miRTarBase - #MIRT678756 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ALG1   
Synonyms CDG1K, HMAT1, HMT-1, HMT1, MT-1, Mat-1, hMat-1
Description ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
Transcript NM_019109   
Expression
Putative miRNA Targets on ALG1
3'UTR of ALG1
(miRNA target sites are highlighted)
>ALG1|NM_019109|3'UTR
   1 CTCCTGGGCCAGAGGCTAAAACCCCAGGACCCCTGCTGTCCTTCCCGCAGCTTCTTCTTGGAGTCTCAGGGCAAACCCTT
  81 TCGAGCAGCACCTCCCAGTGGCCAGAAGCTGAAATGACAGCAGTGGTACTGCCTGGTAAAAGAATTGGTTCTGTGACCCG
 161 GGAAGCTTTGGTTGGCCTTGATTTCTTCTCTGGAGGCTTGGAAACGCTTCCTCTCTTCTTCTGTTCTTCACGCCCCATGC
 241 CCCTGCTAGCGTATTACTGTTCTGTGACTTCCCTGTGACCTCTGCAGAACTCCTCATCCTGCGTTTGGTCTCCAGGTGTC
 321 CCCTTTCTGCCGTGTTCCTAACATTTTGATTCCTGTCTTGAAAAAAGCACCTGCTGCACCGTAAGCCCAGGGATGTGGCA
 401 GCTGCAGTGGGCTTGGCTTTGTGAGGAACTGAGTGTGTCCACGTTGGGGGAACATCATACTTGATACACACGTTTTTATT
 481 TGCACAAAGAAAATGCTATTTTTGGAGCCAGAATTTTCATGTCTGATTTATGGTGATTTTCTTAAGAACCAGAACTGCTG
 561 GCAGAAAGGGGGCACCCACACGCTTAGATAGCCGATGTCTTATTAGAGGGCAGTTTGTGGTTCCTGATTTGGAAATTAAC
 641 ATTCTCCAAACATTCCAGTCCAATGAAAGTTTTATCCGCTTTCCCATATAAAAATTCTTCCCATGAGAGTGACTTGATTC
 721 TCACAATCCCGTTGGAGTCGTGTGTGAGTCCTACAGGGTGAGATTCAGCATTGCCATCTCCAAGTGCTCTTCGTAGGGAA
 801 ACAGTTTCTGCTCATGACGAGGTTCCACTTCCCATCTGATCCCGGCCCGGCCTGGAAACAGAGCACATGTGTTTGAGGAT
 881 GGCGGTGTTTGGGGACAGGACATGAGGGTATTGTGTGGGGCTGCTAGGACAGGCCTGGCGGGGTAGGGGGGTGTCCAAGT
 961 CAGTTTACTTGGTTCACAGGTTCCCAGGCCCACCCAGGTGCCTAGAATTGGCCTCCAGGATGGGACCAGAAAGCTGGTTT
1041 TGCATAGAAATGGCTAGCAGCAGGCACCGTGCCGCTGTCCACTCTCTGCCTGTGTCTGCCCCAGCACTTGGCACAGCGGG
1121 ACAGAAGCAGAGATCTGAATAGTCAACCCACTCTTCACAAAGCTTAGAAAGCGGCCGGGCACAGTGGCTCATGCCTGTAA
1201 TCCCAACACTTTGGGAGGCCAAGGCGGGCGGATCACTTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAAT
1281 CCCATCTCTACAAAAATACAGAAATTAGCCAGGCATGATGGCGAGTGCCTGTAATCCCAGCTACTTGGGAGGCTGAGGTG
1361 GGAGAATTGCTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCTGAGATTGTGCCACTGCACTCCAGCCTGAGTGACAGGGT
1441 GAGACTAAGTCTCAAAAAAAAAAAAAAAAAACCACACGCACCACACACACACCCACACACACACACAGCTTAGAAGGGGC
1521 TGCTGTTCTCATAAGCACAGATGTCTGAAGAGCCGTTAGCCAGAATGATTCTTTTTTTTTGTTTTGAGATATGATCTTGT
1601 TCTGTCACCCAGGCTGGAGTGCAGTGGCACAGTCATTGCTCACTACAGCCTCGACTCCTGGGCTCTAGCAATCCTCCCAC
1681 TTCCTGAGTAGCTGGGATGACAGGTGCGTGCCACCATGCCAGTAATTTTTTTATTTTGTAGAGATGGGGTCCTGAACGCA
1761 TGGCCTCAAGTGATGCTCCTGCCTCAGCCTCTTTTATTATTTGTTTTTAGACGAAGTTTTACTCTGTTCCCCAGGCTGGA
1841 GTGCAGTGGCACAATCTCAGCTCACTGCAACGCCTCCCAGGTTCAAGTGATTCTCCTGCCTCAGTCTCCCGAGTAGCTTT
1921 GACTATAGGCGTGCACCACCACGCCTGGCTAATTTTTGTGTTTTTAGTAGAGATGGGGTTTCACCATGTGGGCCAGGCTG
2001 GTCTTGAACTCGACCTCCCGTGATCTGCTCACCTCAGCCTCCCAAAGCCTCAGCCTCTTACAGTGTTGGGATTACAGGCG
2081 TGAGACACTGTGACCCGGGACGATTTTCAATCACAGTTTTTTGTTACGAGTGGAAAATGCGTATTTATAAGAATGAAGTA
2161 GTACAGACATGAATGTGTAGAAATCTCTATAATCCTGCCATCCAAGGATGGCACCTGTTAATGTGTATATCAGGGATGTC
2241 CAATCTTTTGGCCTCCCTGTGCCACACTGGAAGAAGAAGAATCGCCTTGGGCCACGCATAAAATACACTAACACTAGCAA
2321 TACCTGATGAGCTAAAAGAAAAAAAATCACAAAAAAACCTCGTACTGTTTGAAGAAAGTTTACAGATTTGCGTTGGGCCG
2401 CAAGTTGGACAAGACTGCTATATGTATATTCTAGGTTTTCCCCTATAGGTATACTTATGTGAAAATGATTATTGTGATAA
2481 ATTTTGTTTTGAGATGAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG---UGUGAGGu 5'
            | :| |||| ||   |||:||| 
