miRTarBase - #MIRT680344 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF281   
Synonyms ZBP-99, ZNP-99
Description zinc finger protein 281
Transcript NM_012482   
Expression
Putative miRNA Targets on ZNF281
3'UTR of ZNF281
(miRNA target sites are highlighted)
>ZNF281|NM_012482|3'UTR
   1 GGTCCCAAAAGTGGCCAGGCTGGAGGTCTTCTAATGTAATTTTGTTTTATTTTGAGAACACTGCCATTGGAATGTTTCTA
  81 CACGATCCTATTAAGAATAATGTGATGCCCTTTCAATGCAACTTTTCATATTTAGTTTATTTTGTTAGCGTGATTTTAGC
 161 TCTGTTTGTATTATGATTTTTAATCAAAATCAATAGATTAAAAATAGTTTGACATTCAAAGTGACAATGTTTAGCAATCA
 241 AATTTACATGTATAGATCGTCAGGGAATAGCCCAAATGTTTTAAACGCAAAAAAAAAGACAAAAAAAAACCAAAAAAAAA
 321 AAACCTACAAAAAAAACTTTGTTGCTAGGATTAAGGTTATTCTAATTGCTTTACTCTCAGGAAAGTGTAATAACGCATGG
 401 GAATTCTGTACGTTATCACTGTAATGGAATATCCAATTTACAGATAGTATGATATACATTTCATCATTTAAGTAAGGGAT
 481 CGAAAACATTTCAAATTGCTCTATCTGGGCTGATAGACATTTCGTCATTTAAGTAAGGGATCGAAGACATTTCAAATTGC
 561 TATCTCCATCTGGGCTGATCCAAAATTCTGAGATTGTTGGCTACCTATATTTTGTTGCAGCTTTTAAATGTACTCTGAAC
 641 TTCCAAACCACATTCATTCCAGCCTGGTAGAACAAATATTCTTGGATCTTTGATCAAAGCCTGGAATGATAGCTTTAATA
 721 AAAGAAGGAAAAAAAAAAAGCACCCTCTCTTGATCTCAACTGTAACAAGGCTGTAATTCCATCAAGCGATTCTACTGACA
 801 TCTAGTACAGTGTTGAAGCCCAAGTGGTTGGCTGGTTCCAGTATTAGAACTCAAGTTGAAATTATATGATTAACTGAAAT
 881 TTGGGGCATGCATTATTTATTATACATGGCCTACAACGGTTCTGTCTGCGCTGTTACGTATTACCTACACTTCTGGGTTT
 961 TTTTGTTCTTGTTCTCAGCCTCTCTTTAAGAGTTCTTGGGCCTTCCTTTTCCCTCTTTCTATTTTAACAGTTTTAATTTT
1041 AGAACCATTTACATTCCAGTAGGTAATTCACTATGCGCTTTATATGCCTTAGGGCATCCAAATAAAAAACAATAGGGTAA
1121 ACATCCCCAAAACCCACCTTTAAAAAAAAAAAAACCCATACAGATTTCCATATGTAATAAAACCCCGTGTTCTTGGATAG
1201 ATATTAATAAGGTTGTAATTCCAACTGGTGACATAACTCCTGTGAGGGATAAGAATGTGTCTGCTTATAGTAATAACATC
1281 AGAACCTCTTTGTGAAATTGCGGCCTTTAATGTACATTTTAATGAAAGGGTGCATTAGTATTGTACAGGGGTCTTGTAAA
1361 GTCATCAAAACTTGCTATGAACTCTAATTGCCATTTGAAGCTACTGATTGGCAGTGGCTCTACTCTAAAACTGCTTTTTA
1441 GCAATTGTATTTTTTTCCTGATTATATTTTTTAATGTACTTTGATGTTTATGCTGATGAGTTTTTTATGTACTTTTGGTG
1521 ATGTTTCAGTCTTATGTACTCTTCTGACGTCAGAAAAGTACCACTGGTTGTTTGCAGTCTTATTGTGTAATCAGCCTACC
1601 GCAGGCTTCCATGTATAATAAAGTAATTAATATTGTGCAAGTGTAAAACACTTCTGTTATAAAAGCAGTGTTTGGAAAAT
1681 AAGAAATATTAAAAATGGTTACAAAGTATTAGTTAATTTCCTTTTCCCACTTTCCTCCCTTTAGCTTTAGCAGCTAAAGG
1761 GTCACCAACTTGTCATTGCAAGATTCTTAGAAAATGTACTTAATCTTAAATACGCTGAGTACTAAAAAGTGTTTATTTCT
1841 TATTTCAGTAAGTGCGGTAAGTTCTATTGAGTACAGAGTACAAGCTGTAATCAAAGGATGGAGAGGACCTTTACCACTGT
1921 ATCTCTTAAGCTGTATGATTTTTCTCCAGTTTGTTTTATACAGGTTTTGAATTTCTTTAACTTTTATTGTGTGTACTGAA
2001 TACTGCATATGTATTATTCTGATTGTTTGCTCTAGTTTACTACCAATAAAAGTCCTGTTAATCACAAGATTAAAAAAAAA
