miRTarBase - #MIRT673251 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol INO80   
Synonyms INO80A, INOC1, hINO80
Description INO80 complex subunit
Transcript NM_017553   
Expression
Putative miRNA Targets on INO80
3'UTR of INO80
(miRNA target sites are highlighted)
>INO80|NM_017553|3'UTR
   1 CCATCTGGGCCCTCCGACTTCCTTCAACCAAACCAGGGCTAGAGTCCTGACCTGCCAGTGGTCTTTGGATGGCTTGCCCC
  81 GTGCAGCATCTTGCATCCTGAGTCAGAAGTGGAAATGTCCAGCAGGGGAAGGACAGGCAGGTGGATGGTGTGAGCACTTT
 161 TATCATCTGTGTCTCATCAGGAGCATCTGGGGTGCCTGTAGGAGGAAGGCCACAGGGCATGGATCAGCCCCACTGCATCT
 241 CAAGTGAACTGTATAGCCAAGTCTTAAACCTCTCACGGGGCAAGCCTGACACAGACCCCCTTTAGATGCTCAGGCATACT
 321 GTTTCCATCCCGATTCCACTCTTCGGCTCTGACACGTCCCTTGCAAAGTCTCCGCAGGTGCTGTGAAGAGCCTTCCATGG
 401 TAGAGATTTCTCTTAAGAGTGTGATTTCTCATAGGGCTAGTAAGGGAGATTGTATACCTGTTGTCCACAGTCTTCAGGCA
 481 GCTCCCCAGGTCTCTGAACCCCAGAGTGTCATCATTGGAGAGAGCAGTGACTGCGAGAGATGGTGGAGGCCGCTAAGCAT
 561 GGTAGAGGCTAGAGGAAGTCTATCCACAGGCAGTTGTGTTCCCAGCAATTCCTCCCATCCTGCATGGTTCACACCAAGAG
 641 AACCTTCAGATCCTACCAGCAACCGTAGCACCTTCCACCCAGGGGACTCCCAGAAGCCAGTAAAGAGACCAGGAGCCACC
 721 TCAATCAGCAGGACAGCCTCACTGCCCCTCTTGCAGAGTCCCCTTTGCCCATCCTGAATGCACAGTCTCCCTGCTCATGC
 801 CCTTCAGTCCCCTGCTTGGCTGTATGCACTGTCTATATTGCACTGAGAGAGGAAGGGACAGCAGGAGTGAGGTGAAGAGG
 881 GCGGAGAGAGGGGGCAGGCTCGGCACCGGCCCTCCCAGCCCGGCCAGCCTGAGCTTGCTGCCCTCCAGTAGAGACAGAGG
 961 GGCAGTGTTTGCATGGGAGGTGTTTCTGCCTGTCCCTGCCTGATGTCCCTGGTGGAGCAGGTACCTCCGGGCGGGCAAGC
1041 CTCTGATTTGCACACCTGAAAATCGCGGAATTGAGTTTCGATAGATTGATTTTTAAAACTTTTTTGGAGTAGGGGGTATA
1121 GGGGAATCATTTAATTTAAATCATTAAGATTCCCCTGCTCAAACCCAGATTCCTGTGTACAGATGCTATTTAGAGGGAAT
1201 CAGAAAAATGCCAAGCCTTTTCTCTTTGAATGTGCTATTTTTATAACTGAACTTGTACATATGTATAAAGAGAGACACAT
1281 CTTCCTTTTACTAACTGGATAAAAAAATCTTAAATAAAATGGAGTGAGATAATTTTATGTAAAAAAAAAAAAAAAAAAAA
1361 AAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGG-UAACA-GUGUGAGGu 5'
             |:||| :|||| |||| ||: 
Target 5' tgtATACCTGTTGTCCACAGTCTt 3'
451 - 474 123.00 -16.50
2
miRNA  3' guuuGUGGUAA--C-AG--UGUG-AGGu 5'
              |||: ||  | ||  |||| ||| 
Target 5' attcCACTCTTCGGCTCTGACACGTCCc 3'
333 - 360 118.00 -11.40
3
miRNA  3' guUUG-UGGUAACAGUGUGAGGu 5'
            |:| |||:| | ||| :||| 
Target 5' ccAGCAACCGTAG-CACCTTCCa 3'
656 - 677 115.00 -16.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31480995 5 COSMIC
COSN30192131 73 COSMIC
COSN20111949 77 COSMIC
COSN26581263 90 COSMIC
COSN26440686 150 COSMIC
COSN16391895 251 COSMIC
COSN27211154 253 COSMIC
COSN27313979 276 COSMIC
COSN29813958 305 COSMIC
COSN31552264 535 COSMIC
COSN30538691 652 COSMIC
COSN31541289 664 COSMIC
COSN31533983 690 COSMIC
COSN28792418 734 COSMIC
COSN31577583 744 COSMIC
COSN17038329 965 COSMIC