Target 5' aaATTAACATTCTCCAAACATTCCa 3'
633 - 657 144.00 -14.10
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :|| : ||| ||||| ||| 
Target 5' gtGACTTGATTCTCACAATCCc 3'
709 - 730 136.00 -9.70
3
miRNA  3' guuuguggUAACA-----GUGUGAGGu 5'
                  |||||     ::|||||| 
Target 5' gagctgagATTGTGCCACTGCACTCCa 3'
1398 - 1424 134.00 -13.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
166670 17 ClinVar
1189650 29 ClinVar
1197920 276 ClinVar
1032824 788 ClinVar
COSN26648037 6 COSMIC
COSN30191750 7 COSMIC
COSN26567633 27 COSMIC
COSN13675432 30 COSMIC
COSN506877 67 COSMIC
COSN30492330 72 COSMIC
COSN30512952 97 COSMIC
COSN13675436 101 COSMIC
COSN30157474 146 COSMIC
COSN30539958 234 COSMIC
COSN31597476 443 COSMIC
COSN26417239 486 COSMIC
COSN26417240 488 COSMIC
COSN23014963 499 COSMIC
COSN31580722 514 COSMIC
COSN26419219 573 COSMIC
COSN20929981 590 COSMIC
COSN31558000 595 COSMIC
COSN30475893 674 COSMIC
COSN30532320 677 COSMIC
COSN31538577 679 COSMIC
COSN31602129 692 COSMIC
COSN31604645 694 COSMIC
COSN26568615 705 COSMIC
COSN30146223 723 COSMIC
COSN30530848 726 COSMIC
COSN13675501 732 COSMIC
COSM7897300 757 COSMIC
COSM6281539 764 COSMIC
COSM3510204 767 COSMIC
COSM6263082 769 COSMIC
COSM7325678 769 COSMIC
COSM9059677 769 COSMIC
COSM2834699 771 COSMIC
COSM9038470 774 COSMIC
COSM5363578 778 COSMIC
COSM1378287 802 COSMIC
COSM3402353 803 COSMIC
COSM6281036 812 COSMIC
COSM5556503 816 COSMIC
COSM2834700 819 COSMIC
COSM971367 820 COSMIC
COSM4260580 844 COSMIC
COSM1708720 846 COSMIC
COSM4442014 849 COSMIC
COSM1206471 850 COSMIC
COSN2533558 946 COSMIC
COSN31995173 977 COSMIC
COSN2533559 978 COSMIC
COSN9647617 1238 COSMIC
COSN23864437 1496 COSMIC
COSN16467621 1577 COSMIC
COSN16468379 1586 COSMIC
COSN19332347 1720 COSMIC
COSN32150287 1864 COSMIC
COSN27122856 2022 COSMIC
COSN22057150 2052 COSMIC
COSN17898909 2069 COSMIC
COSN8501242 2096 COSMIC
COSN32058004 2188 COSMIC
COSN17829201 2247 COSMIC
COSN20093074 2297 COSMIC
COSN21468743 2489 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767436067 6 dbSNP
rs562910605 7 dbSNP
rs1333354175 10 dbSNP
rs752581537 12 dbSNP
rs755611942 13 dbSNP
rs1305255176 14 dbSNP
rs1326207438 15 dbSNP
rs747294081 16 dbSNP
rs59332251 17 dbSNP
rs148531077 18 dbSNP
rs777172549 19 dbSNP
rs112038320 20 dbSNP
rs1280975109 23 dbSNP
rs756870641 24 dbSNP
rs778601761 25 dbSNP
rs746218285 26 dbSNP
rs699145 27 dbSNP
rs1362143066 28 dbSNP
rs28609548 29 dbSNP
rs201598025 30 dbSNP
rs747498468 31 dbSNP
rs199520539 33 dbSNP
rs776544754 41 dbSNP
rs1444263114 44 dbSNP
rs762053544 46 dbSNP
rs1185302393 47 dbSNP
rs377518319 47 dbSNP
rs1047690 48 dbSNP
rs767248517 49 dbSNP
rs753650595 51 dbSNP
rs752633027 52 dbSNP
rs57377039 54 dbSNP
rs701110 60 dbSNP
rs1047682 61 dbSNP
rs1047680 66 dbSNP
rs17137607 71 dbSNP
rs1047674 77 dbSNP
rs1012935027 82 dbSNP
rs1047670 83 dbSNP
rs1336721795 84 dbSNP
rs709261 91 dbSNP
rs971911419 98 dbSNP
rs750185113 101 dbSNP
rs1047658 119 dbSNP
rs1047655 120 dbSNP
rs1485917504 123 dbSNP
rs1047653 126 dbSNP
rs709260 129 dbSNP
rs1397867110 130 dbSNP
rs709259 131 dbSNP
rs1047645 132 dbSNP
rs1382954002 135 dbSNP
rs709258 139 dbSNP
rs1393879464 140 dbSNP
rs709257 142 dbSNP
rs1455959430 143 dbSNP