2081 AAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |: |||||  |:|||:||| 
Target 5' ttAGAACCAT--TTACATTCCa 3'
1039 - 1058 148.00 -16.90
2
miRNA  3' guuuGUG-GUAACAG-UGUGAGGu 5'
              :|| :|||  | |||||:| 
Target 5' ctgtTACGTATTACCTACACTTCt 3'
931 - 954 134.00 -12.20
3
miRNA  3' guUUGUGGUA-----ACA--GUGUGAGGu 5'
            ||:|:::|     |||   |||||:| 
Target 5' ttAATATTGTGCAAGTGTAAAACACTTCt 3'
1627 - 1655 134.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30458048 20 COSMIC
COSN30162069 60 COSMIC
COSN31560073 64 COSMIC
COSN30512994 67 COSMIC
COSN30173795 83 COSMIC
COSN30175395 87 COSMIC
COSN30495969 107 COSMIC
COSN30419820 185 COSMIC
COSN6018799 197 COSMIC
COSN31528508 212 COSMIC
COSN31522289 222 COSMIC
COSN31609565 258 COSMIC
COSN31553423 286 COSMIC
COSN30539868 288 COSMIC
COSN29007923 311 COSMIC
COSN15662061 312 COSMIC
COSN32061574 329 COSMIC
COSN26644235 341 COSMIC
COSN17761791 351 COSMIC
COSN26574907 355 COSMIC
COSN30544791 377 COSMIC
COSN26555898 378 COSMIC
COSN31544099 395 COSMIC
COSN31608364 523 COSMIC
COSN29467877 524 COSMIC
COSN30544824 553 COSMIC
COSN27396117 728 COSMIC
COSN27462581 729 COSMIC
COSN29357844 959 COSMIC
COSN28939445 965 COSMIC
COSN21431554 974 COSMIC
COSN7197820 990 COSMIC
COSN16449829 1383 COSMIC
COSN26713063 1493 COSMIC
COSN8428286 1760 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1162759417 5 dbSNP
rs1425199419 7 dbSNP
rs771841506 11 dbSNP
rs1259770831 17 dbSNP
rs748135498 17 dbSNP
rs1374201308 18 dbSNP
rs774315324 20 dbSNP
rs1166474518 21 dbSNP
rs573995191 23 dbSNP
rs1183525332 25 dbSNP
rs899692165 31 dbSNP
rs1214275850 32 dbSNP
rs1393331573 33 dbSNP
rs377661439 33 dbSNP
rs1034066469 37 dbSNP
rs781078928 38 dbSNP
rs1285368369 39 dbSNP
rs1222263980 41 dbSNP
rs757561925 48 dbSNP
rs534302212 54 dbSNP
rs1226614902 55 dbSNP
rs566897310 64 dbSNP
rs1334542168 65 dbSNP
rs1041623941 66 dbSNP
rs949789981 78 dbSNP
rs1361408198 80 dbSNP
rs1222768919 81 dbSNP
rs551894990 83 dbSNP
rs540071956 84 dbSNP
rs1489625956 89 dbSNP
rs1218106299 96 dbSNP
rs1010331128 97 dbSNP
rs1191679412 100 dbSNP
rs891688737 104 dbSNP
rs1179769864 107 dbSNP
rs1459484768 108 dbSNP
rs1421774933 117 dbSNP
rs1289457397 127 dbSNP
rs1239411047 128 dbSNP
rs916921868 132 dbSNP
rs1193558519 140 dbSNP
rs569449684 149 dbSNP
rs1055977130 159 dbSNP
rs1246507447 162 dbSNP
rs201032582 164 dbSNP
rs1356777928 170 dbSNP
rs937096000 174 dbSNP
rs1260743016 175 dbSNP
rs1485292434 181 dbSNP
rs920318597 185 dbSNP
rs1245548936 190 dbSNP
rs549327975 201 dbSNP
rs1240706511 207 dbSNP
rs1039095054 212 dbSNP
rs1441717083 215 dbSNP
