miRTarBase - #MIRT672597 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NKPD1   
Synonyms -
Description NTPase KAP family P-loop domain containing 1
Transcript NM_198478   
Expression
Putative miRNA Targets on NKPD1
3'UTR of NKPD1
(miRNA target sites are highlighted)
>NKPD1|NM_198478|3'UTR
   1 ATGGAGGACTTGGCGGGCAGCAGGAGGCAAGGGTTCCTCCATCTGCCCAGATGGGAGAATAGGGGGCTGGACTGGGGCCG
  81 CAACCCAGGGTCCGAATGAGCCCTGTGAGGCCCACACCCCCAGGTGAACCTGAGCCAGAGCCGTGGACATAGCTTCCAAG
 161 GAGTGCGGCCACAAGCCGGTGCCAGCATGAGAGCAGGCACAGAAGGACCAGTGAGGAAGTCAGGGTATACATGCAATAAA
 241 TGGAGGTGTTGAGAGCCCGGAGTTGCTCTCCGCATCCTGATCTGACCAGGGACCAGGCCTGCCCCGTCCTGCCACAGGGC
 321 CTGCCCCATCCTGCTAAGCCCACTTACTCCTCTGCACCATGCTGGCCTCCTCATCTGGCATCTCTGTGGCAGGAGAGGCT
 401 GCGGGGGTGGTGGGTGAGGCTGCAGAGATGACAGGTGGATGGGCCAGGTTGACTCAGGCAACATGGAGCGCCCAGGCCTC
 481 AGGGAATCCCAGTCCTTGTCCCCATGCCCTAGCTTGCCCCTCTGTGAGTAGGGCAGGGGCTGGCATTTCTGAGGATGACC
 561 TCGGTGACCTCAGCAAGCTGCTCCACCCCTAGGGTGGCTCCATTCTCAACGTAATGGGTTAGACCTCGCTGGCACCTCAG
 641 CCAGCTGGAGTGGGTGGCACTAACCTCCCCCAGACAAATAACTGTCCACAGGGTACCTGCCTTACGAGTCACTCCAGGGC
 721 CACTGGTTAGTCACTGACACTGAAGCCACTGCATCAGCCCCCTGATGAGGACAGGGAAGTTGGGCAGAGATGGGGACATA
 801 CAGGGCCCAAGCCACAGCCAGCCAGGAGGGGTTACACTAGGGCTCCCCCACTTTCCCTCTGGGCAGAGCCCTGGGCTGGG
 881 GGTGGGTGTCACTCCTCTGGGCAGTTCCTGATTCCTCACTGGTCAAATGTTCAGCCACACGCTCAGGCCCTGGGGTGCCT
 961 GGCCCAGTTCCAAGTGTGTGCCGGCAGGGGCCACAAGGGCCAACACTGAACATACCCTGGGATGAGGCTGAGGGTGTGGC
1041 TTCTGAGCCAGGGCCCTGAGGCTGGTGGAGGGGACAGCCCCCGAGGAACCTGAGAGCTCTGCAAAGGCACACACCCTCAG
1121 GCCATGGGACTGGGTCACTGACCTCACAGTTCTTTAGTTCCAAGGCTGGGCATAGCATCCAGGTCTGGCTGCAGCACCGG
1201 AGTTCTCTGGCCACAGCAATTGTCACAGGTGCATGCAGGTCAGTGGGAGCCCTCTATGATCTTCCCTGGGGCTGGGCAAG
1281 CAGAGGTGCTGTTTCCCATTCCTGGACTGACTAAGCTGGTAGGATACGCCTGGACCTCCTGGGAGCTGTTTCCCAGCAGT
1361 CAGGGAGAGCTGGCCTCAGAGGGAGAAGGATGGGGCCTCGTGACACCGTTAAGTCTGTTTCTGTAGATGTGTGGTTGGGG
1441 TCAATATATCCCTGTAGCCTCCCTTAAGCCAGTTTCAGTTGGGTTTGTTTCTTACCACCTGGAATCCAAGCTGAAAATAA
1521 ATTTTCACTCCTGTTACCAGGAGTGGGGTGCTGTGAGAGATGCTAACGTGTAGACTTGGCTGGAGGTGAGGGCAGGACTG
1601 AAGCCCCCCATGCCTCAGTAAGAAGCTGCATCAGCCTGGCCAACATGGTGAAGCCCTGTCTCTAATAAAAATACAAAAAG
1681 ATTAGCTGGGCATGGTGGTGCATGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGTGGGAGGATCACTTGAACCCGGGAG
1761 GTGGTGGCTGGAGCCAAGATGGTGCCACTGCACTCCAGCCTGGGCGACAGAGCAAGACTCCGACTGATTAAAAAAAAAAG
1841 CCGCAGCCTCTGTTACGTGGTACAAGCTGTGGCCAAACTGTTGGTCACTGTATCTTCACGTGGAGCTGCTATGAGAACTT
1921 GCACCTGTGTAAAGCCACGGGACCGTTGTCACGAACAAAAAAGGAGCACGGCTGACCTGTGCGCCTTTCCCAGCAATGAG
2001 TCAGGGAGCAGGTTTCCCTTCTCCACTCCCTTCCCCCATCTGCCCACTTGATCCGGGATCCTTGAGGCCCTGGGGAGCAA
2081 CAGAGCCCTAAGAGCTTCAAAGGGGCCTGGGTCCAGGAATAACTTGGTGAAGAGCTGCCTGCCACTCTGAACATCCACAT