rs1174714635 152 dbSNP
rs957568943 160 dbSNP
rs1380106704 163 dbSNP
rs990240413 165 dbSNP
rs910823463 166 dbSNP
rs527512215 168 dbSNP
rs1047639 169 dbSNP
rs1444768260 178 dbSNP
rs1063200 179 dbSNP
rs1399267026 181 dbSNP
rs943596760 189 dbSNP
rs1320546010 190 dbSNP
rs1047744 197 dbSNP
rs975079270 206 dbSNP
rs1231882521 207 dbSNP
rs1345938894 209 dbSNP
rs1294153199 213 dbSNP
rs368205784 214 dbSNP
rs1323954730 216 dbSNP
rs1368759470 224 dbSNP
rs547607392 230 dbSNP
rs1323568673 232 dbSNP
rs1460740194 233 dbSNP
rs933776146 234 dbSNP
rs1164633620 240 dbSNP
rs1474245819 249 dbSNP
rs567329568 251 dbSNP
rs1371978396 263 dbSNP
rs1193313418 270 dbSNP
rs55848638 276 dbSNP
rs908247968 290 dbSNP
rs1212153386 303 dbSNP
rs145044749 308 dbSNP
rs1468313505 313 dbSNP
rs941220621 317 dbSNP
rs1221801058 324 dbSNP
rs1337718249 332 dbSNP
rs1269629666 333 dbSNP
rs1228251189 338 dbSNP
rs1367198803 361 dbSNP
rs1285923992 363 dbSNP
rs1301140711 372 dbSNP
rs549652869 377 dbSNP
rs1447216167 378 dbSNP
rs569317828 381 dbSNP
rs1220268196 382 dbSNP
rs1038180261 385 dbSNP
rs149110534 387 dbSNP
rs1167927196 388 dbSNP
rs1450811219 392 dbSNP
rs1392786556 403 dbSNP
rs1192269516 406 dbSNP
rs558389580 408 dbSNP
rs1012821076 409 dbSNP
rs1224275018 412 dbSNP
rs1469384542 412 dbSNP
rs1436225170 415 dbSNP
rs1045801011 419 dbSNP
rs1196658381 433 dbSNP
rs1344400527 435 dbSNP
rs1194822498 438 dbSNP
rs1238038463 440 dbSNP
rs907193961 441 dbSNP
rs1468925392 443 dbSNP
rs760391565 445 dbSNP
rs1160650359 446 dbSNP
rs867352336 451 dbSNP
rs999228998 452 dbSNP
rs1371671190 453 dbSNP
rs1409060869 464 dbSNP
rs1276356262 470 dbSNP
rs867547136 471 dbSNP
rs1031759797 472 dbSNP
rs1162927859 473 dbSNP
rs1396824827 479 dbSNP
rs1441668299 486 dbSNP
rs1326515668 488 dbSNP
rs1011715831 489 dbSNP
rs1434596508 490 dbSNP
rs1335028747 497 dbSNP
rs6775 499 dbSNP
rs534404562 500 dbSNP
rs1468909896 511 dbSNP
rs1232730546 512 dbSNP
rs531718461 513 dbSNP
rs1281061561 518 dbSNP
rs1017716654 519 dbSNP
rs554392935 520 dbSNP
rs1278224544 522 dbSNP
rs1210299070 526 dbSNP
rs1047576 537 dbSNP
rs1047573 543 dbSNP
rs976303888 547 dbSNP
rs1280671573 549 dbSNP
rs1270824659 551 dbSNP
rs1349683369 556 dbSNP
rs1279969935 568 dbSNP
rs1047566 572 dbSNP
rs1336317557 578 dbSNP
rs574276334 581 dbSNP
rs16843033 582 dbSNP
rs543353647 583 dbSNP
rs1360447489 584 dbSNP
rs1178860988 587 dbSNP
rs1184482277 590 dbSNP
rs982829657 592 dbSNP
rs17137613 594 dbSNP
rs908298276 595 dbSNP
rs1047553 598 dbSNP
rs1187245015 599 dbSNP
rs576528783 601 dbSNP
rs1239356203 611 dbSNP
rs1213526584 614 dbSNP
rs1047549 615 dbSNP
rs1170058399 616 dbSNP
rs1395761235 617 dbSNP
rs1446378404 618 dbSNP
rs1047545 624 dbSNP
rs1230003406 627 dbSNP
rs1332138206 628 dbSNP
rs1038233002 633 dbSNP
rs1047543 636 dbSNP
rs1047538 641 dbSNP
rs1047536 643 dbSNP
rs1380667023 644 dbSNP
rs915743830 647 dbSNP
rs1408123206 656 dbSNP
rs1345152796 657 dbSNP
rs1047534 661 dbSNP
rs1321561426 666 dbSNP
rs9921840 667 dbSNP
rs1164478272 670 dbSNP
rs1045658111 672 dbSNP
rs907075710 674 dbSNP
rs1047523 676 dbSNP
rs565122912 678 dbSNP
rs1485463643 679 dbSNP
rs1053501736 684 dbSNP
rs1210576669 686 dbSNP
rs752852537 687 dbSNP
rs1466965729 688 dbSNP
rs1047514 689 dbSNP
rs893250822 691 dbSNP
