miRTarBase - #MIRT672252 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SIK2   
Synonyms LOH11CR1I, QIK, SIK-2, SNF1LK2
Description salt inducible kinase 2
Transcript NM_015191   
Expression
Putative miRNA Targets on SIK2
3'UTR of SIK2
(miRNA target sites are highlighted)
>SIK2|NM_015191|3'UTR
   1 TCTCAGCACAGGAATTGAGGTGGGTCAGGTGAAGGAAGAGTGTATGTTCCTATTTTTATTCCAGCCTTTTAAATTTAAAG
  81 CTTATTTTCTTGCCCTCTCCCTAACGGGGAGAAATCGAGCCACCCAACTGGAATCAGAGGGTCTGGCTGGGGTGGATGTT
 161 GCTTCCTCCTGGTTCTGCCCCACCACAAAGTTTTCTGTGGCAAGTGCTGGAACATAGTTGTAGGCTGAGGCTCCTGCCCT
 241 TCGGTCGAGTGGAGCAAGCTCTCGAGGGCAGCACTGACAAATGTGTTCCTAAGAAGACATTCAGACCCAGGTGTTATGCA
 321 GGATTACATCCGTTTATTATCAAGGGCAACCTTGGTGAAAGCAGAAAGGGTGTGTGCTATTGCATATATATGGGGGAAAA
 401 GGCAATATATTTTTCACTGAAGCTGAGCAACCACATATTGCTACAAGGCAAATCAAGAAGACATCAGGAAATCAGATGCA
 481 CAGGAAATAAAGGAAAGCTGTGCTTTGTCATTGAATCCTAAGTTCTTAGCTGCTGATGCAAGTTGTCCCCCAAGGCCATC
 561 ACAAAGCAGTGGGGCATGAGCTGTGTTTCAGGGGCCACTAAATAACAGCTGGTACTGACCCCAGAAACCGCCTTCATCTC
 641 CATTCGGAAGCAGGTGACACACCCCTTCAGAAGGTGCCCTGGGTTGCCGAGTGTCAGAATATACTCAGGACTCCAGAGGT
 721 GTCACACGTGGAACTGACAGGAGACCCGCCACCGTGGAGGCAGGGGGCAAGAAACTCAAGAACGCATCAAGAGCACCAGC
 801 CCTGGGCCAGGGAAGACAGGCTCTTCCTGCAGTTTCTCGTGGACACTGCTGGCTTGCGGGCAGTCGGTCTCCAGGGTACC
 881 TGTTGTCTCTTTTCCGATGTAATAACTACTTTGACCTTACACTATATGTTGCTAGTAGTTTATTGAGCTTTGTATATTTG
 961 GACAGTTTCATATAGGGCTTAGAGATTTTAAGGACATGATAAATGAACTTTTCTGTCCCATGTGAAGTGGTAGTGCGGTG
1041 CCTTTCCCCCAGATCATGCTTTAATTCTTTCTTTTCTGTAGAAACCAACAGTTTCCATTTATGTCAATGCTAAATCCAAA
1121 GTCACTTCAGAGTTTGTTTTCCACCATGTGGGAATCAGCATTCTTAATTTCGTTAAAGTTTTGACTTGTAATGAAATGTT
1201 CAAGTATTACAGCAATATTCAAAGAAAGAACCACAGATGTGTTAACCATTTAAGCAGATCATCTGCCAAACATTATATTA
1281 CTAATAAAACTTAACCAACACTTACAATTCAGTCATCAAAGTAAGTAAAAATTAGATGCTACAGCTAGCTAACTGTATCC
1361 CTAGAAATGATGAATAATTTGCCATTTGGACAGTTAACATCCAGGTGTTACAAAGTCAGTGTTAATTCTAAAGATGATCA
1441 TTTCTGCCCTTTAGAATGGCTTGTCCCATCAGCAGATGAATGTGTTAAGCACAAAGCATCTTCCTTAAAGCACAAAGAGA
1521 GGGACTAACTGATGCTGCATCTAGAAAACACCTTTAAGTTGCCTTTCCTCTTTGTAGTTAGCGTTCAGGCAGGTGACGTG
1601 TGGAAAGTCTAGGGGGTTCCATTCTGGCCATGCGAGCCCAGCTCCTACCAACGTCGGTAACTTGAGCAGTCCCTGTTGCT
1681 GGCCAGAGACTGCCTGGTCGCCAGCGCTCACCATGGGTGCCAGGATGCTTCGCAGAGGCACTGTGCTCACGGTTGGACTT
1761 GGTGTCAGTGGGAAAGGGCAGTGTGGGGACTGTCATTTTTGTGATTTAATAACACACAGTGAAAATCCAGGAAGAATGAA
1841 TTAAGCTTCTTCTGGGAGTTGTTTATTCCTGCTCGTGCTTAAGATTGATGATTTCGTGAAATAAAGAACATCATTTCATT
1921 TAAGAGATCATTTCATTAAGATCTCTAATCTGTTTTGAGTCTTTACAAAATAGCCAGTTATAAAATGGGGCTTGATTTGT
2001 TTAGACTGAAGGAAGACGTTTTCCCAAAATATACTACAGAAGTGCTACAATATTTGCGATATTAAAATGCCTGCAGATTG
2081 AAAATGGGGGCCACTCATTTCAGAACTGCAGGAATGGTGTAGTTACAGATCGACATAAACTCCTGCCCCCCAACAATGCC
2161 ATGAGCTGCTTAGCCCAGGAGACCTGGGAGCTATGGCAGGACGGTTAGGCCAGCCGATGAGGGACTGCAGAGAGGCTACT
2241 GGAAGGTTAAGGACCCAGAGAGAAATCGAGAGGTGCCCTACAGCAGCCAGGCCTATCAGGATCCGTCACACACGGCAGCG
2321 GCGTGGACACCGGCCTGATGCAGAGCGTGACCCCTCCTGCTGGGACCTGTGTTGTAAGCTCCTATTTGCTTATCTTGTTT
2401 ATTTCAAGCAGAAATCAATAAATTCCATAACCCTCTGTATTGACTGCAATGTAAGCTGCTGAGGAGACTGGTTCTGTTGG
2481 TCAGTCAGGTGTTTGCTCAGCCCTGTCTGATCACCTGTGCTGCTCTGTCCCTAACTAGTGACCCATGGAAGCTTCCAAGC
2561 AGTTTTCTCTTCATCACTACTAACAAACGAAACACTAAGAAGGCTTAGTATCGCTCTTTTTCTGCGGGGCTACTCTGAAG
2641 TACTGACTTGCTTTCCAGTCTGATTCACGTTAGCAGTGTGTACACTACTGTATCATCATCAGCTTCATCACCCTGTAAAC
2721 CAGGCTCCTCTGAAGAGACTTTGGTGAGATGAACGTGAGGTAAAAATTTCGTTCGGCAAAAAGTGCAAAAAAAAAAAAAA
2801 AAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACA-GUGUGAGGu 5'
              :| || ||| :||||| | 
Target 5' acgtTAGCAGTGTGTACACTACt 3'
2667 - 2689 126.00 -10.50
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :| :| : || ||||| || 
Target 5' cgGAAGCAGGTGACACACCCCt 3'
645 - 666 124.00 -10.80
3
miRNA  3' guUUGUGGUAAC---AGUGUGAggu 5'
            |||  | |||   |:|||||   
Target 5' atAACTACTTTGACCTTACACTata 3'
902 - 926 120.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30526843 28 COSMIC
COSN30107442 35 COSMIC
COSN30162310 39 COSMIC
COSN1126524 81 COSMIC
COSN31528529 82 COSMIC
COSN31551482 102 COSMIC
COSN26677543 142 COSMIC
COSN31552367 244 COSMIC
COSN32062670 303 COSMIC
COSN28803514 314 COSMIC
COSN31530995 842 COSMIC
COSN31533339 867 COSMIC
COSN31577333 995 COSMIC
COSN1513880 1001 COSMIC
COSN22628571 1144 COSMIC
COSN31579317 1154 COSMIC
COSN29302879 1383 COSMIC
COSN1126526 1385 COSMIC
COSN1126528 1401 COSMIC
COSN31483791 1450 COSMIC
COSN28717146 1464 COSMIC
COSN26585401 1483 COSMIC
COSN31530454 1484 COSMIC
COSN31578945 1495 COSMIC
COSN31611116 1583 COSMIC
COSN10077993 1634 COSMIC
COSN24900709 1792 COSMIC
COSN19609622 2037 COSMIC
COSN30160902 2698 COSMIC
COSN30177082 2698 COSMIC
COSN30176937 2710 COSMIC
COSN1126530 2727 COSMIC
COSN30125701 2735 COSMIC
COSN30170539 2738 COSMIC
COSN30129434 2771 COSMIC
COSN31520549 2775 COSMIC
COSN30453961 2797 COSMIC
COSN30163978 2831 COSMIC
COSM7193446 2839 COSMIC
COSM3808333 2842 COSMIC
COSM7191028 2844 COSMIC
COSM7003773 2847 COSMIC
COSM9306807 2848 COSMIC
COSM371275 2862 COSMIC
COSM686403 2869 COSMIC
COSM3383195 2871 COSMIC
COSM6461515 2882 COSMIC
COSM4017796 2888 COSMIC
COSM1578773 2896 COSMIC
COSM4639704 2910 COSMIC
COSM8849661 2915 COSMIC
COSN18184379 2988 COSMIC
COSN18431164 3018 COSMIC
COSN30722992 3018 COSMIC
COSN6985326 3084 COSMIC
COSN18027580 3336 COSMIC
COSN5894855 3568 COSMIC
COSN29793105 3667 COSMIC
COSN18264720 3886 COSMIC
COSN8732039 3994 COSMIC
COSN29865006 4049 COSMIC
COSN19353573 4678 COSMIC
COSN31875197 4810 COSMIC
COSN6985327 5196 COSMIC
COSN1513883 5520 COSMIC
COSN5296709 6061 COSMIC