2161 GTGACAATAAACATCTCCTGTGTTAGGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::::||| |   :|||||| 
Target 5' atGGTGCCACT---GCACTCCa 3'
1779 - 1797 133.00 -16.10
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||:|  ||| |  |||||| 
Target 5' aaAATA-AATTTT--CACTCCt 3'
1514 - 1532 126.00 -9.40
3
miRNA  3' guUUGUG--GUAACAGUGUGAGGu 5'
            |:| |  ||  | ||||| || 
Target 5' agAGCTCTGCAAAGGCACACACCc 3'
1093 - 1116 122.00 -13.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30507001 15 COSMIC
COSN31512274 45 COSMIC
COSN30518703 50 COSMIC
COSN30126347 80 COSMIC
COSN8261023 95 COSMIC
COSN30568794 140 COSMIC
COSN23506074 305 COSMIC
COSN25871193 377 COSMIC
COSN20694920 507 COSMIC
COSN16878175 629 COSMIC
COSN9226669 678 COSMIC
COSN1216604 830 COSMIC
COSN20115883 845 COSMIC
COSN1216602 917 COSMIC
COSN1216600 962 COSMIC
COSN9850991 1347 COSMIC
COSN20885711 1352 COSMIC
COSN8973544 1409 COSMIC
COSN27277488 1829 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1350553127 1 dbSNP
rs777834643 8 dbSNP
rs575884785 9 dbSNP
rs369832157 14 dbSNP
rs1010462575 15 dbSNP
rs1413567168 27 dbSNP
rs1220640153 32 dbSNP
rs1318890311 39 dbSNP
rs771651440 42 dbSNP
rs1212875758 43 dbSNP
rs1040500306 53 dbSNP
rs944492981 56 dbSNP
rs888888241 57 dbSNP
rs960296085 64 dbSNP
rs190215571 73 dbSNP
rs185685640 79 dbSNP
rs895650269 80 dbSNP
rs557381207 90 dbSNP
rs866511618 102 dbSNP
rs1381099781 117 dbSNP
rs1483426228 118 dbSNP
rs1210202654 119 dbSNP
rs1256053234 121 dbSNP
rs537536772 124 dbSNP
rs1037752531 142 dbSNP
rs974324750 143 dbSNP
rs1419244012 149 dbSNP
rs1006269807 150 dbSNP
rs940155037 153 dbSNP
rs908728035 156 dbSNP
rs886245722 163 dbSNP
rs1047573094 166 dbSNP
rs1057384826 172 dbSNP
rs192224730 176 dbSNP
rs923179062 177 dbSNP
rs563805868 178 dbSNP
rs957367391 183 dbSNP
rs1468087528 184 dbSNP
rs763941672 192 dbSNP
rs867292553 195 dbSNP
rs1371775042 206 dbSNP
rs376849417 211 dbSNP
rs1343078640 217 dbSNP
rs1233725671 221 dbSNP
rs1478160167 222 dbSNP
rs1039399110 230 dbSNP
rs998743714 231 dbSNP
rs902994227 232 dbSNP
rs1186127564 241 dbSNP
rs943048988 247 dbSNP
rs117540719 255 dbSNP
rs529107934 258 dbSNP
rs979168477 259 dbSNP
rs1200818893 263 dbSNP
rs1453396997 271 dbSNP
rs565662923 272 dbSNP
rs748346982 284 dbSNP
rs966461669 291 dbSNP
rs913377975 297 dbSNP
rs1217509564 305 dbSNP
rs115379353 306 dbSNP
rs116106679 307 dbSNP
rs4330014 309 dbSNP
rs1320956289 311 dbSNP
rs758292248 315 dbSNP
rs994465958 320 dbSNP
rs1233836744 324 dbSNP
rs533293282 327 dbSNP
rs1347234306 328 dbSNP
rs1219817627 331 dbSNP
rs1284214301 333 dbSNP
rs1211021818 335 dbSNP
rs1327637198 335 dbSNP