rs1047505 696 dbSNP
rs527816882 697 dbSNP
rs760509902 701 dbSNP
rs764130039 704 dbSNP
rs1047502 705 dbSNP
rs1316086165 706 dbSNP
rs1362121954 707 dbSNP
rs758640759 711 dbSNP
rs778478979 712 dbSNP
rs1047498 714 dbSNP
rs997598228 715 dbSNP
rs750076157 717 dbSNP
rs1340724094 718 dbSNP
rs1213484792 720 dbSNP
rs541160794 725 dbSNP
rs780301989 726 dbSNP
rs951003072 727 dbSNP
rs747447071 730 dbSNP
rs561174573 731 dbSNP
rs769041738 732 dbSNP
rs761523989 734 dbSNP
rs781779977 734 dbSNP
rs1351837020 736 dbSNP
rs748185623 738 dbSNP
rs529796262 739 dbSNP
rs376514038 740 dbSNP
rs186337138 741 dbSNP
rs371074454 744 dbSNP
rs1403270537 745 dbSNP
rs373657874 747 dbSNP
rs1190398962 748 dbSNP
rs1452558711 750 dbSNP
rs1337048855 752 dbSNP
rs1477653204 755 dbSNP
rs568457681 757 dbSNP
rs760584474 759 dbSNP
rs1295339143 761 dbSNP
rs552184574 763 dbSNP
rs769633492 764 dbSNP
rs776562609 765 dbSNP
rs973810353 772 dbSNP
rs140141371 775 dbSNP
rs190402165 776 dbSNP
rs1300934938 777 dbSNP
rs371589415 777 dbSNP
rs201345819 778 dbSNP
rs751858067 779 dbSNP
rs755384762 782 dbSNP
rs781737396 784 dbSNP
rs1371220174 787 dbSNP
rs142385356 788 dbSNP
rs867696905 793 dbSNP
rs756217732 794 dbSNP
rs1360487088 795 dbSNP
rs267604573 797 dbSNP
rs1451195477 798 dbSNP
rs1426019156 800 dbSNP
rs1288589384 802 dbSNP
rs1248238194 803 dbSNP
rs777980781 805 dbSNP
rs1483209115 806 dbSNP
rs1402386578 814 dbSNP
rs1301894696 815 dbSNP
rs151297040 819 dbSNP
rs771051209 820 dbSNP
rs772580812 823 dbSNP
rs774688938 823 dbSNP
rs1434912694 829 dbSNP
rs762532333 829 dbSNP
rs766190615 831 dbSNP
rs547938013 836 dbSNP
rs1238606278 837 dbSNP
rs1259923178 839 dbSNP
rs567864126 842 dbSNP
rs768441103 844 dbSNP
rs761761355 845 dbSNP
rs772676442 849 dbSNP
rs762583437 850 dbSNP
rs1426672190 853 dbSNP
rs1314275627 857 dbSNP
rs1416938172 859 dbSNP
rs751541341 860 dbSNP
rs759443326 860 dbSNP
rs1157998015 862 dbSNP
rs767269843 864 dbSNP
rs1364719150 865 dbSNP
rs765890148 866 dbSNP
rs1301719804 867 dbSNP
rs1409387603 867 dbSNP
rs536814642 868 dbSNP
rs1351370814 869 dbSNP
rs768020685 869 dbSNP
rs1309857615 872 dbSNP
rs368350974 872 dbSNP
rs756661216 879 dbSNP
rs752557770 881 dbSNP
rs778492820 883 dbSNP
rs749311788 884 dbSNP
rs757368497 885 dbSNP
rs778931362 886 dbSNP
rs1158138062 887 dbSNP
rs556914293 888 dbSNP
rs780942739 890 dbSNP
rs747976218 897 dbSNP
rs773216565 899 dbSNP
rs762304211 902 dbSNP
rs372527188 903 dbSNP
rs1485054603 909 dbSNP
rs1256295947 914 dbSNP
rs1201504266 916 dbSNP
rs900569422 920 dbSNP
rs1259290376 921 dbSNP
rs1228170768 932 dbSNP
rs576844844 936 dbSNP
rs997651522 940 dbSNP
rs1339917403 943 dbSNP
rs904528063 945 dbSNP
rs371821907 949 dbSNP
rs1000237447 953 dbSNP
rs538944992 970 dbSNP
rs886715765 977 dbSNP
rs1457558240 980 dbSNP
rs1216208061 983 dbSNP
rs9933366 989 dbSNP
rs1448813793 992 dbSNP
rs1193984157 993 dbSNP
rs962378218 1001 dbSNP
rs1189055711 1011 dbSNP
rs1373628910 1013 dbSNP
rs973695538 1014 dbSNP
rs1453700543 1017 dbSNP
rs1171567659 1020 dbSNP
rs1260277942 1026 dbSNP
rs1396694764 1037 dbSNP
rs1435049865 1039 dbSNP
rs1287937228 1046 dbSNP
rs1022739375 1048 dbSNP
rs969767356 1054 dbSNP
rs1382239211 1057 dbSNP
rs1324816972 1058 dbSNP
rs4483845 1066 dbSNP