rs1160187164 217 dbSNP
rs974212942 227 dbSNP
rs962815111 232 dbSNP
rs1156721072 237 dbSNP
rs1047690565 249 dbSNP
rs1379003985 252 dbSNP
rs1335764761 254 dbSNP
rs1326846848 258 dbSNP
rs766940206 259 dbSNP
rs929314460 266 dbSNP
rs1307345377 273 dbSNP
rs1403061954 283 dbSNP
rs1304756215 286 dbSNP
rs1433127372 287 dbSNP
rs1394788135 288 dbSNP
rs920816405 289 dbSNP
rs1159643558 296 dbSNP
rs780680157 297 dbSNP
rs1177970390 298 dbSNP
rs3210270 298 dbSNP
rs1250139788 300 dbSNP
rs3204322 300 dbSNP
rs1181771444 301 dbSNP
rs1430079460 301 dbSNP
rs1175688575 302 dbSNP
rs1470200232 302 dbSNP
rs1436704772 306 dbSNP
rs1256275257 309 dbSNP
rs1223437948 310 dbSNP
rs1284565669 310 dbSNP
rs1372094260 310 dbSNP
rs1389350647 310 dbSNP
rs1463369318 310 dbSNP
rs551314475 310 dbSNP
rs926817624 310 dbSNP
rs1201748653 311 dbSNP
rs1205605014 312 dbSNP
rs1484491433 312 dbSNP
rs908831890 315 dbSNP
rs979835225 323 dbSNP
rs1470756928 324 dbSNP
rs1479743580 324 dbSNP
rs1480188619 324 dbSNP
rs983049707 324 dbSNP
rs1198560581 325 dbSNP
rs1423036283 325 dbSNP
rs1217058164 326 dbSNP
rs1353710335 326 dbSNP
rs971107948 326 dbSNP
rs1355635384 327 dbSNP
rs1304654753 328 dbSNP
rs1365629622 329 dbSNP
rs376462698 330 dbSNP
rs1403856455 336 dbSNP
rs1280836717 337 dbSNP
rs1364650604 337 dbSNP
rs1277676746 338 dbSNP
rs955579979 340 dbSNP
rs772537194 344 dbSNP
rs988456659 345 dbSNP
rs1341099492 350 dbSNP
rs997223586 355 dbSNP
rs11811745 357 dbSNP
rs964142947 368 dbSNP
rs955907638 369 dbSNP
rs1292827969 374 dbSNP
rs1490200643 375 dbSNP
rs1220281087 379 dbSNP
rs35753959 383 dbSNP
rs1033055912 384 dbSNP
rs748414064 390 dbSNP
rs903011888 394 dbSNP
rs1041697609 395 dbSNP
rs779505992 411 dbSNP
rs190693169 412 dbSNP
rs1055479798 415 dbSNP
rs936961547 417 dbSNP
rs753982825 425 dbSNP
rs185051622 429 dbSNP
rs890515121 436 dbSNP
rs1320940093 437 dbSNP
rs941569302 438 dbSNP
rs1432095956 445 dbSNP
rs1288862721 447 dbSNP
rs1360273280 450 dbSNP
rs548753007 452 dbSNP
rs1316198351 454 dbSNP
rs983466715 455 dbSNP
rs934272748 465 dbSNP
rs929288868 467 dbSNP
rs1317652380 468 dbSNP
rs1473433039 472 dbSNP
rs1368477233 473 dbSNP
rs1188999075 477 dbSNP
rs1463507611 477 dbSNP
rs527271706 482 dbSNP
rs1243537793 491 dbSNP
rs975442460 496 dbSNP
rs1161158272 502 dbSNP
rs1409521106 503 dbSNP
rs560026971 507 dbSNP
rs1400819754 508 dbSNP
rs1158987198 510 dbSNP
rs1256325608 513 dbSNP
rs1455084079 515 dbSNP
rs938291629 515 dbSNP
rs964006041 516 dbSNP
rs544684228 523 dbSNP
rs577437165 524 dbSNP
rs978839915 526 dbSNP
rs1351467895 536 dbSNP
rs1223246778 538 dbSNP
rs967230447 542 dbSNP