COSN23332084 6095 COSMIC
COSN5296710 6363 COSMIC
COSN29520769 6556 COSMIC
COSN15082641 6590 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775312022 2 dbSNP
rs1483726588 3 dbSNP
rs1205832990 5 dbSNP
rs371858570 7 dbSNP
rs764329568 10 dbSNP
rs1201309017 15 dbSNP
rs1425520448 16 dbSNP
rs1007307033 18 dbSNP
rs776781348 23 dbSNP
rs1313160915 24 dbSNP
rs761962168 30 dbSNP
rs1371438765 32 dbSNP
rs751763010 34 dbSNP
rs1309225640 41 dbSNP
rs765160763 42 dbSNP
rs570496665 43 dbSNP
rs755213727 43 dbSNP
rs1297695383 45 dbSNP
rs770612318 51 dbSNP
rs1460858562 53 dbSNP
rs1372984008 57 dbSNP
rs1169570347 58 dbSNP
rs1040453331 60 dbSNP
rs901481023 65 dbSNP
rs528413558 68 dbSNP
rs960851770 69 dbSNP
rs1196867178 77 dbSNP
rs1425245161 90 dbSNP
rs183176136 96 dbSNP
rs796569679 104 dbSNP
rs534318781 105 dbSNP
rs568309205 106 dbSNP
rs1010187039 107 dbSNP
rs188877415 117 dbSNP
rs968566103 118 dbSNP
rs1205843376 120 dbSNP
rs979552784 123 dbSNP
rs1028303418 128 dbSNP
rs1023089056 130 dbSNP
rs767943469 133 dbSNP
rs1265000181 135 dbSNP
rs970551774 136 dbSNP
rs981512612 136 dbSNP
rs557191726 139 dbSNP
rs986038692 141 dbSNP
rs1309140143 146 dbSNP
rs911852059 147 dbSNP
rs1364085813 150 dbSNP
rs569014229 162 dbSNP
rs1459057813 169 dbSNP
rs1368712362 173 dbSNP
rs1157674596 178 dbSNP
rs773522444 179 dbSNP
rs1253395262 181 dbSNP
rs972338444 184 dbSNP
rs1182798280 186 dbSNP
rs1490170409 189 dbSNP
rs1463567822 191 dbSNP
rs1211450040 204 dbSNP
rs919112295 205 dbSNP
rs1260344782 211 dbSNP
rs117478616 216 dbSNP
rs1048808138 230 dbSNP
rs1331320616 231 dbSNP
rs111384186 233 dbSNP
rs557818060 239 dbSNP
rs1289125836 241 dbSNP
rs572901294 243 dbSNP
rs540193400 244 dbSNP
rs937711388 247 dbSNP
rs1387732277 248 dbSNP
rs1384759395 250 dbSNP
rs1287891711 253 dbSNP
rs144049128 262 dbSNP
rs1480047186 264 dbSNP
rs879680079 265 dbSNP
rs1200980139 271 dbSNP
rs759657131 272 dbSNP
rs1451940353 275 dbSNP
rs1009725183 284 dbSNP
rs1260866325 291 dbSNP
rs1021512130 303 dbSNP
rs372651064 305 dbSNP
rs605923 314 dbSNP
rs1268773786 324 dbSNP
rs1388911025 329 dbSNP
rs1001317058 332 dbSNP
rs1277098260 333 dbSNP
rs585149 337 dbSNP
rs954025660 339 dbSNP
rs901571585 340 dbSNP
rs986823054 347 dbSNP
rs993208014 348 dbSNP
rs1390423324 350 dbSNP
rs1280159643 351 dbSNP
rs146444945 355 dbSNP
rs888071470 368 dbSNP
rs1399489767 373 dbSNP
rs1263620702 374 dbSNP
rs1478349591 380 dbSNP
rs1372229155 384 dbSNP
rs1186448624 388 dbSNP
rs1451513216 392 dbSNP
rs1248899897 393 dbSNP
rs1203328959 394 dbSNP
rs1006392242 398 dbSNP
rs530943824 402 dbSNP
rs1201514192 408 dbSNP
rs1023095418 410 dbSNP
rs142847023 410 dbSNP
rs752356340 410 dbSNP
rs966329477 419 dbSNP
rs757093232 426 dbSNP
rs1262251170 427 dbSNP
rs972026879 432 dbSNP
rs781073388 435 dbSNP
rs1035800067 439 dbSNP
rs956304640 441 dbSNP
rs750213434 455 dbSNP
rs1414899919 458 dbSNP
rs1395720035 463 dbSNP
rs755883402 464 dbSNP
rs967959869 468 dbSNP
rs1183218596 477 dbSNP
rs141362790 479 dbSNP
rs1239222725 493 dbSNP
rs1422741786 496 dbSNP
rs1437708214 502 dbSNP
rs1273081336 512 dbSNP
rs926412174 516 dbSNP
rs1343319745 528 dbSNP
rs937657686 529 dbSNP
rs564214746 534 dbSNP
rs528491832 535 dbSNP
rs1164633305 536 dbSNP
rs1353823013 537 dbSNP
rs943241967 538 dbSNP
rs976309456 543 dbSNP
rs1056083838 545 dbSNP
rs923081073 547 dbSNP
rs929057313 559 dbSNP
rs1348679863 570 dbSNP
rs1427155376 572 dbSNP
rs375934710 572 dbSNP
rs762285145 577 dbSNP
rs1162709522 579 dbSNP
rs1403777566 583 dbSNP
rs1164101389 591 dbSNP
rs1416261291 591 dbSNP
rs1304111558 594 dbSNP
rs1249800596 601 dbSNP
rs1047391053 604 dbSNP
rs1483677279 606 dbSNP
rs1268547246 607 dbSNP
rs1219860479 608 dbSNP
rs1398382909 610 dbSNP
rs539135542 611 dbSNP
rs887412911 617 dbSNP
rs546932245 630 dbSNP
rs4936666 631 dbSNP
rs558741574 634 dbSNP
rs529179877 644 dbSNP
rs550829287 646 dbSNP
rs1323396623 647 dbSNP
rs569051300 648 dbSNP
rs1001080754 652 dbSNP
rs1434003140 660 dbSNP
rs1351445695 663 dbSNP
rs1246683046 666 dbSNP
rs1028394760 669 dbSNP
rs1487224208 671 dbSNP
rs906089567 679 dbSNP
rs1003070193 687 dbSNP
rs1036259351 688 dbSNP
rs891918822 689 dbSNP
rs111929530 690 dbSNP
rs1482622253 706 dbSNP
rs1489650992 714 dbSNP
rs1179578736 718 dbSNP
rs1010285673 728 dbSNP
rs889903386 729 dbSNP
rs1265623675 730 dbSNP
rs1210079831 740 dbSNP
rs1329305506 742 dbSNP
rs773335560 744 dbSNP
rs1369453880 747 dbSNP
rs1275240127 749 dbSNP
rs1434565380 752 dbSNP
rs1446963029 755 dbSNP
rs1322577219 756 dbSNP
rs1019605451 758 dbSNP
rs1223845537 763 dbSNP
rs1457812853 763 dbSNP
rs1164856109 766 dbSNP
rs1247576149 774 dbSNP
rs1380006644 774 dbSNP
rs1426242575 784 dbSNP
rs961405646 785 dbSNP
rs1418272914 795 dbSNP
rs1448458682 800 dbSNP
rs993789155 803 dbSNP
rs1026263214 805 dbSNP
rs1346041101 812 dbSNP
rs572244777 813 dbSNP
rs1210256298 817 dbSNP
rs150240525 826 dbSNP
rs1381502884 828 dbSNP
rs1207867003 830 dbSNP
rs530846426 834 dbSNP
rs985441082 839 dbSNP
rs926359599 840 dbSNP
rs1227418163 846 dbSNP
rs1017550869 858 dbSNP
rs959086499 859 dbSNP
rs991887746 862 dbSNP
rs772425859 866 dbSNP
rs566523418 867 dbSNP
rs964979945 874 dbSNP
rs945069283 876 dbSNP
rs923060357 877 dbSNP
rs1242092345 883 dbSNP
rs79669376 891 dbSNP
rs761013412 896 dbSNP
rs75142829 897 dbSNP
rs1449716010 907 dbSNP
rs1254785639 911 dbSNP
rs776843150 914 dbSNP
rs889978877 919 dbSNP
rs1484168659 922 dbSNP
rs1237959395 923 dbSNP
rs1044439061 924 dbSNP
rs1238699912 928 dbSNP
rs1204392617 939 dbSNP
rs1339796849 943 dbSNP