COSN26574580 1033 COSMIC
COSN8743982 1072 COSMIC
COSN30028856 1139 COSMIC
COSN31548900 1141 COSMIC
COSN31550966 1148 COSMIC
COSN30175106 1274 COSMIC
rs9796 974 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs977751965 3 dbSNP
rs1477821736 5 dbSNP
rs764667696 6 dbSNP
rs183778624 10 dbSNP
rs1484912056 11 dbSNP
rs1278324645 12 dbSNP
rs775664082 13 dbSNP
rs772091533 14 dbSNP
rs746058502 15 dbSNP
rs375192260 16 dbSNP
rs200587640 27 dbSNP
rs749091379 28 dbSNP
rs777501578 33 dbSNP
rs372166913 34 dbSNP
rs368322933 40 dbSNP
rs998339802 41 dbSNP
rs1385907058 45 dbSNP
rs1416168866 46 dbSNP
rs1394254713 49 dbSNP
rs780725689 50 dbSNP
rs754606380 51 dbSNP
rs965309690 52 dbSNP
rs1015599382 54 dbSNP
rs1004248708 58 dbSNP
rs779106924 59 dbSNP
rs1284774249 63 dbSNP
rs1402607362 66 dbSNP
rs946451509 74 dbSNP
rs888506262 75 dbSNP
rs1048963018 78 dbSNP
rs759691448 79 dbSNP
rs1203896062 80 dbSNP
rs1263176027 80 dbSNP
rs398026985 81 dbSNP
rs557135828 81 dbSNP
rs66470529 81 dbSNP
rs1479120533 82 dbSNP
rs200129129 84 dbSNP
rs1054787549 86 dbSNP
rs1362217006 87 dbSNP
rs1160104620 90 dbSNP
rs1364155360 96 dbSNP
rs937701426 97 dbSNP
rs1455205692 102 dbSNP
rs1156719413 103 dbSNP
rs543212712 104 dbSNP
rs1359866218 105 dbSNP
rs894648468 109 dbSNP
rs1304381879 111 dbSNP
rs575697140 114 dbSNP
rs1057329330 116 dbSNP
rs927886014 122 dbSNP
rs1319095946 123 dbSNP
rs558626447 139 dbSNP
rs924905842 141 dbSNP
rs1162273982 142 dbSNP
rs538690562 143 dbSNP
rs1225380834 150 dbSNP
rs1266775815 152 dbSNP
rs982456808 155 dbSNP
rs1177984453 156 dbSNP
rs929125533 157 dbSNP
rs1252984575 160 dbSNP
rs919101639 163 dbSNP
rs1156572190 170 dbSNP
rs972755358 173 dbSNP
rs989647842 175 dbSNP
rs1165399904 178 dbSNP
rs962768291 183 dbSNP
rs1457025193 184 dbSNP
rs1202487506 187 dbSNP
rs1348994142 190 dbSNP
rs953847157 192 dbSNP
rs376198405 193 dbSNP
rs985457871 194 dbSNP
rs1383990072 196 dbSNP
rs878929674 198 dbSNP
rs1248794100 199 dbSNP
rs1240453434 203 dbSNP
rs954201905 205 dbSNP
rs553282424 208 dbSNP
rs1378448367 211 dbSNP
rs536972433 213 dbSNP
rs1321173153 220 dbSNP
rs1447190476 221 dbSNP
rs147064138 225 dbSNP
rs965279002 226 dbSNP
rs998849618 229 dbSNP
rs1341050776 231 dbSNP
rs1015529178 235 dbSNP
rs551160911 236 dbSNP
rs141637444 240 dbSNP
rs771472661 243 dbSNP
rs1445087466 249 dbSNP
rs1398669262 251 dbSNP
rs571366538 253 dbSNP
rs551491681 254 dbSNP
rs1170489215 262 dbSNP
rs1355783002 263 dbSNP
rs1158220042 269 dbSNP
rs1460091182 271 dbSNP
rs1330334750 272 dbSNP
rs528125662 276 dbSNP
rs749700981 279 dbSNP
rs1055308302 282 dbSNP
rs192434445 297 dbSNP
rs1379030769 300 dbSNP
rs1181889131 302 dbSNP
rs186709943 303 dbSNP
rs778057401 314 dbSNP