rs1020104587 555 dbSNP
rs982253323 558 dbSNP
rs1460760063 561 dbSNP
rs192265035 562 dbSNP
rs1356982859 565 dbSNP
rs1176081309 568 dbSNP
rs544110999 570 dbSNP
rs1267210722 579 dbSNP
rs1231525928 587 dbSNP
rs573807658 590 dbSNP
rs1409136484 603 dbSNP
rs916969567 604 dbSNP
rs555630345 618 dbSNP
rs756260748 621 dbSNP
rs533978052 637 dbSNP
rs560427353 659 dbSNP
rs1331319529 670 dbSNP
rs1336538118 677 dbSNP
rs1001188172 678 dbSNP
rs1286473968 685 dbSNP
rs1347533271 686 dbSNP
rs1325011994 697 dbSNP
rs1318084677 702 dbSNP
rs1365508471 702 dbSNP
rs78360744 704 dbSNP
rs776158671 710 dbSNP
rs1406372123 717 dbSNP
rs573174815 719 dbSNP
rs1163450187 721 dbSNP
rs1459391550 724 dbSNP
rs1322531223 726 dbSNP
rs1416553020 727 dbSNP
rs1193883420 728 dbSNP
rs1037434760 729 dbSNP
rs558311402 733 dbSNP
rs964567739 737 dbSNP
rs886159205 739 dbSNP
rs1017490746 740 dbSNP
rs140983887 740 dbSNP
rs796470955 740 dbSNP
rs1200758715 751 dbSNP
rs1429144662 759 dbSNP
rs1047244884 768 dbSNP
rs934113192 786 dbSNP
rs79617453 787 dbSNP
rs976062917 788 dbSNP
rs759170042 789 dbSNP
rs925927722 794 dbSNP
rs1282750226 799 dbSNP
rs1192184752 804 dbSNP
rs1230978048 807 dbSNP
rs1271657108 811 dbSNP
rs938012959 814 dbSNP
rs1227203567 815 dbSNP
rs1272087161 818 dbSNP
rs905406543 831 dbSNP
rs765907268 838 dbSNP
rs1267563541 839 dbSNP
rs1046691851 851 dbSNP
rs1452036849 853 dbSNP
rs949525408 855 dbSNP
rs914113830 863 dbSNP
rs1475316623 864 dbSNP
rs1052857346 865 dbSNP
rs978871240 873 dbSNP
rs967470791 874 dbSNP
rs1302548396 877 dbSNP
rs925736370 886 dbSNP
rs1020766547 888 dbSNP
rs1384991735 889 dbSNP
rs1478648870 890 dbSNP
rs1320284398 892 dbSNP
rs1326771874 895 dbSNP
rs978808306 903 dbSNP
rs1295170981 906 dbSNP
rs992680459 909 dbSNP
rs960133043 919 dbSNP
rs1246275404 923 dbSNP
rs964347980 924 dbSNP
rs1034308333 930 dbSNP
rs1220629165 931 dbSNP
rs1001387309 933 dbSNP
rs1269895590 936 dbSNP
rs1128817 937 dbSNP
rs1445399464 938 dbSNP
rs1333237534 948 dbSNP
rs1324406279 953 dbSNP
rs1015894315 957 dbSNP
rs1440861140 964 dbSNP
rs767583788 986 dbSNP
rs1393011084 988 dbSNP
rs1455447627 990 dbSNP
rs886192201 999 dbSNP
rs954542131 1000 dbSNP
rs1385532169 1002 dbSNP
rs1051916820 1004 dbSNP
rs1026589625 1017 dbSNP
rs1384797765 1021 dbSNP
rs1452914867 1033 dbSNP
rs1311623633 1034 dbSNP
rs934210361 1046 dbSNP
rs1416943625 1047 dbSNP
rs901336007 1053 dbSNP
rs1260832137 1062 dbSNP
rs1039979843 1063 dbSNP
rs942919249 1065 dbSNP
rs926165861 1071 dbSNP
rs1478221867 1073 dbSNP
rs1043100544 1076 dbSNP
rs945993776 1077 dbSNP
rs1181464266 1083 dbSNP
rs1002172057 1086 dbSNP