rs574661205 944 dbSNP
rs1461384569 953 dbSNP
rs1229337961 955 dbSNP
rs906147492 957 dbSNP
rs1310614841 961 dbSNP
rs938929056 971 dbSNP
rs1057302951 973 dbSNP
rs1307957206 983 dbSNP
rs1408602245 986 dbSNP
rs145886854 1001 dbSNP
rs535729901 1005 dbSNP
rs1169631906 1009 dbSNP
rs891935110 1014 dbSNP
rs1184693228 1022 dbSNP
rs1008279093 1023 dbSNP
rs1041159993 1031 dbSNP
rs1010344364 1036 dbSNP
rs897141224 1037 dbSNP
rs994218195 1038 dbSNP
rs1026630375 1046 dbSNP
rs1253620396 1048 dbSNP
rs1006931430 1051 dbSNP
rs766540679 1061 dbSNP
rs1263872627 1065 dbSNP
rs1018690627 1068 dbSNP
rs952023958 1071 dbSNP
rs1322393199 1081 dbSNP
rs964663628 1088 dbSNP
rs976373291 1088 dbSNP
rs1414106486 1091 dbSNP
rs1308969514 1092 dbSNP
rs1386544131 1094 dbSNP
rs755233472 1098 dbSNP
rs1389069688 1120 dbSNP
rs557160425 1122 dbSNP
rs1459172172 1134 dbSNP
rs1006105923 1144 dbSNP
rs1033450546 1148 dbSNP
rs575453485 1152 dbSNP
rs759618820 1156 dbSNP
rs149005940 1173 dbSNP
rs917715425 1176 dbSNP
rs966760448 1179 dbSNP
rs1453489788 1182 dbSNP
rs983227232 1184 dbSNP
rs1330545430 1202 dbSNP
rs191715926 1216 dbSNP
rs1444352175 1219 dbSNP
rs1211802931 1221 dbSNP
rs148246535 1221 dbSNP
rs1267544133 1225 dbSNP
rs924954029 1225 dbSNP
rs1366727215 1235 dbSNP
rs1331377753 1238 dbSNP
rs1289485844 1240 dbSNP
rs979831030 1242 dbSNP
rs1366376041 1247 dbSNP
rs143792566 1256 dbSNP
rs1388082959 1257 dbSNP
rs1394800347 1259 dbSNP
rs938954456 1271 dbSNP
rs1057498870 1274 dbSNP
rs114743715 1278 dbSNP
rs1323555207 1281 dbSNP
rs45540232 1292 dbSNP
rs904649057 1297 dbSNP
rs1454838459 1300 dbSNP
rs1007348434 1301 dbSNP
rs1255654274 1302 dbSNP
rs550917487 1305 dbSNP
rs944222852 1306 dbSNP
rs1041522318 1308 dbSNP
rs375531146 1309 dbSNP
rs1200323688 1317 dbSNP
rs1233815781 1322 dbSNP
rs897259938 1323 dbSNP
rs901142835 1327 dbSNP
rs997458683 1330 dbSNP
rs767541925 1339 dbSNP
rs1258092687 1341 dbSNP
rs1234444958 1343 dbSNP
rs1030685073 1346 dbSNP
rs950621613 1355 dbSNP
rs1296376243 1359 dbSNP
rs1477908913 1360 dbSNP
rs1432525567 1367 dbSNP
rs1366670253 1368 dbSNP
rs879656992 1376 dbSNP
rs1004705392 1387 dbSNP
rs1413798810 1390 dbSNP
rs1400012858 1392 dbSNP
rs562738939 1417 dbSNP
rs1174299328 1424 dbSNP
rs1435073849 1450 dbSNP
rs1389394909 1452 dbSNP
rs1016048322 1453 dbSNP
rs963100780 1455 dbSNP
rs1048359490 1457 dbSNP
rs1242704458 1458 dbSNP
rs980226054 1462 dbSNP
rs202149110 1464 dbSNP
rs1258844536 1471 dbSNP
rs888466052 1480 dbSNP
rs750305256 1482 dbSNP
rs1272950734 1485 dbSNP
rs1470448326 1487 dbSNP
rs1170027898 1493 dbSNP
rs992494421 1497 dbSNP
rs1270224880 1506 dbSNP
rs1446626944 1507 dbSNP
rs1336091860 1514 dbSNP
rs913521481 1514 dbSNP
rs1411585519 1516 dbSNP
rs143801975 1520 dbSNP
rs1219545937 1523 dbSNP
rs1431816173 1524 dbSNP
rs1420519337 1526 dbSNP
rs1033563632 1527 dbSNP
rs894974489 1535 dbSNP
rs1013397609 1536 dbSNP
rs946278550 1552 dbSNP
rs1189196081 1564 dbSNP
rs1025132849 1571 dbSNP
rs1434052750 1573 dbSNP
rs1043250825 1579 dbSNP
rs758398565 1584 dbSNP
rs1284766283 1585 dbSNP
rs1345720995 1586 dbSNP
rs1483018443 1596 dbSNP
rs1250017811 1598 dbSNP
rs183488735 1599 dbSNP
rs1438807855 1603 dbSNP
rs978263892 1605 dbSNP
rs1273235163 1611 dbSNP
rs926078311 1611 dbSNP
rs1340948893 1612 dbSNP
rs1294607982 1613 dbSNP
rs755971453 1626 dbSNP
rs957701867 1631 dbSNP
rs1233750242 1632 dbSNP
rs1353565526 1634 dbSNP
rs576388998 1635 dbSNP
rs868426362 1636 dbSNP
rs566490835 1638 dbSNP
rs3210417 1639 dbSNP
rs1354935525 1651 dbSNP
rs1040171705 1653 dbSNP
rs779933093 1656 dbSNP
rs188110826 1657 dbSNP
rs1165791885 1665 dbSNP
rs976974905 1667 dbSNP
rs1410374983 1669 dbSNP
rs1185027928 1672 dbSNP
rs1451345406 1674 dbSNP
rs1219783488 1682 dbSNP
rs998620568 1688 dbSNP
rs1220293802 1693 dbSNP
rs548736585 1695 dbSNP
rs1274459008 1696 dbSNP
rs1201092157 1700 dbSNP
rs918761637 1701 dbSNP
rs1480877619 1706 dbSNP
rs1193296836 1707 dbSNP
rs753561684 1717 dbSNP
rs1048959833 1725 dbSNP
rs1421485611 1730 dbSNP
rs886396216 1732 dbSNP
rs888413802 1733 dbSNP
rs28687711 1738 dbSNP
rs756026345 1741 dbSNP
rs937376158 1743 dbSNP
rs1326891402 1747 dbSNP
rs1407552179 1748 dbSNP
rs1456749496 1749 dbSNP
rs1054948880 1750 dbSNP
rs963514473 1751 dbSNP
rs545537482 1752 dbSNP
rs1034543117 1764 dbSNP
rs1013933693 1769 dbSNP
rs1476807687 1790 dbSNP
rs1254464622 1796 dbSNP
rs559183541 1796 dbSNP
rs1366029194 1804 dbSNP
rs1024786612 1806 dbSNP
rs1464044900 1807 dbSNP
rs1265757739 1810 dbSNP
rs959809800 1812 dbSNP
rs3210413 1817 dbSNP
rs1317481092 1823 dbSNP
rs992944069 1829 dbSNP
rs1277596832 1831 dbSNP
rs1217245113 1833 dbSNP
rs902349973 1843 dbSNP
rs778522855 1847 dbSNP
rs999252395 1849 dbSNP
rs1434722899 1854 dbSNP
rs1363055573 1855 dbSNP
rs1290710029 1857 dbSNP
rs140813392 1858 dbSNP
rs1359115767 1859 dbSNP
rs1174632603 1871 dbSNP
rs547275455 1872 dbSNP
rs747586240 1875 dbSNP
rs1396133226 1876 dbSNP
rs567229423 1886 dbSNP
rs1327619259 1896 dbSNP
rs116914817 1897 dbSNP
rs1448513215 1898 dbSNP
rs1245625646 1899 dbSNP
rs1187788169 1900 dbSNP
rs772692203 1900 dbSNP
rs1485937993 1903 dbSNP
rs1236801893 1909 dbSNP
rs1208021830 1910 dbSNP
rs1227550007 1911 dbSNP
rs957691768 1913 dbSNP
rs1227868301 1920 dbSNP
rs778246016 1928 dbSNP
rs985146754 1929 dbSNP
rs1018523372 1930 dbSNP
rs1340338689 1936 dbSNP
rs1297749374 1939 dbSNP
rs1215213557 1947 dbSNP
rs1378584805 1951 dbSNP
rs547661800 1960 dbSNP
rs1417226809 1972 dbSNP
rs1229364085 1977 dbSNP
rs1376384477 1982 dbSNP
rs1356233704 1987 dbSNP
rs192718137 1990 dbSNP
