP
rs936083156 4638 dbSNP
rs747655677 4641 dbSNP
rs539866116 4643 dbSNP
rs1174987925 4682 dbSNP
rs907919371 4688 dbSNP
rs1354398390 4694 dbSNP
rs763365594 4699 dbSNP
rs796155342 4706 dbSNP
rs940709459 4713 dbSNP
rs973418826 4719 dbSNP
rs1177267802 4723 dbSNP
rs1448165390 4724 dbSNP
rs1294545146 4729 dbSNP
rs1439641603 4735 dbSNP
rs1257540569 4746 dbSNP
rs34736932 4748 dbSNP
rs571737543 4761 dbSNP
rs1353001173 4779 dbSNP
rs1232338158 4780 dbSNP
rs1278431569 4785 dbSNP
rs1217638605 4813 dbSNP
rs1354101841 4816 dbSNP
rs1341281162 4817 dbSNP
rs1193798418 4818 dbSNP
rs540609954 4836 dbSNP
rs1335068757 4842 dbSNP
rs920871446 4843 dbSNP
rs774746734 4849 dbSNP
rs1397259454 4856 dbSNP
rs1272206766 4857 dbSNP
rs1376363920 4867 dbSNP
rs1301828635 4869 dbSNP
rs1400257519 4890 dbSNP
rs1045641359 4891 dbSNP
rs182308392 4903 dbSNP
rs1419522637 4922 dbSNP
rs1369545409 4936 dbSNP
rs912071568 4937 dbSNP
rs1167596216 4940 dbSNP
rs1422070828 4947 dbSNP
rs1003887885 4961 dbSNP
rs1194598539 4966 dbSNP
rs944838973 4969 dbSNP
rs1489381310 4973 dbSNP
rs1037063316 4989 dbSNP
rs2413 4991 dbSNP
rs1259758110 5002 dbSNP
rs14608 5003 dbSNP
rs1040813262 5014 dbSNP
rs1187578085 5020 dbSNP
rs898282890 5024 dbSNP
rs1265901496 5033 dbSNP
rs1424532709 5038 dbSNP
rs1319359191 5050 dbSNP
rs1292156667 5051 dbSNP
rs902264279 5052 dbSNP
rs1027850158 5071 dbSNP
rs578186558 5074 dbSNP
rs953545921 5084 dbSNP
rs1166478997 5090 dbSNP
rs1295732079 5092 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guUUGUGGUAACAG---UGUGAGGu 5'
            || |:|: || |   :|||||| 
Target 5' ccAAGAUCG-UGCCACUGCACUCC- 3'
14 - 36
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000310827.4 | 3UTR | AGCUUGCAGUGAGCCAAGAUCGUGCCACUGCACUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1