rs1421142648 1086 dbSNP
rs1182534366 1090 dbSNP
rs1363315571 1092 dbSNP
rs905229814 1095 dbSNP
rs551152314 1098 dbSNP
rs913347808 1106 dbSNP
rs1407995732 1109 dbSNP
rs1238812153 1112 dbSNP
rs1200594572 1115 dbSNP
rs1302073385 1117 dbSNP
rs1436188945 1118 dbSNP
rs1392774566 1122 dbSNP
rs1307009923 1123 dbSNP
rs1272531298 1125 dbSNP
rs1019397983 1136 dbSNP
rs1220054592 1136 dbSNP
rs1328511087 1141 dbSNP
rs10666591 1142 dbSNP
rs187093892 1142 dbSNP
rs1347524559 1146 dbSNP
rs892625280 1151 dbSNP
rs1481708825 1153 dbSNP
rs1196660616 1155 dbSNP
rs1251166023 1155 dbSNP
rs1471676536 1155 dbSNP
rs34371654 1155 dbSNP
rs5780025 1155 dbSNP
rs1301707831 1156 dbSNP
rs1357224480 1158 dbSNP
rs959921708 1158 dbSNP
rs1463184505 1162 dbSNP
rs1298457964 1163 dbSNP
rs1369369159 1164 dbSNP
rs1407507211 1168 dbSNP
rs568702998 1172 dbSNP
rs1346624486 1179 dbSNP
rs547259920 1181 dbSNP
rs1219174679 1186 dbSNP
rs979875563 1187 dbSNP
rs1228394003 1188 dbSNP
rs1274258004 1196 dbSNP
rs1224769174 1199 dbSNP
rs1269698804 1200 dbSNP
rs963281956 1202 dbSNP
rs1334030220 1206 dbSNP
rs1443705090 1212 dbSNP
rs1190600748 1216 dbSNP
rs1352313954 1217 dbSNP
rs1422791417 1222 dbSNP
rs1430126448 1231 dbSNP
rs1053001867 1233 dbSNP
rs1016094414 1246 dbSNP
rs1327712522 1247 dbSNP
rs527319362 1248 dbSNP
rs773137348 1250 dbSNP
rs925653571 1251 dbSNP
rs1436385597 1255 dbSNP
rs1292333563 1258 dbSNP
rs1364501047 1260 dbSNP
rs1383083871 1261 dbSNP
rs1042794979 1263 dbSNP
rs943030414 1270 dbSNP
rs6668164 1271 dbSNP
rs1292568120 1283 dbSNP
rs1321262665 1292 dbSNP
rs142690378 1302 dbSNP
rs1244960173 1311 dbSNP
rs1030121044 1313 dbSNP
rs184307307 1315 dbSNP
rs1486818788 1318 dbSNP
rs997657109 1334 dbSNP
rs901371563 1338 dbSNP
rs1447271181 1345 dbSNP
rs771893847 1358 dbSNP
rs1413847902 1361 dbSNP
rs1404300533 1363 dbSNP
rs1162122111 1364 dbSNP
rs954655252 1367 dbSNP
rs919199111 1377 dbSNP
rs562709543 1386 dbSNP
rs972269555 1386 dbSNP
rs963251940 1390 dbSNP
rs1016754207 1398 dbSNP
rs1378502191 1412 dbSNP
rs1007042612 1418 dbSNP
rs1232380220 1420 dbSNP
rs1211040911 1435 dbSNP
rs1002330481 1440 dbSNP
rs1286466758 1440 dbSNP
rs969360874 1446 dbSNP
rs1267254758 1457 dbSNP
rs1278519568 1458 dbSNP
rs1463411108 1478 dbSNP
rs544609391 1485 dbSNP
rs1237648634 1486 dbSNP
rs532824244 1494 dbSNP
rs946106149 1499 dbSNP
rs148204949 1500 dbSNP
rs1312078193 1503 dbSNP
rs191801113 1506 dbSNP
rs913203585 1507 dbSNP
rs1159158078 1508 dbSNP
rs1386866164 1509 dbSNP
rs1471188506 1512 dbSNP
rs1335298677 1516 dbSNP
rs1358760775 1518 dbSNP
rs1446097140 1525 dbSNP