rs942884372 1991 dbSNP
rs965588523 2003 dbSNP
rs867214966 2004 dbSNP
rs1294393700 2011 dbSNP
rs1490616170 2018 dbSNP
rs1179983415 2019 dbSNP
rs370822101 2022 dbSNP
rs1216088517 2030 dbSNP
rs977425006 2035 dbSNP
rs1257922254 2038 dbSNP
rs568564717 2043 dbSNP
rs747448661 2044 dbSNP
rs1253263409 2051 dbSNP
rs930144371 2058 dbSNP
rs934086140 2059 dbSNP
rs1310680812 2060 dbSNP
rs1235610377 2061 dbSNP
rs1047051601 2063 dbSNP
rs1288322254 2067 dbSNP
rs984212468 2074 dbSNP
rs887073375 2076 dbSNP
rs575493036 2086 dbSNP
rs940624446 2086 dbSNP
rs1037558208 2087 dbSNP
rs1462187757 2088 dbSNP
rs1193959548 2094 dbSNP
rs1162203699 2095 dbSNP
rs910007936 2100 dbSNP
rs899069602 2106 dbSNP
rs1181419378 2118 dbSNP
rs937330308 2121 dbSNP
rs1471763546 2122 dbSNP
rs1471486665 2128 dbSNP
rs561496968 2132 dbSNP
rs1055694886 2133 dbSNP
rs1488281810 2135 dbSNP
rs1263706455 2137 dbSNP
rs530437275 2139 dbSNP
rs1335593905 2146 dbSNP
rs949292683 2149 dbSNP
rs539647271 2150 dbSNP
rs902338447 2152 dbSNP
rs1308161023 2155 dbSNP
rs1366503543 2159 dbSNP
rs1391566575 2159 dbSNP
rs550448403 2166 dbSNP
rs999806914 2171 dbSNP
rs1323543012 2172 dbSNP
rs1462533098 2175 dbSNP
rs1394670769 2178 dbSNP
rs1158319829 2180 dbSNP
rs1053516262 2184 dbSNP
rs893587577 2189 dbSNP
rs967014509 2194 dbSNP
rs1451009466 2203 dbSNP
rs1006656588 2204 dbSNP
rs1251339856 2212 dbSNP
rs978408132 2216 dbSNP
rs1360552180 2217 dbSNP
rs184346757 2235 dbSNP
rs1017928866 2241 dbSNP
rs1207307506 2249 dbSNP
rs1353504027 2252 dbSNP
rs1261628518 2255 dbSNP
rs1232966611 2257 dbSNP
rs965417510 2268 dbSNP
rs964317807 2269 dbSNP
rs776933023 2272 dbSNP
rs1319309788 2273 dbSNP
rs1380417863 2282 dbSNP
rs1206007314 2285 dbSNP
rs1387019047 2293 dbSNP
rs1255558044 2301 dbSNP
rs558321259 2305 dbSNP
rs573290489 2306 dbSNP
rs1175695597 2314 dbSNP
rs759834387 2315 dbSNP
rs540701427 2320 dbSNP
rs146596911 2321 dbSNP
rs769878564 2323 dbSNP
rs374740401 2324 dbSNP
rs775688989 2327 dbSNP
rs544579158 2332 dbSNP
rs908567772 2333 dbSNP
rs982799814 2333 dbSNP
rs767631935 2334 dbSNP
rs991536753 2341 dbSNP
rs367752441 2348 dbSNP
rs1438809453 2349 dbSNP
rs1176512405 2351 dbSNP
rs562776694 2354 dbSNP
rs1365378966 2358 dbSNP
rs773291602 2362 dbSNP
rs1224571803 2363 dbSNP
rs950131033 2367 dbSNP
rs1171643186 2371 dbSNP
rs899117750 2374 dbSNP
rs138807790 2389 dbSNP
rs533264822 2398 dbSNP
rs1046309597 2402 dbSNP
rs1314522829 2404 dbSNP
rs1435512750 2405 dbSNP
rs1389752600 2417 dbSNP
rs923879945 2419 dbSNP
rs1476432086 2422 dbSNP
rs558251616 2423 dbSNP
rs1470680846 2425 dbSNP
rs1373780533 2427 dbSNP
rs1187388431 2428 dbSNP
rs935163783 2432 dbSNP
rs1474516154 2434 dbSNP
rs1053588069 2441 dbSNP
rs893659750 2443 dbSNP
rs1006603713 2444 dbSNP
rs1039480011 2445 dbSNP
rs1193773599 2447 dbSNP
rs551640623 2449 dbSNP
rs1270273882 2450 dbSNP
rs900828626 2451 dbSNP
rs998298242 2462 dbSNP
rs1353502961 2466 dbSNP
rs1020071588 2469 dbSNP
rs1415141154 2472 dbSNP
rs1446764349 2477 dbSNP
rs1305296528 2478 dbSNP
rs1327091395 2484 dbSNP
rs1411883098 2485 dbSNP
rs1397222614 2489 dbSNP
rs902918781 2494 dbSNP
rs1474485129 2498 dbSNP
rs1337974719 2513 dbSNP
rs1239955347 2518 dbSNP
rs560277666 2523 dbSNP
rs527420623 2524 dbSNP
rs539025302 2531 dbSNP
rs964649796 2546 dbSNP
rs1205685095 2547 dbSNP
rs1212492737 2551 dbSNP
rs1332077221 2555 dbSNP
rs997075464 2559 dbSNP
rs1233890157 2566 dbSNP
rs1263877459 2568 dbSNP
rs1005778737 2573 dbSNP
rs1457252796 2575 dbSNP
rs1017019026 2578 dbSNP
rs549082379 2583 dbSNP
rs533612 2590 dbSNP
rs753542111 2596 dbSNP
rs377599225 2597 dbSNP
rs1396854088 2598 dbSNP
rs779679662 2604 dbSNP
rs1197657616 2610 dbSNP
rs917363564 2611 dbSNP
rs531215712 2613 dbSNP
rs370637712 2614 dbSNP
rs977855392 2615 dbSNP
rs114480420 2626 dbSNP
rs754705287 2627 dbSNP
rs1470743135 2628 dbSNP
rs764781895 2640 dbSNP
rs935220554 2644 dbSNP
rs1192698442 2646 dbSNP
rs539728569 2662 dbSNP
rs746566927 2669 dbSNP
rs186767216 2670 dbSNP
rs942543604 2674 dbSNP
rs1316303848 2676 dbSNP
rs867662167 2678 dbSNP
rs1399016788 2682 dbSNP
rs1281823964 2691 dbSNP
rs1225238557 2694 dbSNP
rs1351183505 2700 dbSNP
rs1302935904 2701 dbSNP
rs757907006 2704 dbSNP
rs777206821 2712 dbSNP
rs534851465 2722 dbSNP
rs1326699109 2723 dbSNP
rs917134138 2724 dbSNP
rs1047147256 2726 dbSNP
rs1161958238 2736 dbSNP
rs886779715 2736 dbSNP
rs1401644117 2743 dbSNP
rs1005725025 2753 dbSNP
rs1017175836 2755 dbSNP
rs139119746 2756 dbSNP
rs1343840899 2762 dbSNP
rs1452195561 2764 dbSNP
rs1225635176 2767 dbSNP
rs949890656 2771 dbSNP
rs534100716 2772 dbSNP
rs1032240755 2773 dbSNP
rs555841619 2774 dbSNP
rs894647378 2775 dbSNP
rs1333796623 2776 dbSNP
rs1217936367 2783 dbSNP
rs781510853 2787 dbSNP
rs753097693 2788 dbSNP
rs375484186 2789 dbSNP
rs1381328458 2790 dbSNP
rs747536782 2792 dbSNP
rs369377901 2793 dbSNP
rs368731172 2795 dbSNP
rs755349475 2798 dbSNP
rs1357195329 2802 dbSNP
rs756605426 2805 dbSNP
rs777582267 2811 dbSNP
rs145597836 2815 dbSNP
rs373784555 2817 dbSNP
rs771574890 2817 dbSNP
rs1485399611 2824 dbSNP
rs1186189299 2829 dbSNP
rs756932481 2830 dbSNP
rs778346567 2833 dbSNP
rs745360020 2834 dbSNP
rs544667078 2839 dbSNP
rs1360033451 2840 dbSNP
rs145742091 2841 dbSNP
rs746827678 2845 dbSNP
rs768378143 2846 dbSNP
rs34805244 2850 dbSNP
rs776839091 2851 dbSNP
rs1029938119 2854 dbSNP
rs1278934169 2856 dbSNP
rs1286815779 2861 dbSNP
rs191565135 2862 dbSNP
rs1435280640 2863 dbSNP
rs989388506 2864 dbSNP
rs955608277 2866 dbSNP
rs770037862 2867 dbSNP
rs867654060 2872 dbSNP