rs1213960101 325 dbSNP
rs529198351 325 dbSNP
rs906205293 327 dbSNP
rs1264056351 328 dbSNP
rs1003031482 329 dbSNP
rs1046276948 331 dbSNP
rs539904372 332 dbSNP
rs753009960 336 dbSNP
rs1472391174 337 dbSNP
rs919217648 339 dbSNP
rs1355495701 341 dbSNP
rs1288941194 342 dbSNP
rs945014341 344 dbSNP
rs781546231 345 dbSNP
rs568846351 349 dbSNP
rs577754687 353 dbSNP
rs909945198 355 dbSNP
rs1053478733 360 dbSNP
rs985960013 362 dbSNP
rs76495904 364 dbSNP
rs1030076482 373 dbSNP
rs976818146 374 dbSNP
rs921055402 380 dbSNP
rs1359940361 382 dbSNP
rs545078632 383 dbSNP
rs1218149774 395 dbSNP
rs150344174 397 dbSNP
rs1298621436 406 dbSNP
rs552963574 406 dbSNP
rs1021245569 412 dbSNP
rs1400825452 415 dbSNP
rs766024860 416 dbSNP
rs1162958506 417 dbSNP
rs908437000 419 dbSNP
rs1414655251 420 dbSNP
rs982710886 420 dbSNP
rs1011059879 423 dbSNP
rs952689611 425 dbSNP
rs866813263 426 dbSNP
rs1165486373 428 dbSNP
rs1192253985 436 dbSNP
rs535671209 437 dbSNP
rs1033407271 439 dbSNP
rs1002369551 443 dbSNP
rs1170453208 448 dbSNP
rs536211027 451 dbSNP
rs959036350 455 dbSNP
rs1046487718 468 dbSNP
rs1002972989 469 dbSNP
rs751570514 470 dbSNP
rs1303788886 473 dbSNP
rs1220411800 475 dbSNP
rs1020438694 483 dbSNP
rs1434570844 484 dbSNP
rs1274540335 488 dbSNP
rs552566557 490 dbSNP
rs1224168664 494 dbSNP
rs1286122795 500 dbSNP
rs993158948 503 dbSNP
rs758415868 505 dbSNP
rs1490717127 506 dbSNP
rs1196290180 507 dbSNP
rs1012221174 508 dbSNP
rs574276008 511 dbSNP
rs1179283098 514 dbSNP
rs183047130 515 dbSNP
rs1053853704 522 dbSNP
rs190095758 523 dbSNP
rs1403721969 527 dbSNP
rs1323102573 531 dbSNP
rs571853191 534 dbSNP
rs1040836953 535 dbSNP
rs943826707 536 dbSNP
rs1343448122 540 dbSNP
rs910391133 550 dbSNP
rs761287386 551 dbSNP
rs185631841 552 dbSNP
rs1292482701 554 dbSNP
rs1436090469 564 dbSNP
rs932725119 566 dbSNP
rs140410830 572 dbSNP
rs1325690522 582 dbSNP
rs1438000371 583 dbSNP
rs180781964 587 dbSNP
rs1423460342 588 dbSNP
rs1236723276 589 dbSNP
rs1172015615 604 dbSNP
rs966723389 605 dbSNP
rs991865952 615 dbSNP
rs958751559 619 dbSNP
rs914133559 620 dbSNP
rs1387674599 621 dbSNP
rs989744885 624 dbSNP
rs1472113609 634 dbSNP
rs1035707406 635 dbSNP
rs981478518 636 dbSNP
rs188261145 638 dbSNP
rs967458895 638 dbSNP
rs1190244877 640 dbSNP
rs1445839682 641 dbSNP
rs1315610439 642 dbSNP
rs151226229 643 dbSNP
rs958159054 650 dbSNP
rs528879425 654 dbSNP
rs1220069260 655 dbSNP
rs776068623 656 dbSNP
rs533192828 664 dbSNP
rs7175464 665 dbSNP
rs1441130166 668 dbSNP
rs1187466459 681 dbSNP
rs148612890 683 dbSNP
rs993107888 685 dbSNP
rs1168768951 696 dbSNP
rs1423233742 698 dbSNP
rs1029248098 700 dbSNP
rs7175438 703 dbSNP
rs1200482327 705 dbSNP
rs1321122691 707 dbSNP