rs1281339923 1531 dbSNP
rs747950425 1532 dbSNP
rs143393661 1535 dbSNP
rs938776961 1548 dbSNP
rs1205289994 1564 dbSNP
rs575261245 1565 dbSNP
rs1312300411 1570 dbSNP
rs149220070 1573 dbSNP
rs1207653317 1583 dbSNP
rs1448233893 1586 dbSNP
rs904054024 1587 dbSNP
rs1483118491 1589 dbSNP
rs573731036 1594 dbSNP
rs979908274 1600 dbSNP
rs573176173 1601 dbSNP
rs1310773993 1605 dbSNP
rs558147727 1610 dbSNP
rs774307259 1632 dbSNP
rs187472952 1633 dbSNP
rs888769535 1635 dbSNP
rs575760392 1638 dbSNP
rs1051355257 1641 dbSNP
rs866640402 1642 dbSNP
rs1409233529 1665 dbSNP
rs879647780 1679 dbSNP
rs1348484389 1695 dbSNP
rs1235349321 1696 dbSNP
rs909168087 1697 dbSNP
rs1275209252 1706 dbSNP
rs1182497845 1712 dbSNP
rs919135461 1716 dbSNP
rs1217083974 1725 dbSNP
rs1274735467 1727 dbSNP
rs1255661870 1729 dbSNP
rs983329778 1730 dbSNP
rs1187573889 1735 dbSNP
rs1203759349 1739 dbSNP
rs1248990371 1748 dbSNP
rs1488787661 1754 dbSNP
rs941857819 1776 dbSNP
rs1246457809 1779 dbSNP
rs1477273794 1781 dbSNP
rs145308442 1783 dbSNP
rs909071784 1784 dbSNP
rs1030398728 1795 dbSNP
rs1166735847 1796 dbSNP
rs775400303 1798 dbSNP
rs1009062576 1804 dbSNP
rs1388438120 1805 dbSNP
rs772883377 1810 dbSNP
rs769332831 1813 dbSNP
rs11804058 1814 dbSNP
rs758948231 1824 dbSNP
rs1299583391 1831 dbSNP
rs1233364565 1834 dbSNP
rs568620603 1843 dbSNP
rs553414616 1855 dbSNP
rs535290065 1856 dbSNP
rs1413795820 1857 dbSNP
rs1043350358 1861 dbSNP
rs1450425665 1864 dbSNP
rs956740793 1864 dbSNP
rs1290436376 1866 dbSNP
rs1195701747 1870 dbSNP
rs1249052123 1873 dbSNP
rs1031664188 1876 dbSNP
rs1186986732 1878 dbSNP
rs1344503022 1883 dbSNP
rs1458515529 1901 dbSNP
rs1162758910 1907 dbSNP
rs1010890483 1908 dbSNP
rs776369238 1910 dbSNP
rs1165476254 1914 dbSNP
rs1322233366 1918 dbSNP
rs1463065404 1921 dbSNP
rs1057445984 1923 dbSNP
rs1018426574 1932 dbSNP
rs1007026566 1933 dbSNP
rs1341918399 1947 dbSNP
rs888825422 1948 dbSNP
rs1051467070 1949 dbSNP
rs932971749 1953 dbSNP
rs1354793739 1959 dbSNP
rs566141007 1960 dbSNP
rs878983681 1965 dbSNP
rs897527388 1979 dbSNP
rs182919435 1983 dbSNP
rs905964754 1992 dbSNP
rs1245142508 1993 dbSNP
rs532763865 1997 dbSNP
rs941984834 1998 dbSNP
rs1186843957 2000 dbSNP
rs770451873 2002 dbSNP
rs941908187 2003 dbSNP
rs909032723 2007 dbSNP
rs1161367347 2013 dbSNP
rs1456462928 2016 dbSNP
rs775758341 2016 dbSNP
rs980579919 2024 dbSNP
rs568650903 2025 dbSNP
rs780554081 2045 dbSNP
rs748550321 2049 dbSNP
rs1336214953 2053 dbSNP
rs1270763719 2065 dbSNP