rs915200768 2884 dbSNP
rs773207832 2886 dbSNP
rs763052033 2894 dbSNP
rs1213373873 2896 dbSNP
rs1286559387 2897 dbSNP
rs767018821 2900 dbSNP
rs368255114 2909 dbSNP
rs752055621 2910 dbSNP
rs759984147 2911 dbSNP
rs768063551 2917 dbSNP
rs1184159192 2921 dbSNP
rs545264632 2922 dbSNP
rs1400559300 2923 dbSNP
rs756907165 2924 dbSNP
rs975272701 2925 dbSNP
rs778594513 2926 dbSNP
rs1188129712 2932 dbSNP
rs560157344 2938 dbSNP
rs143668056 2942 dbSNP
rs1015675032 2947 dbSNP
rs779975852 2948 dbSNP
rs1248410816 2951 dbSNP
rs746878468 2955 dbSNP
rs184829846 2956 dbSNP
rs747947146 2961 dbSNP
rs974154980 2965 dbSNP
rs374436915 2966 dbSNP
rs1305785487 2967 dbSNP
rs773439739 2968 dbSNP
rs926633611 2982 dbSNP
rs1355412010 2983 dbSNP
rs1292033173 2986 dbSNP
rs781577952 2987 dbSNP
rs190477202 2988 dbSNP
rs531301993 2990 dbSNP
rs917207779 2992 dbSNP
rs1352220359 2994 dbSNP
rs878940987 2995 dbSNP
rs1297863377 3000 dbSNP
rs549401463 3001 dbSNP
rs1417033008 3006 dbSNP
rs894761977 3015 dbSNP
rs949948267 3017 dbSNP
rs1476056025 3019 dbSNP
rs1041578135 3034 dbSNP
rs935751360 3041 dbSNP
rs1253106414 3048 dbSNP
rs570888382 3049 dbSNP
rs1024868801 3050 dbSNP
rs1490781933 3061 dbSNP
rs1356424906 3062 dbSNP
rs1306773616 3063 dbSNP
rs1222699432 3065 dbSNP
rs770113498 3069 dbSNP
rs1051199867 3078 dbSNP
rs1446873338 3080 dbSNP
rs1393169106 3082 dbSNP
rs1162628873 3090 dbSNP
rs891380095 3100 dbSNP
rs150560721 3102 dbSNP
rs1261881250 3103 dbSNP
rs1429617478 3106 dbSNP
rs749463266 3111 dbSNP
rs768874535 3112 dbSNP
rs1251233729 3119 dbSNP
rs1216052152 3121 dbSNP
rs898643076 3127 dbSNP
rs1260704085 3134 dbSNP
rs1237291703 3142 dbSNP
rs1319171973 3145 dbSNP
rs145521756 3148 dbSNP
rs1240435448 3157 dbSNP
rs117113318 3158 dbSNP
rs1323349880 3164 dbSNP
rs567014814 3170 dbSNP
rs1033796429 3176 dbSNP
rs1426969920 3180 dbSNP
rs1288258608 3206 dbSNP
rs748575378 3210 dbSNP
rs1451354690 3217 dbSNP
rs1164405153 3218 dbSNP
rs1159416020 3219 dbSNP
rs181630528 3221 dbSNP
rs992213367 3235 dbSNP
rs1428941394 3237 dbSNP
rs963926942 3244 dbSNP
rs1024942683 3245 dbSNP
rs975359205 3255 dbSNP
rs1395321938 3268 dbSNP
rs922396282 3269 dbSNP
rs971313040 3270 dbSNP
rs1487019431 3271 dbSNP
rs1261679644 3275 dbSNP
rs1240374913 3283 dbSNP
rs1346733119 3286 dbSNP
rs1300872615 3292 dbSNP
rs933874914 3301 dbSNP
rs1235816120 3327 dbSNP
rs977309917 3328 dbSNP
rs982938959 3335 dbSNP
rs1285094995 3353 dbSNP
rs935874474 3361 dbSNP
rs990377814 3364 dbSNP
rs1217573571 3367 dbSNP
rs185177690 3382 dbSNP
rs1175829780 3394 dbSNP
rs79762860 3399 dbSNP
rs149149672 3400 dbSNP
rs200410753 3400 dbSNP
rs543835564 3400 dbSNP
rs555102941 3400 dbSNP
rs1482650874 3401 dbSNP
rs1183463806 3402 dbSNP
rs941020290 3405 dbSNP
rs1050725892 3407 dbSNP
rs1210593358 3407 dbSNP
rs1037974484 3408 dbSNP
rs915593717 3409 dbSNP
rs1212649267 3419 dbSNP
rs1345040854 3420 dbSNP
rs890761274 3423 dbSNP
rs948932223 3427 dbSNP
rs373513970 3432 dbSNP
rs540474483 3432 dbSNP
rs1045988116 3433 dbSNP
rs1037268014 3436 dbSNP
rs1407783914 3440 dbSNP
rs907355383 3442 dbSNP
rs999071412 3448 dbSNP
rs1053594139 3449 dbSNP
rs893253774 3451 dbSNP
rs61899391 3456 dbSNP
rs1034263294 3460 dbSNP
rs648033 3473 dbSNP
rs964715055 3474 dbSNP
rs1187959654 3481 dbSNP
rs545373955 3481 dbSNP
rs1469377253 3482 dbSNP
rs556620042 3482 dbSNP
rs966677874 3484 dbSNP
rs978069483 3488 dbSNP
rs1334564035 3492 dbSNP
rs578084740 3493 dbSNP
rs1031622127 3494 dbSNP
rs1332317895 3500 dbSNP
rs1294935250 3501 dbSNP
rs957508975 3503 dbSNP
rs202058115 3506 dbSNP
rs1335379614 3511 dbSNP
rs1327156578 3514 dbSNP
rs1453352557 3515 dbSNP
rs1029620590 3518 dbSNP
rs1370996823 3520 dbSNP
rs1460344439 3520 dbSNP
rs921062987 3522 dbSNP
rs1164174391 3523 dbSNP
rs545039073 3529 dbSNP
rs1231949714 3544 dbSNP
rs554043323 3548 dbSNP
rs1458668271 3549 dbSNP
rs1238251449 3550 dbSNP
rs372845946 3554 dbSNP
rs1212944499 3561 dbSNP
rs1467098972 3563 dbSNP
rs1292003213 3566 dbSNP
rs138674489 3568 dbSNP
rs908399567 3569 dbSNP
rs1201194106 3570 dbSNP
rs1242605198 3574 dbSNP
rs1264509343 3578 dbSNP
rs542852808 3581 dbSNP
rs1463034869 3583 dbSNP
rs1439283981 3585 dbSNP
rs759245059 3588 dbSNP
rs1324856509 3591 dbSNP
rs1400477080 3604 dbSNP
rs1406252622 3605 dbSNP
rs1156378485 3607 dbSNP
rs1404057041 3610 dbSNP
rs1441192450 3611 dbSNP
rs190421635 3615 dbSNP
rs181160910 3616 dbSNP
rs973794536 3639 dbSNP
rs915541163 3644 dbSNP
rs1248383356 3650 dbSNP
rs572470604 3664 dbSNP
rs1222295602 3665 dbSNP
rs898784927 3678 dbSNP
rs1281891479 3679 dbSNP
rs1354718895 3683 dbSNP
rs1046400418 3684 dbSNP
rs73564823 3685 dbSNP
rs117929286 3688 dbSNP
rs1055308668 3690 dbSNP
rs1369892831 3692 dbSNP
rs1275900963 3697 dbSNP
rs895277382 3699 dbSNP
rs1343760292 3702 dbSNP
rs934810503 3707 dbSNP
rs1360734981 3710 dbSNP
rs564604545 3710 dbSNP
rs532144799 3711 dbSNP
rs893327111 3724 dbSNP
rs547033191 3725 dbSNP
rs1032341441 3734 dbSNP
rs117205104 3734 dbSNP
rs957317473 3735 dbSNP
rs1011878817 3736 dbSNP
rs73564825 3748 dbSNP
rs757996969 3749 dbSNP
rs1209014347 3761 dbSNP
rs572866014 3764 dbSNP
rs1279457624 3765 dbSNP
rs1214442528 3779 dbSNP
rs1029981647 3786 dbSNP
rs955291820 3788 dbSNP
rs1284638132 3791 dbSNP
rs1280695647 3792 dbSNP
rs541878324 3793 dbSNP
rs1355292096 3794 dbSNP
rs1323628123 3799 dbSNP
rs1464234574 3809 dbSNP
rs1360350299 3810 dbSNP
rs1004558248 3814 dbSNP
rs961107342 3816 dbSNP
rs972376834 3817 dbSNP
rs751040021 3820 dbSNP
rs759392421 3825 dbSNP
rs149325442 3826 dbSNP
rs1256546367 3827 dbSNP
