miRTarBase - #MIRT685275 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KIAA1143   
Synonyms -
Description KIAA1143
Transcript NM_020696   
Expression
Putative miRNA Targets on KIAA1143
3'UTR of KIAA1143
(miRNA target sites are highlighted)
>KIAA1143|NM_020696|3'UTR
   1 GTGTAAATATTTTGAATTTAGTCTACTTTGAAAGTATATGGAGTGTTCATTAAAATCACATTTTTTCCTATTATAAAGAT
  81 ACTACAAGTTCTTTATAGAAAGTTTAGGAAATAGAGAAAAAAATTTAATAAACTACATCTATTCATCAATACCCCTCTGA
 161 CTTAAAATGCCAACTCTATAGAAATTAGCTAGTATTAACATTTTGTTATTTCCCTTGTGTGGTTGTATATATATGTAAAT
 241 TATATTTTTAAGCAAAATACATTTTTTGTGTGTAAACAAAATTTTATAAATACAACTGTATTGCAAATGTTCTTTGTCCT
 321 GCTTCTCACTTGACATTGCATTACGAGTATTCTTCCAGGTCAGTAAATTTCAAAAACCTGACATTAATAGCTACAGATAA
 401 TTTCATAAACATCTCATTGTATCTTTTTCATTAGCAATAGCTCCACTTTGGGTGGGGGAGATGATAATGTGCCTTGTTAA
 481 AAATACCTCCCCAACTCCTGCTAAGGGTGGCCATGAGACTCAGCTCTGGCAAGTTAAGAAATACAGGTGGAATTCTGCTT
 561 GATAAAGCTGCTGGGTTTTTTGTTACAAAAGGACAGACTTGGCAAACATGAGCCTTTGCTCTTATCTTTTCATCCTACTT
 641 GGAGTGCAGAGATAAAACCTGAGTACCAGAGCCACTTTTAGGCATAAGGAAGGCAGCCATGTGCTTTGGGTCATGTTAGT
 721 AAAAAGACTCAGAGCTTGGCTCCTTGCTGACATGCCTGGAGGAGCTGCTACACCAGCTTGGATTGCTGACCTCTGACTTC
 801 TTGGTAGTGAGAAGAATAAACACTGTGCTTAATTAGGCCTTGGTCAGGTTTCTTTTATATGCAGCCAAATGCAGTCCTAA
 881 GTAATACAATAAATAACTGGTCAAACTGTTACTGGTGGAGGGTGTCCAGGTTCTTGGCATTTTGGACAAATAATTGAACA
 961 AAACGCACAAAGCAATGAATATCCTCTAGAGGTTTGCCATTGGTTACTTGGCGTACACCCTGTGTAAATGAAGTAGTGGC
1041 CCGTGACCTGTCTGATTGGTGCAGAAAGTGACCAATCAGAGGCTGAAGTGAAGTTACAAAGTTATACTCCTGTGTAAATG
1121 AGGACTTGGCCTATGACCAGTCTGATTGGTTGCAGGAGGGGACCAATCAGAGGCACTTTCATTTTTCATCTGCAATGCAG
1201 AAAAGGCAAGGGGATTGCAAAGGGAGTAGCCTCTGATCCTTTTGTTACTTAGGTATGGAGAGGTGGGGTTTTCCTTTTGA
1281 TTCAGTTCTAGGAAGTCAATGTGAATCAGCCTTAGGTTCCCTGTCTCCAGACCCTATTCTCCTGCCTCATTTTCCCCCTG
1361 AGAGACGTGATCCTCGTAAATCTTTATGGGAGGCTGAGAGACTGAGGGTCTTTCTTCTGTAACTGCTTCATGCTAACTTG
1441 GGACACAGTCCCTACCTATTGGAGATCACGTAACTCTCACCCTGCTTTGTCTAGGGGAGACAGGGTAGCTTCTTGATGGC
1521 CGGTGGTGTCTTCTCCTGAAACTGGCTAGAAATCTTGTCACATGATCATCTAACTTGGTGGTCTCTAGGCAAAAGGAAAT
1601 GGATTTGGTTAAAAGATTTAACAGATATGGTCCAAAAACCAAGGCAAATATAATCATTAATAATGGGCTGGCCAAGGGAG
1681 GGAGCCATGAAACCCAACTTAGTGCCCTTTAGGTGCCCCAGCTGTTGTCATATTTTAGAGGCCCAGTCAGCTAGTTTTCA
1761 GGTGGTGTCCCTTACTAATCCTGATTGGTTGACATCAAAACAGCATTCTTCTTCTAGGAAAATACATAAGCCACCTGTTT
1841 CAGCAGTTAGGAGATCTAGTCCCCTTCGATTTTGCAAAGCGACCACTGCCAAGGAGCCTATCCGAATTTGTAAGGTGACA
1921 ATACTTTGAGCAATGTTATCCAGGCTTTCCATAAAATCCTTGGACAAGCGTTGGTAATAGGATAGGGAAGTTGCAATCCC
2001 GCTAACTCCCATTCCTACCTCTGCTGTTATTCCTAGCCGTTGTGTCTGGTGGTTGCAGTTAAAGGTATAATGAGGGATTG
2081 GTTGTTGGGAGCTATATTAATTTAGGGACATACAATATTTCTGTCTCCAGTCTACCACTTCCACCAAAGACAAATCACAG
2161 CAGAACCGACCTAACTTCAAAATAAACTGCAGTCCCATATACTGGGCCTGATTACCCACACAAAGTGCAACAAGAATCAT