rs917974550 2067 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084040. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep1 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuguggUAACA-----GUGUGAGGu 5'
                  |||||     ::|||||| 
Target 5' -----aagAUUGUGCCACUGCACUCCa 3'
1 - 22
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084040
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep1
Location of target site ENST00000294740.3 | 3UTR | AAGAUUGUGCCACUGCACUCCAGCCUGGGCGACAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.507 5.7e-3 -0.417 2.1e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.454 1.1e-2 -0.481 7.5e-3 25 Click to see details
GSE28260 Renal cortex and medulla 0.603 1.5e-2 0.538 2.9e-2 13 Click to see details
GSE32688 Pancreatic cancer -0.371 1.8e-2 -0.311 4.2e-2 32 Click to see details
GSE21687 Ependynoma primary tumors -0.22 4.0e-2 -0.234 3.1e-2 64 Click to see details
GSE19350 CNS germ cell tumors -0.519 4.2e-2 -0.329 1.5e-1 12 Click to see details
GSE38226 Liver fibrosis 0.269 1.2e-1 0.332 7.1e-2 21 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.332 2.6e-1 -0.257 3.1e-1 6 Click to see details
GSE14794 Lymphoblastoid cells 0.062 2.8e-1 0.111 1.5e-1 90 Click to see details
GSE21849 B cell lymphoma 0.099 3.0e-1 0.136 2.4e-1 29 Click to see details
GSE27834 Pluripotent stem cells 0.073 3.9e-1 0.088 3.7e-1 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.041 4.3e-1 -0.211 1.9e-1 20 Click to see details
GSE17306 Multiple myeloma -0.024 4.3e-1 0.167 1.3e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells 0.035 4.4e-1 -0.150 2.5e-1 23 Click to see details
GSE17498 Multiple myeloma -0.025 4.4e-1 -0.171 1.5e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells 0.031 4.4e-1 0.019 4.6e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.028 4.5e-1 -0.032 4.4e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.665 0.04 -0.738 0.02 8 Click to see details
KICH -0.456 0.13 -0.571 0.07 8 Click to see details
LIHC 0.056 0.35 -0.141 0.17 49 Click to see details
CHOL 0.115 0.38 0.267 0.24 9 Click to see details
THCA -0.178 0.39 -0.600 0.14 5 Click to see details
HNSC 0.283 0.41 0.500 0.33 3 Click to see details
KIRC 0.023 0.45 0.119 0.27 29 Click to see details
KIRP 0.015 0.48 -0.200 0.3 9 Click to see details
ESCA -0.015 0.49 -0.200 0.37 5 Click to see details
ESCA -0.015 0.49 -0.200 0.37 5 Click to see details
ESCA -0.015 0.49 -0.200 0.37 5 Click to see details
ESCA -0.015 0.49 -0.200 0.37 5 Click to see details
ESCA -0.015 0.49 -0.200 0.37 5 Click to see details
ESCA -0.015 0.49 -0.200 0.37 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*