rs117181329 340 dbSNP
rs1467801924 343 dbSNP
rs1191379900 352 dbSNP
rs940266277 355 dbSNP
rs1335277152 356 dbSNP
rs1157432611 361 dbSNP
rs1405763326 362 dbSNP
rs908815884 364 dbSNP
rs1045892312 365 dbSNP
rs752659658 366 dbSNP
rs950302402 370 dbSNP
rs1321833522 373 dbSNP
rs1016691794 375 dbSNP
rs867625253 378 dbSNP
rs1279007694 379 dbSNP
rs1349222626 382 dbSNP
rs915955041 384 dbSNP
rs886509135 386 dbSNP
rs991539812 392 dbSNP
rs1334619276 399 dbSNP
rs957341214 403 dbSNP
rs940108268 408 dbSNP
rs908647950 411 dbSNP
rs984046297 415 dbSNP
rs1451801211 424 dbSNP
rs71352254 425 dbSNP
rs1047832684 434 dbSNP
rs1410959934 437 dbSNP
rs1475042396 439 dbSNP
rs977418040 441 dbSNP
rs1473564145 447 dbSNP
rs1369206555 462 dbSNP
rs1182827120 468 dbSNP
rs369182454 469 dbSNP
rs1443884719 470 dbSNP
rs765271065 472 dbSNP
rs1197985241 474 dbSNP
rs1458145510 475 dbSNP
rs1019314784 476 dbSNP
rs531670017 482 dbSNP
rs953337999 495 dbSNP
rs1411668045 498 dbSNP
rs1289562979 500 dbSNP
rs1355333739 505 dbSNP
rs1390489342 510 dbSNP
rs943286576 512 dbSNP
rs1259501947 519 dbSNP
rs903487774 520 dbSNP
rs563001304 522 dbSNP
rs1356694900 525 dbSNP
rs1211202618 527 dbSNP
rs759655335 533 dbSNP
rs945046627 536 dbSNP
rs913639449 537 dbSNP
rs542822678 538 dbSNP
rs898938074 539 dbSNP
rs1483752062 540 dbSNP
rs991942073 550 dbSNP
rs1334394878 553 dbSNP
rs1256746279 554 dbSNP
rs1036016251 556 dbSNP
rs1189405432 556 dbSNP
rs1448242745 560 dbSNP
rs938828766 562 dbSNP
rs928804582 563 dbSNP
rs1368909132 567 dbSNP
rs187319433 571 dbSNP
rs867240442 579 dbSNP
rs887363440 592 dbSNP
rs980351730 597 dbSNP
rs1308691101 604 dbSNP
rs1375415385 606 dbSNP
rs1394798320 610 dbSNP
rs75029548 611 dbSNP
rs1323979580 616 dbSNP
rs1016540500 617 dbSNP
rs879624204 619 dbSNP
rs184055419 620 dbSNP
rs916094397 620 dbSNP
rs140405738 622 dbSNP
rs984744872 627 dbSNP
rs577961689 628 dbSNP
rs191567664 629 dbSNP
rs1026357154 632 dbSNP
rs537852115 635 dbSNP
rs754116507 636 dbSNP
rs1446246603 644 dbSNP
rs1388603706 646 dbSNP
rs901641169 649 dbSNP
rs1451529015 654 dbSNP
rs778999112 655 dbSNP
rs1169385288 657 dbSNP
rs967823150 658 dbSNP
rs1017865447 660 dbSNP
rs987801465 664 dbSNP
rs1239867064 670 dbSNP
rs1007451039 673 dbSNP
rs758347810 677 dbSNP
rs1450495267 678 dbSNP
rs1435355900 683 dbSNP
rs1289931971 686 dbSNP
rs1302130350 694 dbSNP
rs568832814 705 dbSNP
rs142470380 706 dbSNP
rs371256536 717 dbSNP
rs1256540823 719 dbSNP
rs1285841531 720 dbSNP
rs755066591 723 dbSNP
rs1241245505 725 dbSNP
rs1466466495 727 dbSNP
rs1189473483 740 dbSNP
rs1043691648 745 dbSNP
rs945015439 749 dbSNP
rs1379784092 751 dbSNP
rs1301819528 754 dbSNP
rs1178262086 755 dbSNP