rs1436396018 3830 dbSNP
rs1484370476 3835 dbSNP
rs1207033556 3836 dbSNP
rs1238315137 3837 dbSNP
rs796286468 3838 dbSNP
rs776815365 3839 dbSNP
rs189616415 3851 dbSNP
rs1233868426 3855 dbSNP
rs1219798626 3860 dbSNP
rs970108496 3881 dbSNP
rs1490244048 3887 dbSNP
rs981158639 3891 dbSNP
rs12290773 3894 dbSNP
rs1431456273 3895 dbSNP
rs550311647 3896 dbSNP
rs1172645001 3900 dbSNP
rs1466102282 3904 dbSNP
rs1416834877 3905 dbSNP
rs1162500938 3917 dbSNP
rs1167217603 3918 dbSNP
rs1339237266 3921 dbSNP
rs989071473 3944 dbSNP
rs1176898772 3945 dbSNP
rs914735958 3947 dbSNP
rs561323858 3963 dbSNP
rs902639489 3965 dbSNP
rs368347864 3966 dbSNP
rs1271885560 3967 dbSNP
rs1247403268 3971 dbSNP
rs757811254 3972 dbSNP
rs1402639906 3973 dbSNP
rs1222851362 3976 dbSNP
rs1304599537 3980 dbSNP
rs1373956714 3990 dbSNP
rs77936162 3992 dbSNP
rs1446945761 3993 dbSNP
rs933415126 3995 dbSNP
rs893774884 3999 dbSNP
rs1226104837 4011 dbSNP
rs1051747335 4016 dbSNP
rs1267944392 4018 dbSNP
rs1350268895 4021 dbSNP
rs1337992437 4033 dbSNP
rs1009176038 4035 dbSNP
rs187236308 4038 dbSNP
rs1004097148 4039 dbSNP
rs139114857 4047 dbSNP
rs1179315862 4048 dbSNP
rs529233700 4058 dbSNP
rs898329466 4059 dbSNP
rs1251680280 4066 dbSNP
rs1212164529 4074 dbSNP
rs1271358533 4079 dbSNP
rs752538007 4081 dbSNP
rs78231019 4090 dbSNP
rs1019365070 4099 dbSNP
rs563968091 4100 dbSNP
rs969803671 4107 dbSNP
rs1311051392 4108 dbSNP
rs553877289 4109 dbSNP
rs532578352 4113 dbSNP
rs1035322382 4119 dbSNP
rs558807241 4121 dbSNP
rs1299033077 4123 dbSNP
rs952508473 4128 dbSNP
rs1240487377 4133 dbSNP
rs955933489 4136 dbSNP
rs990488032 4137 dbSNP
rs1168427146 4141 dbSNP
rs1362661050 4158 dbSNP
rs916852562 4159 dbSNP
rs1434118281 4161 dbSNP
rs1375998765 4162 dbSNP
rs11342742 4164 dbSNP
rs1191916069 4164 dbSNP
rs1201589237 4164 dbSNP
rs398017597 4164 dbSNP
rs1489513019 4165 dbSNP
rs1287700720 4166 dbSNP
rs1384313477 4171 dbSNP
rs1216904103 4173 dbSNP
rs1346436664 4178 dbSNP
rs536135092 4191 dbSNP
rs1331591863 4194 dbSNP
rs192001214 4212 dbSNP
rs1365783201 4216 dbSNP
rs1381355162 4220 dbSNP
rs371810043 4221 dbSNP
rs543174919 4222 dbSNP
rs924076760 4225 dbSNP
rs935421027 4226 dbSNP
rs1400093458 4239 dbSNP
rs183481741 4241 dbSNP
rs576863493 4248 dbSNP
rs922115003 4254 dbSNP
rs1244197778 4261 dbSNP
rs1478975123 4264 dbSNP
rs933384162 4269 dbSNP
rs1294466412 4272 dbSNP
rs1052286914 4275 dbSNP
rs1357302859 4276 dbSNP
rs886431246 4292 dbSNP
rs893876845 4293 dbSNP
rs940733412 4312 dbSNP
rs1201646680 4314 dbSNP
rs756443443 4315 dbSNP
rs528580993 4316 dbSNP
rs1448825231 4329 dbSNP
rs1019421850 4331 dbSNP
rs995395971 4334 dbSNP
rs1242492525 4336 dbSNP
rs993944960 4362 dbSNP
rs1396664105 4363 dbSNP
rs1027180657 4367 dbSNP
rs1395878021 4371 dbSNP
rs952488867 4381 dbSNP
rs1442752564 4395 dbSNP
rs990932411 4396 dbSNP
rs1022773020 4399 dbSNP
rs1023261915 4403 dbSNP
rs905694309 4411 dbSNP
rs1002618883 4415 dbSNP
rs1185180113 4422 dbSNP
rs1035887228 4424 dbSNP
rs188376238 4427 dbSNP
rs982338130 4428 dbSNP
rs45617836 4431 dbSNP
rs1452601924 4436 dbSNP
rs1227526547 4437 dbSNP
rs113556097 4440 dbSNP
rs1286113921 4447 dbSNP
rs1386419849 4454 dbSNP
rs1021314929 4456 dbSNP
rs968936756 4457 dbSNP
rs757258207 4458 dbSNP
rs1449156639 4463 dbSNP
rs1401626329 4465 dbSNP
rs932043505 4469 dbSNP
rs1050863262 4475 dbSNP
rs922091956 4476 dbSNP
rs890428818 4479 dbSNP
rs113423503 4482 dbSNP
rs943978309 4483 dbSNP
rs1379348685 4484 dbSNP
rs1040965564 4491 dbSNP
rs768964614 4495 dbSNP
rs1441073314 4503 dbSNP
rs897066408 4504 dbSNP
rs111684470 4508 dbSNP
rs561528340 4512 dbSNP
rs1451169142 4513 dbSNP
rs531950361 4518 dbSNP
rs550350464 4520 dbSNP
rs571758594 4521 dbSNP
rs371887058 4522 dbSNP
rs538748198 4523 dbSNP
rs1209406691 4524 dbSNP
rs547799420 4526 dbSNP
rs940681244 4527 dbSNP
rs190808419 4528 dbSNP
rs920613306 4529 dbSNP
rs1256513016 4532 dbSNP
rs1333137024 4535 dbSNP
rs182621214 4538 dbSNP
rs1031291535 4539 dbSNP
rs956938328 4543 dbSNP
rs1179166683 4546 dbSNP
rs1044713462 4547 dbSNP
rs1420925130 4548 dbSNP
rs1380379125 4551 dbSNP
rs905693391 4552 dbSNP
rs1477013647 4553 dbSNP
rs556868238 4554 dbSNP
rs1248433823 4555 dbSNP
rs990055920 4557 dbSNP
rs915376396 4558 dbSNP
rs1487880102 4559 dbSNP
rs1365082615 4564 dbSNP
rs932074923 4567 dbSNP
rs1219093351 4572 dbSNP
rs1354421883 4573 dbSNP
rs554453924 4575 dbSNP
rs868205457 4576 dbSNP
rs575887305 4580 dbSNP
rs145979214 4582 dbSNP
rs891523494 4583 dbSNP
rs1399768096 4584 dbSNP
rs558324121 4588 dbSNP
rs1021263635 4593 dbSNP
rs968383982 4596 dbSNP
rs996432746 4598 dbSNP
rs1029696349 4599 dbSNP
rs774618425 4600 dbSNP
rs1339280924 4605 dbSNP
rs1427175697 4606 dbSNP
rs1173152410 4612 dbSNP
rs918543485 4613 dbSNP
rs1196069220 4618 dbSNP
rs988072837 4620 dbSNP
rs576908708 4621 dbSNP
rs1314075918 4622 dbSNP
rs540745527 4623 dbSNP
rs779683345 4624 dbSNP
rs973461075 4628 dbSNP
rs1200803053 4630 dbSNP
rs1219687156 4632 dbSNP
rs369967879 4632 dbSNP
rs1362188057 4633 dbSNP
rs1301965133 4634 dbSNP
rs1445160094 4637 dbSNP
rs1360406955 4640 dbSNP
rs920561934 4644 dbSNP
rs867995492 4647 dbSNP
rs1327319000 4648 dbSNP
rs1044302255 4652 dbSNP
rs369757740 4653 dbSNP
rs187280310 4656 dbSNP
rs763464904 4656 dbSNP
rs541804898 4657 dbSNP
rs1011126360 4658 dbSNP
rs12363963 4659 dbSNP
rs1180349433 4660 dbSNP
rs1057346035 4662 dbSNP
rs12365499 4664 dbSNP
rs544069013 4665 dbSNP
rs1009958372 4666 dbSNP
rs1042864935 4668 dbSNP
rs369001060 4669 dbSNP
rs966098081 4672 dbSNP