rs1318392265 1068 dbSNP
rs1370974467 1069 dbSNP
rs928440795 1070 dbSNP
rs541521482 1074 dbSNP
rs4786593 1075 dbSNP
rs574313691 1077 dbSNP
rs1164430893 1080 dbSNP
rs1460014068 1082 dbSNP
rs989128586 1093 dbSNP
rs543177308 1097 dbSNP
rs4238853 1098 dbSNP
rs62036246 1103 dbSNP
rs947406796 1106 dbSNP
rs1250239535 1107 dbSNP
rs1192191901 1108 dbSNP
rs1353093451 1118 dbSNP
rs532464961 1119 dbSNP
rs552179410 1120 dbSNP
rs1337492641 1126 dbSNP
rs1038980625 1145 dbSNP
rs559311174 1149 dbSNP
rs1300899831 1150 dbSNP
rs1254749716 1151 dbSNP
rs1435516257 1152 dbSNP
rs376537060 1163 dbSNP
rs571206182 1174 dbSNP
rs1051976603 1177 dbSNP
rs886598702 1177 dbSNP
rs773075103 1178 dbSNP
rs1430914139 1181 dbSNP
rs760492544 1186 dbSNP
rs1171393820 1188 dbSNP
rs1361763236 1190 dbSNP
rs1477900711 1191 dbSNP
rs1455004630 1195 dbSNP
rs1201248715 1203 dbSNP
rs4786594 1204 dbSNP
rs1016529262 1208 dbSNP
rs1205962494 1213 dbSNP
rs1344153978 1217 dbSNP
rs1438023180 1221 dbSNP
rs1328517579 1226 dbSNP
rs568129805 1227 dbSNP
rs1345416534 1230 dbSNP
rs537130220 1231 dbSNP
rs1439510532 1238 dbSNP
rs1305276806 1247 dbSNP
rs1337794919 1253 dbSNP
rs1240067567 1258 dbSNP
rs1272727292 1261 dbSNP
rs1332785130 1266 dbSNP
rs899391905 1272 dbSNP
rs1414446298 1273 dbSNP
rs1426251072 1274 dbSNP
rs1174709056 1280 dbSNP
rs995185688 1282 dbSNP
rs1488759990 1293 dbSNP
rs1176457638 1298 dbSNP
rs1235847271 1300 dbSNP
rs1022626268 1302 dbSNP
rs186602069 1305 dbSNP
rs570262270 1310 dbSNP
rs191507482 1319 dbSNP
rs1327981651 1321 dbSNP
rs1288577881 1323 dbSNP
rs1229891464 1324 dbSNP
rs1283111560 1329 dbSNP
rs956077603 1344 dbSNP
rs558941209 1349 dbSNP
rs572405748 1354 dbSNP
rs183691393 1368 dbSNP
rs1160141262 1370 dbSNP
rs1166445274 1377 dbSNP
rs1411660916 1378 dbSNP
rs1181390495 1379 dbSNP
rs1473049463 1385 dbSNP
rs1239151102 1393 dbSNP
rs1206813360 1402 dbSNP
rs1464244892 1407 dbSNP
rs968591368 1408 dbSNP
rs1395912005 1410 dbSNP
rs1461891480 1412 dbSNP
rs111263245 1413 dbSNP
rs1399106456 1419 dbSNP
rs1311339049 1423 dbSNP
rs1228420067 1426 dbSNP
rs1392269670 1436 dbSNP
rs12922304 1439 dbSNP
rs1353793081 1446 dbSNP
rs1235279479 1447 dbSNP
rs1293962086 1450 dbSNP
rs1322300828 1451 dbSNP
rs1348388250 1452 dbSNP
rs921932816 1452 dbSNP
rs1164108793 1453 dbSNP
rs753027372 1453 dbSNP
rs773283628 1453 dbSNP
rs1186584039 1454 dbSNP
rs1190310660 1454 dbSNP
rs1221901895 1454 dbSNP
rs1248343374 1454 dbSNP
rs1385061094 1454 dbSNP
rs1416140338 1454 dbSNP
rs1448808842 1454 dbSNP
rs374671583 1454 dbSNP
rs556079793 1454 dbSNP
rs770971453 1454 dbSNP
rs1203773542 1455 dbSNP
rs1249500697 1456 dbSNP
rs1481503114 1458 dbSNP
rs1205599387 1459 dbSNP
rs1256434362 1461 dbSNP
rs1226759112 1464 dbSNP
rs1342077666 1467 dbSNP
rs1298741017 1471 dbSNP
rs1437750168 1471 dbSNP
rs1293124388 1472 dbSNP
rs1365988102 1472 dbSNP
rs1437534127 1473 dbSNP
rs1474006857 1473 dbSNP
rs1166802630 1474 dbSNP
rs1189491709 1478 dbSNP
rs1413924755 1479 dbSNP
rs1427357557 1480 dbSNP
rs1168968429 1481 dbSNP
rs371997547 1481 dbSNP
rs1431200595 1482 dbSNP
rs1266494269 1483 dbSNP
rs1191398129 1484 dbSNP
rs1356719434 1488 dbSNP
rs1248897345 1490 dbSNP
rs1203847384 1491 dbSNP
rs1462877237 1492 dbSNP
rs1275941737 1493 dbSNP
rs1219969980 1494 dbSNP