rs1435892336 763 dbSNP
rs1457147312 764 dbSNP
rs1157488792 769 dbSNP
rs1331796891 775 dbSNP
rs1458040540 776 dbSNP
rs535232390 779 dbSNP
rs1364993324 786 dbSNP
rs931319747 791 dbSNP
rs1388060592 793 dbSNP
rs994701487 798 dbSNP
rs367812484 802 dbSNP
rs1335173427 803 dbSNP
rs1399239255 806 dbSNP
rs921296339 808 dbSNP
rs1360058456 812 dbSNP
rs114356221 813 dbSNP
rs1329612523 816 dbSNP
rs1014719916 817 dbSNP
rs1056186703 823 dbSNP
rs1420030220 825 dbSNP
rs1004511555 830 dbSNP
rs546862596 831 dbSNP
rs1191709995 837 dbSNP
rs533253685 845 dbSNP
rs1477643621 846 dbSNP
rs980659903 849 dbSNP
rs148195725 850 dbSNP
rs1414746090 857 dbSNP
rs948944673 859 dbSNP
rs570767618 873 dbSNP
rs894756993 881 dbSNP
rs1347800067 882 dbSNP
rs1459118841 884 dbSNP
rs1293671347 885 dbSNP
rs1369420462 886 dbSNP
rs1444929827 892 dbSNP
rs1407381623 894 dbSNP
rs1290168255 895 dbSNP
rs1350977917 896 dbSNP
rs1055877370 909 dbSNP
rs936208583 921 dbSNP
rs904615026 928 dbSNP
rs1356250625 929 dbSNP
rs1278597280 931 dbSNP
rs1482771425 933 dbSNP
rs1203051704 935 dbSNP
rs1254655372 937 dbSNP
rs985050228 940 dbSNP
rs551437552 941 dbSNP
rs1425868980 942 dbSNP
rs950682837 945 dbSNP
rs1165048402 951 dbSNP
rs911894882 955 dbSNP
rs1026278782 958 dbSNP
rs1346316757 962 dbSNP
rs976107400 977 dbSNP
rs987513196 981 dbSNP
rs1276690901 982 dbSNP
rs966543299 983 dbSNP
rs531751469 984 dbSNP
rs1363480981 991 dbSNP
rs1428648758 1005 dbSNP
rs1007791163 1006 dbSNP
rs1300923425 1007 dbSNP
rs1381090322 1013 dbSNP
rs1228607261 1017 dbSNP
rs1316030994 1025 dbSNP
rs931873010 1026 dbSNP
rs562804251 1032 dbSNP
rs1226328051 1033 dbSNP
rs1340145970 1035 dbSNP
rs921878568 1044 dbSNP
rs973229757 1060 dbSNP
rs903718269 1067 dbSNP
rs1022218866 1071 dbSNP
rs1009489792 1073 dbSNP
rs1182752786 1079 dbSNP
rs892108655 1082 dbSNP
rs781176727 1083 dbSNP
rs970398673 1085 dbSNP
rs1056160737 1094 dbSNP
rs1025046045 1114 dbSNP
rs1402044682 1142 dbSNP
rs1011899035 1149 dbSNP
rs369145932 1149 dbSNP
rs766601215 1161 dbSNP
rs1003235237 1164 dbSNP
rs1448547362 1173 dbSNP
rs904928881 1181 dbSNP
rs894724436 1182 dbSNP
rs1433153166 1183 dbSNP
rs1300027457 1191 dbSNP
rs1340164183 1192 dbSNP
rs1218683601 1194 dbSNP
rs1413903544 1198 dbSNP
rs1044857064 1199 dbSNP
rs543089587 1201 dbSNP
rs373015825 1203 dbSNP
rs1049270506 1220 dbSNP
rs1190124941 1226 dbSNP
rs147684473 1228 dbSNP
rs929571475 1231 dbSNP
rs560306080 1233 dbSNP
rs1489056449 1234 dbSNP
rs919234037 1235 dbSNP
rs147041223 1236 dbSNP
rs1041776616 1239 dbSNP
rs966098563 1242 dbSNP
rs1158222042 1246 dbSNP
rs1386201404 1254 dbSNP
rs910617786 1256 dbSNP
rs1206803545 1261 dbSNP
rs577871102 1271 dbSNP
rs1443507434 1277 dbSNP