rs1426513401 4673 dbSNP
rs373197782 4675 dbSNP
rs996266658 4676 dbSNP
rs12365500 4678 dbSNP
rs972042943 4679 dbSNP
rs1445449352 4682 dbSNP
rs1378689370 4683 dbSNP
rs1461968596 4684 dbSNP
rs1333347691 4686 dbSNP
rs919225917 4688 dbSNP
rs955098901 4688 dbSNP
rs1009169868 4689 dbSNP
rs1414858243 4690 dbSNP
rs1178067497 4696 dbSNP
rs929896059 4697 dbSNP
rs1240559899 4698 dbSNP
rs1015006068 4699 dbSNP
rs1488323507 4701 dbSNP
rs1410596366 4704 dbSNP
rs962192981 4709 dbSNP
rs973451195 4711 dbSNP
rs547591064 4712 dbSNP
rs566125569 4713 dbSNP
rs1302127717 4718 dbSNP
rs371647853 4720 dbSNP
rs928006719 4721 dbSNP
rs1252780353 4723 dbSNP
rs1158334094 4724 dbSNP
rs1342620486 4725 dbSNP
rs10891289 4727 dbSNP
rs541566913 4728 dbSNP
rs1490750798 4732 dbSNP
rs906283348 4733 dbSNP
rs992768676 4735 dbSNP
rs913064012 4736 dbSNP
rs1350810566 4737 dbSNP
rs536934744 4739 dbSNP
rs1428441303 4741 dbSNP
rs558361043 4743 dbSNP
rs1311502860 4744 dbSNP
rs57734892 4745 dbSNP
rs1297750356 4746 dbSNP
rs534779364 4750 dbSNP
rs796857034 4750 dbSNP
rs867414528 4751 dbSNP
rs552800641 4752 dbSNP
rs1010972307 4753 dbSNP
rs1426855141 4755 dbSNP
rs1294188891 4756 dbSNP
rs1263457222 4757 dbSNP
rs1022576686 4758 dbSNP
rs1007722081 4759 dbSNP
rs1235334112 4760 dbSNP
rs1019032360 4761 dbSNP
rs966109435 4762 dbSNP
rs1244930726 4764 dbSNP
rs972095169 4765 dbSNP
rs919315564 4766 dbSNP
rs952107096 4768 dbSNP
rs985188284 4772 dbSNP
rs574425725 4773 dbSNP
rs541892924 4774 dbSNP
rs1484614956 4775 dbSNP
rs909839036 4776 dbSNP
rs1185239476 4777 dbSNP
rs71477001 4778 dbSNP
rs947923848 4779 dbSNP
rs1453522834 4781 dbSNP
rs1183352128 4782 dbSNP
rs147738328 4783 dbSNP
rs1457117221 4784 dbSNP
rs1425712152 4786 dbSNP
rs373914137 4787 dbSNP
rs909449909 4788 dbSNP
rs1444791971 4790 dbSNP
rs386757488 4790 dbSNP
rs11213991 4791 dbSNP
rs11213992 4792 dbSNP
rs1209070363 4794 dbSNP
rs1322688660 4794 dbSNP
rs1294304778 4795 dbSNP
rs1336677822 4795 dbSNP
rs1449693054 4795 dbSNP
rs753877747 4795 dbSNP
rs972054090 4795 dbSNP
rs1389258713 4796 dbSNP
rs1323285944 4802 dbSNP
rs927751669 4803 dbSNP
rs1388133081 4807 dbSNP
rs939099363 4808 dbSNP
rs1379185511 4809 dbSNP
rs1424666181 4809 dbSNP
rs12794759 4810 dbSNP
rs397934070 4810 dbSNP
rs750951975 4810 dbSNP
rs1197899481 4811 dbSNP
rs1052208713 4813 dbSNP
rs949468063 4813 dbSNP
rs1271246025 4814 dbSNP
rs1312643780 4825 dbSNP
rs1284004565 4826 dbSNP
rs1384738430 4830 dbSNP
rs1351992041 4835 dbSNP
rs188863642 4855 dbSNP
rs1305880832 4858 dbSNP
rs1314574026 4864 dbSNP
rs1333190129 4871 dbSNP
rs931762090 4872 dbSNP
rs1050489893 4879 dbSNP
rs1359555352 4887 dbSNP
rs889378340 4890 dbSNP
rs771056157 4891 dbSNP
rs890129714 4902 dbSNP
rs776434989 4907 dbSNP
rs1408608779 4913 dbSNP
rs1171940282 4915 dbSNP
rs1241621285 4916 dbSNP
rs1019084921 4917 dbSNP
rs1200348853 4917 dbSNP
rs559639489 4923 dbSNP
rs1261356495 4924 dbSNP
rs1407488989 4927 dbSNP
rs1218039317 4930 dbSNP
rs1447717251 4931 dbSNP
rs1278450393 4934 dbSNP
rs532870714 4945 dbSNP
rs994996667 4955 dbSNP
rs548214899 4960 dbSNP
rs1469172571 4961 dbSNP
rs1026432162 4965 dbSNP
rs952224949 4965 dbSNP
rs377663541 4967 dbSNP
rs1345274826 4970 dbSNP
rs980883445 4973 dbSNP
rs759757979 4974 dbSNP
rs1412710625 4975 dbSNP
rs1035399981 4978 dbSNP
rs530782805 4980 dbSNP
rs969304984 4982 dbSNP
rs552201690 4985 dbSNP
rs1421743224 4990 dbSNP
rs751691417 4990 dbSNP
rs1188523691 4991 dbSNP
rs1475757360 4995 dbSNP
rs960776024 5000 dbSNP
rs927849584 5003 dbSNP
rs1225181731 5011 dbSNP
rs1264377150 5014 dbSNP
rs193092416 5014 dbSNP
rs913173594 5016 dbSNP
rs1292917808 5018 dbSNP
rs1215994509 5023 dbSNP
rs945848030 5031 dbSNP
rs978560530 5032 dbSNP
rs546430724 5035 dbSNP
rs946420573 5043 dbSNP
rs925793565 5045 dbSNP
rs931684124 5055 dbSNP
rs1050190568 5066 dbSNP
rs775314875 5067 dbSNP
rs775867938 5068 dbSNP
rs944427510 5074 dbSNP
rs1036559615 5076 dbSNP
rs943642548 5081 dbSNP
rs1269102355 5085 dbSNP
rs1410721568 5087 dbSNP
rs1040633007 5088 dbSNP
rs1180181899 5098 dbSNP
rs898054312 5099 dbSNP
rs139185909 5102 dbSNP
rs902095287 5124 dbSNP
rs1451751574 5130 dbSNP
rs553128612 5132 dbSNP
rs185846689 5137 dbSNP
rs887873948 5139 dbSNP
rs1307693832 5140 dbSNP
rs1288771554 5142 dbSNP
rs1006687312 5144 dbSNP
rs759490007 5144 dbSNP
rs1445996602 5145 dbSNP
rs905366274 5148 dbSNP
rs970068563 5155 dbSNP
rs1442734626 5156 dbSNP
rs535528273 5160 dbSNP
rs1184620119 5161 dbSNP
rs981430159 5163 dbSNP
rs762633963 5173 dbSNP
rs557024176 5174 dbSNP
rs1178127482 5175 dbSNP
rs960975141 5178 dbSNP
rs563663408 5181 dbSNP
rs987997486 5182 dbSNP
rs1360909942 5186 dbSNP
rs1020982231 5187 dbSNP
rs1238861228 5194 dbSNP
rs531058285 5196 dbSNP
rs1315045785 5209 dbSNP
rs1309144375 5211 dbSNP
rs967265185 5217 dbSNP
rs1366663760 5218 dbSNP
rs577236358 5221 dbSNP
rs967837612 5224 dbSNP
rs370784406 5225 dbSNP
rs796507780 5225 dbSNP
rs978679671 5225 dbSNP
rs1297631909 5228 dbSNP
rs1451790748 5236 dbSNP
rs575327763 5242 dbSNP
rs943071625 5248 dbSNP
rs1432904431 5249 dbSNP
rs1427662905 5250 dbSNP
rs925743880 5251 dbSNP
rs1490733056 5253 dbSNP
rs1040012647 5256 dbSNP
rs1215256863 5261 dbSNP
rs1484610885 5271 dbSNP
rs763715417 5272 dbSNP
rs1262361232 5287 dbSNP
rs1239710393 5292 dbSNP
rs1352546161 5295 dbSNP
rs141646259 5305 dbSNP
rs751129946 5308 dbSNP
rs929525731 5316 dbSNP
rs1411210825 5324 dbSNP
rs1277877053 5325 dbSNP
rs986281845 5330 dbSNP
rs911674567 5331 dbSNP
rs1380531284 5332 dbSNP
rs944467155 5334 dbSNP
rs1035961617 5336 dbSNP