rs1230305973 1494 dbSNP
rs1423119234 1494 dbSNP
rs62036247 1495 dbSNP
rs1373928580 1496 dbSNP
rs543489333 1500 dbSNP
rs1313673263 1501 dbSNP
rs1464533634 1503 dbSNP
rs1361391939 1507 dbSNP
rs1212824913 1510 dbSNP
rs907913813 1513 dbSNP
rs1409336013 1517 dbSNP
rs1181070392 1518 dbSNP
rs189184478 1524 dbSNP
rs576923101 1526 dbSNP
rs1253424529 1529 dbSNP
rs1198017441 1531 dbSNP
rs147517741 1539 dbSNP
rs899445734 1545 dbSNP
rs1012487377 1552 dbSNP
rs140057443 1555 dbSNP
rs145467146 1556 dbSNP
rs1035852773 1560 dbSNP
rs955784751 1565 dbSNP
rs1394149487 1569 dbSNP
rs1401446534 1570 dbSNP
rs1303162479 1571 dbSNP
rs1010051984 1572 dbSNP
rs1467366954 1572 dbSNP
rs1485261650 1582 dbSNP
rs1184253345 1587 dbSNP
rs1422345442 1588 dbSNP
rs1021394106 1589 dbSNP
rs1413447183 1593 dbSNP
rs1184823375 1595 dbSNP
rs1422532620 1604 dbSNP
rs1173452256 1607 dbSNP
rs1393694215 1609 dbSNP
rs541882964 1613 dbSNP
rs974623191 1617 dbSNP
rs1266690902 1623 dbSNP
rs921817394 1633 dbSNP
rs1330088969 1636 dbSNP
rs1177077595 1638 dbSNP
rs954876475 1639 dbSNP
rs1242727257 1641 dbSNP
rs987466446 1642 dbSNP
rs907965300 1646 dbSNP
rs561648557 1651 dbSNP
rs940773673 1653 dbSNP
rs1319655824 1654 dbSNP
rs1457409995 1659 dbSNP
rs1428786189 1663 dbSNP
rs1290682134 1669 dbSNP
rs762197376 1672 dbSNP
rs920759998 1675 dbSNP
rs1456942929 1676 dbSNP
rs1302524029 1679 dbSNP
rs948320868 1681 dbSNP
rs1188841236 1694 dbSNP
rs1345484449 1696 dbSNP
rs1446990478 1698 dbSNP
rs1246502276 1705 dbSNP
rs1236149943 1707 dbSNP
rs1278965777 1708 dbSNP
rs1264093059 1709 dbSNP
rs530673146 1718 dbSNP
rs1355720409 1719 dbSNP
rs1213082025 1726 dbSNP
rs1287215992 1742 dbSNP
rs192902200 1744 dbSNP
rs1464916417 1753 dbSNP
rs1340014949 1754 dbSNP
rs1193591789 1756 dbSNP
rs1251603893 1758 dbSNP
rs1435520321 1759 dbSNP
rs1328023719 1761 dbSNP
rs1321173780 1762 dbSNP
rs1385929598 1764 dbSNP
rs1455864236 1766 dbSNP
rs768043876 1773 dbSNP
rs1056783434 1777 dbSNP
rs550689259 1786 dbSNP
rs891570428 1789 dbSNP
rs1161497320 1792 dbSNP
rs1168564542 1794 dbSNP
rs1389511721 1795 dbSNP
rs1009934538 1797 dbSNP
rs1021454465 1801 dbSNP
rs1268100340 1811 dbSNP
rs1224851471 1814 dbSNP
rs1482144886 1816 dbSNP
rs1229140425 1822 dbSNP
rs1341195146 1827 dbSNP
rs968526335 1830 dbSNP
rs1216296811 1832 dbSNP
rs1331359005 1837 dbSNP
rs1304378809 1839 dbSNP
rs1407429010 1847 dbSNP
rs1325156922 1849 dbSNP
rs1368681352 1853 dbSNP
rs995933287 1855 dbSNP
rs1422021198 1861 dbSNP
rs1029338602 1864 dbSNP
rs1477796784 1867 dbSNP
rs148718586 1872 dbSNP
rs532548218 1874 dbSNP
rs1201917722 1875 dbSNP
rs1372216640 1878 dbSNP
rs1471649601 1879 dbSNP
rs987900511 1884 dbSNP
rs1221736765 1888 dbSNP
rs552855261 1894 dbSNP
rs756466332 1899 dbSNP
rs1276194272 1906 dbSNP
rs1199685107 1912 dbSNP
rs1345509866 1924 dbSNP
rs566206719 1925 dbSNP
rs962471485 1929 dbSNP
rs780339828 1931 dbSNP
rs1288439411 1932 dbSNP
rs973480348 1934 dbSNP
rs1271887388 1936 dbSNP
rs1332829901 1937 dbSNP
rs1414234036 1938 dbSNP
rs754206446 1943 dbSNP
rs754587056 1944 dbSNP
rs920637284 1946 dbSNP
rs948207752 1959 dbSNP
rs535310777 1960 dbSNP
rs1471092428 1961 dbSNP
rs185462012 1966 dbSNP
rs778454649 1968 dbSNP
rs1057237126 1972 dbSNP
rs891459017 1973 dbSNP