rs1327197671 1283 dbSNP
rs968246053 1286 dbSNP
rs1273118959 1289 dbSNP
rs773593880 1290 dbSNP
rs1212912246 1291 dbSNP
rs1317409053 1296 dbSNP
rs932008755 1298 dbSNP
rs921805408 1308 dbSNP
rs1450656449 1310 dbSNP
rs201531065 1313 dbSNP
rs1220711564 1315 dbSNP
rs1353724942 1318 dbSNP
rs941812397 1323 dbSNP
rs558052561 1326 dbSNP
rs140419945 1327 dbSNP
rs575162940 1328 dbSNP
rs555096872 1330 dbSNP
rs762273473 1333 dbSNP
rs534667968 1334 dbSNP
rs904898155 1336 dbSNP
rs568406332 1340 dbSNP
rs1463961995 1348 dbSNP
rs1045175979 1353 dbSNP
rs572814200 1355 dbSNP
rs990445784 1381 dbSNP
rs1349116790 1384 dbSNP
rs535531695 1389 dbSNP
rs1230675686 1396 dbSNP
rs1280502367 1399 dbSNP
rs959034365 1400 dbSNP
rs1207715871 1406 dbSNP
rs1291499308 1407 dbSNP
rs1005311471 1408 dbSNP
rs762628317 1412 dbSNP
rs887915962 1415 dbSNP
rs1203756105 1417 dbSNP
rs1478598522 1422 dbSNP
rs548313287 1428 dbSNP
rs187883757 1431 dbSNP
rs528518085 1435 dbSNP
rs1483979261 1439 dbSNP
rs553162911 1440 dbSNP
rs1367658932 1443 dbSNP
rs16979703 1444 dbSNP
rs1473314489 1451 dbSNP
rs1239541745 1457 dbSNP
rs1161683076 1459 dbSNP
rs1020858279 1463 dbSNP
rs1425404281 1464 dbSNP
rs1160177819 1469 dbSNP
rs929498038 1470 dbSNP
rs1369318170 1472 dbSNP
rs1412208721 1482 dbSNP
rs554412866 1487 dbSNP
rs570728946 1493 dbSNP
rs1330074146 1497 dbSNP
rs1010437850 1501 dbSNP
rs890532581 1503 dbSNP
rs1203064865 1511 dbSNP
rs919495767 1514 dbSNP
rs1457666699 1518 dbSNP
rs62118467 1540 dbSNP
rs1234605733 1544 dbSNP
rs1258800734 1555 dbSNP
rs1051858623 1559 dbSNP
rs1344301675 1561 dbSNP
rs752315934 1567 dbSNP
rs769248307 1570 dbSNP
rs1255300428 1573 dbSNP
rs1440516952 1580 dbSNP
rs1189301024 1591 dbSNP
rs1312251051 1598 dbSNP
rs900514268 1602 dbSNP
rs1168106010 1604 dbSNP
rs1227570704 1611 dbSNP
rs910554854 1623 dbSNP
rs1285683401 1640 dbSNP
rs536073206 1646 dbSNP
rs907817190 1647 dbSNP
rs1399364171 1649 dbSNP
rs1048014380 1658 dbSNP
rs1288919741 1658 dbSNP
rs1394708918 1662 dbSNP
rs1336526621 1664 dbSNP
rs550864787 1674 dbSNP
rs1466715138 1680 dbSNP
rs151223945 1683 dbSNP
rs990539026 1692 dbSNP
rs1227468260 1693 dbSNP
rs1255361084 1698 dbSNP
rs959002474 1700 dbSNP
rs1202005095 1703 dbSNP
rs1263515059 1708 dbSNP
rs1464227043 1718 dbSNP
rs924969299 1723 dbSNP
rs987960447 1734 dbSNP
rs1246383924 1735 dbSNP
rs1163678338 1739 dbSNP
rs569210301 1742 dbSNP
rs956560810 1750 dbSNP
rs182388335 1755 dbSNP
rs1416431909 1756 dbSNP
rs1003467464 1758 dbSNP
rs969368113 1759 dbSNP
rs770739294 1761 dbSNP
rs1020572608 1766 dbSNP
rs969428531 1766 dbSNP
rs1023315894 1770 dbSNP
rs1439692727 1774 dbSNP
rs1239305177 1779 dbSNP
rs1005688316 1786 dbSNP