rs1289910370 5337 dbSNP
rs879547395 5365 dbSNP
rs1404603724 5368 dbSNP
rs558991452 5370 dbSNP
rs1344279056 5379 dbSNP
rs1044901582 5380 dbSNP
rs1429474854 5380 dbSNP
rs905940045 5384 dbSNP
rs1426171448 5388 dbSNP
rs1049333269 5397 dbSNP
rs1205246506 5399 dbSNP
rs1205323436 5403 dbSNP
rs371154365 5403 dbSNP
rs1324000373 5405 dbSNP
rs1276156439 5406 dbSNP
rs1257598295 5409 dbSNP
rs1347735975 5412 dbSNP
rs1220381598 5413 dbSNP
rs905354004 5420 dbSNP
rs559498931 5421 dbSNP
rs1381225871 5422 dbSNP
rs541305470 5423 dbSNP
rs1470475503 5430 dbSNP
rs1009870052 5431 dbSNP
rs1166918775 5433 dbSNP
rs761309905 5436 dbSNP
rs968311100 5439 dbSNP
rs1193258160 5441 dbSNP
rs1443552185 5448 dbSNP
rs763765585 5463 dbSNP
rs766988485 5469 dbSNP
rs1252857904 5470 dbSNP
rs1490260355 5478 dbSNP
rs369880592 5483 dbSNP
rs1248591302 5484 dbSNP
rs1020929780 5488 dbSNP
rs1193894212 5500 dbSNP
rs968049549 5502 dbSNP
rs1478275618 5505 dbSNP
rs1185868972 5509 dbSNP
rs751419099 5515 dbSNP
rs1000106835 5516 dbSNP
rs1357390254 5519 dbSNP
rs1317719868 5520 dbSNP
rs1417061470 5521 dbSNP
rs761641835 5528 dbSNP
rs574623440 5537 dbSNP
rs1327242139 5540 dbSNP
rs1393558682 5543 dbSNP
rs1398178427 5549 dbSNP
rs1431427538 5552 dbSNP
rs756598513 5554 dbSNP
rs979279881 5555 dbSNP
rs780318398 5562 dbSNP
rs910340390 5564 dbSNP
rs953316688 5565 dbSNP
rs1422423281 5570 dbSNP
rs528478504 5572 dbSNP
rs1439350277 5577 dbSNP
rs1251446173 5579 dbSNP
rs143685795 5582 dbSNP
rs965727697 5585 dbSNP
rs1437738702 5588 dbSNP
rs971794277 5589 dbSNP
rs918914912 5600 dbSNP
rs1270152994 5602 dbSNP
rs1363425148 5603 dbSNP
rs930350096 5606 dbSNP
rs1350574357 5607 dbSNP
rs1278363549 5613 dbSNP
rs1241536733 5617 dbSNP
rs11549309 5618 dbSNP
rs1329053565 5623 dbSNP
rs1403983887 5633 dbSNP
rs926926331 5636 dbSNP
rs929590064 5637 dbSNP
rs1304403162 5639 dbSNP
rs1424824195 5640 dbSNP
rs938278264 5651 dbSNP
rs1407079913 5653 dbSNP
rs748312422 5656 dbSNP
rs1156759296 5663 dbSNP
rs141241867 5668 dbSNP
rs1358983736 5669 dbSNP
rs564269477 5673 dbSNP
rs528376172 5674 dbSNP
rs189925374 5676 dbSNP
rs1044583013 5680 dbSNP
rs765962703 5684 dbSNP
rs1042530570 5689 dbSNP
rs1214931441 5691 dbSNP
rs1223315521 5695 dbSNP
rs905951594 5699 dbSNP
rs1045160082 5704 dbSNP
rs376131914 5706 dbSNP
rs150804987 5709 dbSNP
rs61743550 5716 dbSNP
rs568926148 5717 dbSNP
rs1007891054 5722 dbSNP
rs539110395 5730 dbSNP
rs769739501 5731 dbSNP
rs1399648819 5732 dbSNP
rs1315665727 5743 dbSNP
rs965883265 5744 dbSNP
rs1387067780 5746 dbSNP
rs1322915614 5752 dbSNP
rs368970092 5755 dbSNP
rs1385642937 5756 dbSNP
rs775198406 5757 dbSNP
rs1479371926 5758 dbSNP
rs1431636529 5762 dbSNP
rs1200429256 5765 dbSNP
rs951699046 5767 dbSNP
rs1240458502 5785 dbSNP
rs1393160850 5792 dbSNP
rs1242814841 5794 dbSNP
rs984446811 5814 dbSNP
rs1286202709 5815 dbSNP
rs1047400 5819 dbSNP
rs535308037 5827 dbSNP
rs1266376921 5835 dbSNP
rs117370374 5837 dbSNP
rs975778834 5839 dbSNP
rs773999775 5840 dbSNP
rs1242245484 5842 dbSNP
rs188597656 5844 dbSNP
rs180696912 5845 dbSNP
rs1336005116 5848 dbSNP
rs150572150 5848 dbSNP
rs185974447 5849 dbSNP
rs1156293881 5850 dbSNP
rs1177364781 5856 dbSNP
rs903968110 5858 dbSNP
rs1409571083 5860 dbSNP
rs1417691737 5863 dbSNP
rs189651973 5865 dbSNP
rs757701637 5866 dbSNP
rs374273174 5867 dbSNP
rs1475787507 5870 dbSNP
rs545917020 5871 dbSNP
rs1459229496 5875 dbSNP
rs1049710618 5877 dbSNP
rs1182316451 5885 dbSNP
rs1321829830 5893 dbSNP
rs1462905976 5893 dbSNP
rs1405753684 5894 dbSNP
rs564489767 5894 dbSNP
rs1394616218 5895 dbSNP
rs980276269 5895 dbSNP
rs1336612562 5900 dbSNP
rs1007467302 5920 dbSNP
rs528403157 5921 dbSNP
rs1314231625 5927 dbSNP
rs1384952981 5928 dbSNP
rs539353843 5928 dbSNP
rs546895545 5935 dbSNP
rs1303188217 5939 dbSNP
rs1441279149 5942 dbSNP
rs182072584 5944 dbSNP
rs1352972617 5961 dbSNP
rs1172827611 5962 dbSNP
rs993318181 5966 dbSNP
rs1430434951 5971 dbSNP
rs938767576 5973 dbSNP
rs1238686862 5974 dbSNP
rs1286459152 5979 dbSNP
rs1446951996 5981 dbSNP
rs1386470304 5982 dbSNP
rs1176985309 5985 dbSNP
rs1331337823 5989 dbSNP
rs1228881734 5991 dbSNP
rs1479864811 5991 dbSNP
rs1026115833 5994 dbSNP
rs1057261878 5995 dbSNP
rs1230760091 5995 dbSNP
rs112664047 5997 dbSNP
rs1262467047 5999 dbSNP
rs891866795 6001 dbSNP
rs1201945300 6002 dbSNP
rs1256672561 6014 dbSNP
rs1361484786 6015 dbSNP
rs951777069 6016 dbSNP
rs1222940394 6018 dbSNP
rs553189927 6018 dbSNP
rs749913346 6024 dbSNP
rs1300077636 6031 dbSNP
rs903776077 6032 dbSNP
rs781766195 6033 dbSNP
rs1000708953 6045 dbSNP
rs1350908824 6046 dbSNP
rs1159035345 6050 dbSNP
rs1417651085 6052 dbSNP
rs1033318771 6055 dbSNP
rs1178180675 6056 dbSNP
rs1017407516 6058 dbSNP
rs1267800909 6065 dbSNP
rs753010403 6065 dbSNP
rs76638288 6067 dbSNP
rs992421032 6073 dbSNP
rs1215024714 6075 dbSNP
rs1174674331 6078 dbSNP
rs1315102514 6083 dbSNP
rs1308856776 6086 dbSNP
rs950495338 6088 dbSNP
rs1345113375 6092 dbSNP
rs1281621053 6094 dbSNP
rs561924475 6104 dbSNP
rs1406783353 6108 dbSNP
rs1391570068 6122 dbSNP
rs1288756622 6125 dbSNP
rs918197130 6127 dbSNP
rs1452224288 6131 dbSNP
rs1347510975 6138 dbSNP
rs760201231 6142 dbSNP
rs1469668449 6144 dbSNP
rs1428079289 6163 dbSNP
rs1403358811 6167 dbSNP
rs1390979509 6170 dbSNP
rs1434360758 6171 dbSNP
rs1185482710 6172 dbSNP
rs1306427808 6179 dbSNP
rs1262491279 6192 dbSNP
rs1209050299 6197 dbSNP
rs1322575283 6202 dbSNP
rs983526878 6219 dbSNP
rs1225613021 6221 dbSNP
rs1331941113 6222 dbSNP
rs1294915464 6226 dbSNP
rs1015899561 6229 dbSNP