rs1264834036 1978 dbSNP
rs1206369711 1995 dbSNP
rs8053862 1998 dbSNP
rs1474954907 2002 dbSNP
rs1224949235 2006 dbSNP
rs1162873725 2007 dbSNP
rs1282942330 2010 dbSNP
rs537157675 2012 dbSNP
rs1383914482 2013 dbSNP
rs904253077 2015 dbSNP
rs67282507 2018 dbSNP
rs879840915 2018 dbSNP
rs4786595 2019 dbSNP
rs4786596 2020 dbSNP
rs890396563 2021 dbSNP
rs1353738187 2026 dbSNP
rs1008806399 2028 dbSNP
rs1289847928 2029 dbSNP
rs1350711502 2034 dbSNP
rs1015376636 2043 dbSNP
rs1217590977 2048 dbSNP
rs1319394504 2051 dbSNP
rs1232217790 2054 dbSNP
rs962039953 2056 dbSNP
rs376075925 2061 dbSNP
rs1433315941 2062 dbSNP
rs553727202 2064 dbSNP
rs1348137138 2068 dbSNP
rs1322976381 2070 dbSNP
rs151245123 2081 dbSNP
rs1386993339 2082 dbSNP
rs1210995699 2084 dbSNP
rs1272843561 2085 dbSNP
rs1166688118 2086 dbSNP
rs1436446274 2089 dbSNP
rs1055694 2096 dbSNP
rs981378553 2097 dbSNP
rs1252897046 2098 dbSNP
rs1055695 2102 dbSNP
rs928148613 2103 dbSNP
rs1420141280 2104 dbSNP
rs1490710991 2105 dbSNP
rs1473143584 2109 dbSNP
rs553118679 2111 dbSNP
rs988415445 2116 dbSNP
rs914106606 2117 dbSNP
rs1408054582 2121 dbSNP
rs758956374 2128 dbSNP
rs1292960949 2131 dbSNP
rs1405602348 2133 dbSNP
rs945729857 2137 dbSNP
rs1055697 2141 dbSNP
rs1310659269 2142 dbSNP
rs1172310437 2148 dbSNP
rs904304111 2149 dbSNP
rs34983839 2151 dbSNP
rs1055698 2152 dbSNP
rs1424004908 2155 dbSNP
rs879019213 2157 dbSNP
rs1199744094 2158 dbSNP
rs1244809560 2162 dbSNP
rs542144469 2164 dbSNP
rs561709204 2165 dbSNP
rs1338014710 2167 dbSNP
rs1252207312 2170 dbSNP
rs1310856985 2173 dbSNP
rs530474524 2176 dbSNP
rs1231127109 2187 dbSNP
rs12928220 2188 dbSNP
rs1347413024 2190 dbSNP
rs1390710949 2192 dbSNP
rs1485521061 2200 dbSNP
rs1299867330 2203 dbSNP
rs1464327631 2204 dbSNP
rs1358428979 2205 dbSNP
rs1176690934 2217 dbSNP
rs188982737 2219 dbSNP
rs890291285 2221 dbSNP
rs1409038764 2223 dbSNP
rs774484220 2228 dbSNP
rs1009106363 2230 dbSNP
rs191500789 2232 dbSNP
rs897714916 2236 dbSNP
rs559111766 2245 dbSNP
rs1482475284 2247 dbSNP
rs1262931617 2248 dbSNP
rs1474365405 2253 dbSNP
rs1027646794 2256 dbSNP
rs1325964054 2258 dbSNP
rs1266264728 2259 dbSNP
rs1238396929 2267 dbSNP
rs1336472191 2268 dbSNP
rs56113154 2270 dbSNP
rs796209012 2270 dbSNP
rs1381696957 2277 dbSNP
rs566241465 2280 dbSNP
rs1337149159 2281 dbSNP
rs759716928 2282 dbSNP
rs764148098 2282 dbSNP
rs753643321 2283 dbSNP
rs1171381150 2284 dbSNP
rs757118560 2284 dbSNP
rs528805350 2285 dbSNP
rs1396175191 2286 dbSNP
rs1316981280 2290 dbSNP
rs1161845798 2292 dbSNP
rs184070653 2296 dbSNP
rs1035477517 2297 dbSNP
rs960913766 2299 dbSNP
rs750529902 2307 dbSNP
rs1437931693 2311 dbSNP
rs561991538 2315 dbSNP
rs988687193 2319 dbSNP
rs76671550 2338 dbSNP
rs1247868376 2339 dbSNP
rs1358676448 2339 dbSNP
rs968252505 2339 dbSNP
rs978426576 2339 dbSNP
rs1317183417 2342 dbSNP
rs925612538 2347 dbSNP
rs1386411888 2348 dbSNP
rs1291321812 2355 dbSNP
rs1345968226 2358 dbSNP
rs770254212 2358 dbSNP
rs931762456 2359 dbSNP
rs7197406 2362 dbSNP
rs911595577 2363 dbSNP
rs188021034 2367 dbSNP
rs1192668991 2373 dbSNP
rs12185203 2375 dbSNP
rs897777111 2382 dbSNP
rs1347086879 2384 dbSNP
rs1190441513 2388 dbSNP
rs1248508991 2391 dbSNP
rs146732584 2392 dbSNP
rs1049132127 2393 dbSNP