rs888176166 1789 dbSNP
rs1180642242 1792 dbSNP
rs868495241 1798 dbSNP
rs113140337 1805 dbSNP
rs777761880 1806 dbSNP
rs1382344418 1808 dbSNP
rs1040988284 1810 dbSNP
rs944985466 1821 dbSNP
rs1030390193 1822 dbSNP
rs1283774616 1830 dbSNP
rs1328260265 1833 dbSNP
rs1206538308 1840 dbSNP
rs996278149 1840 dbSNP
rs889086317 1842 dbSNP
rs1205865525 1843 dbSNP
rs1266750423 1847 dbSNP
rs1237677512 1856 dbSNP
rs1037694827 1857 dbSNP
rs1309854019 1859 dbSNP
rs1050431461 1863 dbSNP
rs1430557145 1890 dbSNP
rs1472480715 1892 dbSNP
rs946728420 1899 dbSNP
rs1346640013 1900 dbSNP
rs1453991295 1904 dbSNP
rs1292524198 1918 dbSNP
rs560218810 1922 dbSNP
rs988264745 1928 dbSNP
rs1406206744 1938 dbSNP
rs1283876422 1939 dbSNP
rs935114696 1944 dbSNP
rs927828846 1945 dbSNP
rs982411092 1946 dbSNP
rs949208574 1952 dbSNP
rs546763839 1953 dbSNP
rs1054470 1962 dbSNP
rs1023994678 1968 dbSNP
rs8108762 1969 dbSNP
rs80182863 1970 dbSNP
rs1381519113 1974 dbSNP
rs1025343865 1976 dbSNP
rs993879522 1983 dbSNP
rs897964304 1986 dbSNP
rs1419980435 1990 dbSNP
rs1163675246 1992 dbSNP
rs1431893138 1996 dbSNP
rs1019124277 2006 dbSNP
rs754812693 2009 dbSNP
rs575895689 2012 dbSNP
rs889362124 2019 dbSNP
rs559429199 2021 dbSNP
rs1369949440 2026 dbSNP
rs1051152806 2030 dbSNP
rs1299759844 2037 dbSNP
rs1373788375 2038 dbSNP
rs1395193538 2041 dbSNP
rs1312305387 2043 dbSNP
rs1320117201 2047 dbSNP
rs546585875 2054 dbSNP
rs113257925 2055 dbSNP
rs1203641580 2058 dbSNP
rs1261281823 2058 dbSNP
rs913440467 2064 dbSNP
rs893815341 2073 dbSNP
rs572927360 2075 dbSNP
rs545930512 2077 dbSNP
rs1181618380 2078 dbSNP
rs989088761 2081 dbSNP
rs1052487723 2087 dbSNP
rs955018399 2088 dbSNP
rs1352760257 2093 dbSNP
rs935417845 2094 dbSNP
rs1389030570 2103 dbSNP
rs1030484765 2104 dbSNP
rs1172479033 2115 dbSNP
rs1354985925 2119 dbSNP
rs1286408396 2125 dbSNP
rs927765959 2127 dbSNP
rs553124180 2140 dbSNP
rs76598479 2141 dbSNP
rs35070962 2156 dbSNP
rs1300074874 2161 dbSNP
rs556902530 2165 dbSNP
rs1158278141 2166 dbSNP
rs1016398521 2167 dbSNP
rs916491793 2168 dbSNP
rs1369345589 2171 dbSNP
rs549682648 2175 dbSNP
rs1364587811 2176 dbSNP
rs1295928663 2178 dbSNP
rs1275782585 2179 dbSNP
rs1308568006 2181 dbSNP
rs750619187 2182 dbSNP
rs1398961632 2184 dbSNP
rs984041215 2185 dbSNP
rs1361595886 2191 dbSNP
rs529968793 2195 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::::||| |   :|||||| 
Target 5' auGGUGCCACU---GCACUCCa 3'
3 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000317951.4 | 3UTR | AGAUGGUGCCACUGCACUCCAGCCUGGGCGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000317951.4 | 3UTR | GAUGGUGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*