rs762460839 709 dbSNP
rs1037545803 710 dbSNP
rs1333490010 713 dbSNP
rs1040764267 714 dbSNP
rs943751491 720 dbSNP
rs1006094802 722 dbSNP
rs760178880 724 dbSNP
rs1258064429 729 dbSNP
rs143650842 732 dbSNP
rs796262229 732 dbSNP
rs889076102 738 dbSNP
rs186168133 745 dbSNP
rs1399684771 750 dbSNP
rs1489295501 750 dbSNP
rs991434043 751 dbSNP
rs1332574110 752 dbSNP
rs573007362 753 dbSNP
rs553251827 755 dbSNP
rs928620781 759 dbSNP
rs1379153293 762 dbSNP
rs1175873831 763 dbSNP
rs1464396556 766 dbSNP
rs1171893202 770 dbSNP
rs1401788549 771 dbSNP
rs981445691 771 dbSNP
rs922659889 772 dbSNP
rs1295743896 773 dbSNP
rs967426038 779 dbSNP
rs1041167993 781 dbSNP
rs1438490647 783 dbSNP
rs1233037353 785 dbSNP
rs1238308458 785 dbSNP
rs1261714657 786 dbSNP
rs1356411989 790 dbSNP
rs1215106341 793 dbSNP
rs181962382 796 dbSNP
rs1183407572 798 dbSNP
rs1193109958 801 dbSNP
rs1200426634 805 dbSNP
rs913912770 809 dbSNP
rs896122872 810 dbSNP
rs989692912 810 dbSNP
rs1364175788 814 dbSNP
rs957580447 816 dbSNP
rs543052926 817 dbSNP
rs1029632532 820 dbSNP
rs1359334932 826 dbSNP
rs573940575 835 dbSNP
rs1294891327 839 dbSNP
rs1365006164 847 dbSNP
rs1313742569 848 dbSNP
rs1280946366 850 dbSNP
rs926931192 851 dbSNP
rs1379582317 852 dbSNP
rs796602818 857 dbSNP
rs966308958 857 dbSNP
rs1310126859 861 dbSNP
rs1449645410 865 dbSNP
rs1377701924 867 dbSNP
rs981336389 874 dbSNP
rs535015798 882 dbSNP
rs753643275 883 dbSNP
rs373011813 891 dbSNP
rs748816357 891 dbSNP
rs1379659751 895 dbSNP
rs993213704 896 dbSNP
rs543736173 897 dbSNP
rs961648909 899 dbSNP
rs556123253 900 dbSNP
rs537941840 901 dbSNP
rs796534459 902 dbSNP
rs1180036408 905 dbSNP
rs1457040182 907 dbSNP
rs1421559627 915 dbSNP
rs1402896230 918 dbSNP
rs1255301936 921 dbSNP
rs190666856 922 dbSNP
rs749876436 927 dbSNP
rs997733967 930 dbSNP
rs901690479 934 dbSNP
rs1041117789 941 dbSNP
rs1228411450 942 dbSNP
rs146410853 943 dbSNP
rs372622105 948 dbSNP
rs1196485434 949 dbSNP
rs1242330519 951 dbSNP
rs1053781888 955 dbSNP
rs1312574174 957 dbSNP
rs957717595 959 dbSNP
rs1381756194 960 dbSNP
rs922107305 961 dbSNP
rs1170926889 962 dbSNP
rs975358261 963 dbSNP
rs1463752909 965 dbSNP
rs1331028838 972 dbSNP
rs9796 974 dbSNP
rs12907665 980 dbSNP
rs1301664328 981 dbSNP
rs1378502112 982 dbSNP
rs549724265 988 dbSNP
rs533075637 989 dbSNP
rs1382887123 992 dbSNP
rs184977146 993 dbSNP
rs113083678 995 dbSNP
rs1455896375 1003 dbSNP
rs1218268429 1018 dbSNP
rs968837086 1023 dbSNP
rs1367403040 1024 dbSNP
rs1257119304 1025 dbSNP
rs547189872 1028 dbSNP
rs918086782 1029 dbSNP
rs995248279 1032 dbSNP
rs781028135 1033 dbSNP
rs1193690988 1035 dbSNP
rs961759458 1038 dbSNP
rs1260759472 1040 dbSNP
rs1015995951 1041 dbSNP