rs905198755 2394 dbSNP
rs1002582119 2398 dbSNP
rs1466213015 2400 dbSNP
rs4786597 2404 dbSNP
rs539902045 2406 dbSNP
rs1403767623 2412 dbSNP
rs564459355 2421 dbSNP
rs1458296506 2422 dbSNP
rs1321821724 2423 dbSNP
rs1427124894 2425 dbSNP
rs1394700831 2430 dbSNP
rs7197573 2432 dbSNP
rs1374977938 2434 dbSNP
rs1021065389 2436 dbSNP
rs968304446 2438 dbSNP
rs1303816233 2439 dbSNP
rs1269716258 2443 dbSNP
rs979651073 2446 dbSNP
rs1482052879 2454 dbSNP
rs145354851 2459 dbSNP
rs1331945872 2466 dbSNP
rs1238646297 2469 dbSNP
rs1341261030 2471 dbSNP
rs1259120854 2473 dbSNP
rs1222588620 2477 dbSNP
rs114604596 2492 dbSNP
rs575331668 2494 dbSNP
rs1284648064 2499 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084042. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep2 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuguggUAACAGUGUGAGGu 5'
                  |||||  |||| | 
Target 5' gagcugagAUUGUGCCACUGCa 3'
19 - 40
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084042
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep2
Location of target site ENST00000262374.5 | 3UTR | GGAGGUGGAGGUUGCAGUGAGCUGAGAUUGUGCCACUGCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.815 6.2e-7 0.846 9.6e-8 24 Click to see details
GSE19350 CNS germ cell tumors -0.63 1.4e-2 -0.343 1.4e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.428 1.6e-2 0.376 3.2e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.393 3.2e-2 -0.621 7.8e-4 23 Click to see details
GSE21849 B cell lymphoma 0.251 9.5e-2 0.308 5.2e-2 29 Click to see details
GSE26953 Aortic valvular endothelial cells -0.252 1.2e-1 -0.304 7.4e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.226 1.4e-1 -0.189 1.8e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.137 1.4e-1 -0.141 1.3e-1 64 Click to see details
GSE27834 Pluripotent stem cells 0.236 1.9e-1 0.324 1.1e-1 16 Click to see details
GSE38226 Liver fibrosis 0.146 2.6e-1 0.155 2.5e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.276 3.0e-1 0.143 3.9e-1 6 Click to see details
GSE14794 Lymphoblastoid cells 0.051 3.2e-1 0.146 8.5e-2 90 Click to see details
GSE28260 Renal cortex and medulla 0.095 3.8e-1 0.159 3.0e-1 13 Click to see details
GSE17306 Multiple myeloma 0.039 4.0e-1 0.033 4.1e-1 49 Click to see details
GSE32688 Pancreatic cancer -0.031 4.3e-1 -0.146 2.1e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.039 4.4e-1 0.317 8.7e-2 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.836 0 0.762 0.01 8 Click to see details
LIHC 0.215 0.07 0.097 0.25 49 Click to see details
KIRP -0.433 0.12 -0.617 0.04 9 Click to see details
ESCA 0.544 0.17 0.600 0.14 5 Click to see details
HNSC -0.842 0.18 -0.500 0.33 3 Click to see details
CHOL 0.274 0.24 0.333 0.19 9 Click to see details
THCA 0.364 0.27 0.500 0.2 5 Click to see details
KICH 0.204 0.31 0.214 0.31 8 Click to see details
KIRC -0.071 0.36 0.024 0.45 29 Click to see details
KIRC -0.071 0.36 0.024 0.45 29 Click to see details
KIRC -0.071 0.36 0.024 0.45 29 Click to see details
KIRC -0.071 0.36 0.024 0.45 29 Click to see details
KIRC -0.071 0.36 0.024 0.45 29 Click to see details
KIRC -0.071 0.36 0.024 0.45 29 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*