rs1169601875 1048 dbSNP
rs898279179 1053 dbSNP
rs755237376 1054 dbSNP
rs1192742181 1056 dbSNP
rs548325133 1064 dbSNP
rs953090968 1065 dbSNP
rs866357082 1066 dbSNP
rs74601039 1067 dbSNP
rs907088345 1075 dbSNP
rs1229903717 1076 dbSNP
rs1284237284 1078 dbSNP
rs1045639817 1079 dbSNP
rs997451902 1080 dbSNP
rs946023588 1083 dbSNP
rs192327784 1085 dbSNP
rs1324091872 1087 dbSNP
rs913220348 1088 dbSNP
rs1218336104 1089 dbSNP
rs1217248804 1092 dbSNP
rs1287532965 1095 dbSNP
rs1341552721 1095 dbSNP
rs1246966354 1096 dbSNP
rs542738626 1097 dbSNP
rs1010107478 1102 dbSNP
rs936100276 1102 dbSNP
rs1384764116 1106 dbSNP
rs1358690804 1111 dbSNP
rs922044793 1112 dbSNP
rs573828893 1115 dbSNP
rs892543850 1119 dbSNP
rs1324422022 1121 dbSNP
rs974874492 1124 dbSNP
rs944859343 1125 dbSNP
rs912126062 1127 dbSNP
rs1293675365 1135 dbSNP
rs775802633 1140 dbSNP
rs983689331 1140 dbSNP
rs1053898024 1144 dbSNP
rs1421318570 1145 dbSNP
rs1215211202 1147 dbSNP
rs779962250 1147 dbSNP
rs1452916494 1152 dbSNP
rs529314300 1153 dbSNP
rs951057258 1154 dbSNP
rs1218936409 1166 dbSNP
rs1246486494 1167 dbSNP
rs1441860332 1171 dbSNP
rs1440763038 1172 dbSNP
rs1181031774 1173 dbSNP
rs1439659762 1180 dbSNP
rs144066616 1183 dbSNP
rs1416053357 1188 dbSNP
rs1045683661 1192 dbSNP
rs949657032 1197 dbSNP
rs1323206602 1205 dbSNP
rs918201243 1206 dbSNP
rs1425571124 1209 dbSNP
rs555394048 1211 dbSNP
rs1447295548 1216 dbSNP
rs765180582 1217 dbSNP
rs1034515155 1218 dbSNP
rs1266750643 1218 dbSNP
rs529906325 1220 dbSNP
rs1210453702 1222 dbSNP
rs759829889 1222 dbSNP
rs1001298011 1233 dbSNP
rs1469884462 1233 dbSNP
rs907057326 1237 dbSNP
rs1236740726 1238 dbSNP
rs908941209 1243 dbSNP
rs1457656155 1249 dbSNP
rs1188928317 1252 dbSNP
rs1239270236 1255 dbSNP
rs984569453 1257 dbSNP
rs752899655 1261 dbSNP
rs765585479 1262 dbSNP
rs757144619 1265 dbSNP
rs542467022 1268 dbSNP
rs1467410164 1270 dbSNP
rs976193404 1271 dbSNP
rs1198594013 1272 dbSNP
rs1397864163 1274 dbSNP
rs1390735368 1275 dbSNP
rs1334827526 1276 dbSNP
rs1319006243 1280 dbSNP
rs1445232483 1281 dbSNP
rs1292155434 1292 dbSNP
rs1491415558 1297 dbSNP
rs891748556 1298 dbSNP
rs1330211124 1301 dbSNP
rs1054454241 1307 dbSNP
rs1201498467 1308 dbSNP
rs759888353 1308 dbSNP
rs1441217617 1314 dbSNP
rs900547257 1314 dbSNP
rs1397539018 1319 dbSNP
rs542275070 1320 dbSNP
rs1326064409 1321 dbSNP
rs188627851 1321 dbSNP
rs1421200142 1324 dbSNP
rs753925625 1329 dbSNP
rs1173065912 1333 dbSNP
rs1466114768 1337 dbSNP
rs1402192786 1339 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000361937.3 | 3UTR | AGGAGAAUGGCAUGAACCCGGGAGGCAGAGCUUGCAGUGAGCUGAGAUUGCGCCACUGCACUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*