2241 TGTCCATATAGACTCTCCTAGATTGGCTTTGCTAGAACATTTCACAAGGCCATTTCAGTCAAAGTCCTGAGAAAGTAACC
2321 GGTTTCAATTGTGCCCTATTACAAAAGAAAACGTGGTTATTAACTTTATACAGACAAATGCCATGAATTAAGAATATTCA
2401 TAAATAGTTTACAAATTCTGGAGAAATTAGAATACTCAATACACTTAAAGTGTATTTCAAGGCTATAAATAGCTCAAAAT
2481 AAAAAGATTATTCAGACTCTGAAAAAACAAAAAGAAGTAGCAATATTTCAAACAACAAAAGCCATACAAATTATTTCAGT
2561 CTTCCATTAGTTCATTTCAGTCCATGTAATCAACTCCTGCTCTACTTCATATTCATCTTTATGAACACATCAGCCTTTCA
2641 ATTAGTGCCTTGGAAGTTTTCTGTCTAATCCAATGGCACACTCTCCAAAGTTACCAGAAACCTGCATTCAAGAGTTCTTT
2721 TCATGAACTCCAAAGAAGTAAGCCTTGGACTGTAGCTGATTATAAGTCACTTTTTTTTTTTGAGAAGGATCAGAGCAAAA
2801 CATCAATTATGGATGACAAAAGTCTTAAGACAGCCATAAAGACACAGTTGACAAATGTGGCTATTTCTGTGGCTTACAAC
2881 AATTTAACATAATCATTACAACATATATTAAGACATATCAGAATTTTAGAACTCTCATACAATCCTGGAACACATATTAA
2961 CAACAAATCTCTATCAGTATAACCCAAAGGAAGCTAAACACCACCTCACACTTGACAATGTTTCCTGTATAATTCAAACA
3041 TTACAAATAAGCCTAATATAAGCCTAATATGTCACTCTTGAACTTCAGGAAGCCTAATATCCAAAAAGTTAGTTTAAGGT
3121 CAAAAGTTTTTGAATTAACTTTTTTCCATTAGTATGGTCATATCTTTCTTACTAATTTGTAAGTTATGTAATTTATCAAT
3201 TTTTTTTTGTTGTTCTGTTTCCCAACCTCTATGTCAGATAAAGAATCACCCAGGCCAGACACAATGGCTCATGCTTGTAA
3281 TCCCAACACTTTGGGAAGCCAAGGTGGGAGAATTGCTTGAAGCCAGGAATCTGAGCCCAGCCTGGGCGACAAAGCAATAC
3361 CCCTATCTCTACAAAAAATAAAAAATAGCCAGGTGTAGCGACACACACCTGTAGTCCCAGCTGCTCAGGAGGCTAAGCAG
3441 GAGGATGGCTTGGGCCCAGGAGTTCAACGCTGCAGTGAGCTATGATTGCACCACTGCACTCCAGCCTGGGCAACAGAGTA
3521 AGAACTGTCTCAAAAAAAATAAAAAATAGAAATAAATTTTAAAAAAAGAATTACCCATATTCTCTTTGTTTTTGTTTATT
3601 CACATTAACCTTTATTCTATCTGGAATTTATTAGAGTATACTTTTTTCTCAAATAATCAATTGTCCTAGAACCATGTGTT
3681 TCTCATTTATTTGAAAGGCCATCTAGTGAGAGATTTCTCCAAATGTTGGGGTAGGGAAGGGAGGGGAAGCACTTTAAAGT
3761 CTGAGCCTTTAGAGGTGATTCCTCAAGACCCTGCTTAATCCTAACAATTTTCCTCATTAGTAAAAGTCAGCCCAAACTGG
3841 GGGCTTGTTAAGATCCTTACCAGCCACATCCATCTGAAATTATGAATTTCAAAGTATCTTACAAATTTGGTGCCACATTA
3921 TCTTTTTTAAGTTTGTTTTGTTTTGTTTTTTTGAGACAGAGTCTCGCTCTGTCACCCAGGCTGGAGTGCAGTGGCGCGAT
4001 CTCAGCTCACTGCAAGCTCCGCCTCCTGGGTTCACACCATTCTCTTGCCTCAGCCTCCCAAGTATCTGGGACTACAGTCG
4081 CCCGCCACCACGCCCGGCTAATTTTTTTGTATTTTTAATAGAGACGGGGTTTCACTTTGTTAGCCAGGATGGTCTCAATC
4161 TCCTGACCTCATGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGCAGGAGCCACCGCGCCTGGGCCTTTTT
4241 TTAAGTTTTAAGTACCTATAAAGAACACTGAAAGGTGATGTGTGTGGATGAGCTAGGAAGACCTGAAATAGGCTCTCTCT
4321 AAATTAATCAAATTAATCCTGAAGCCATTCTGCAATACTGTCTTTAATGTATACTCACTTGTTATAGAAGCCAGGGTTTT
4401 TTCCCCTAATTTGTATCATTGCTATATGTGTTATTGTACCAAACTACACTGTTTTAATTGCTGTAAATTTTAATATGTCT
4481 TAGTATCTGGGTGTGGGAATCTTGAAAGCATGGAGTTTGTGTTATTCACCACTGTATTCTCAAATATCAGAAGAGTATCT
4561 GGCCTACTAAGTGCACAATAAACATAGTTAAAATGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||: ||| || |||||||: 
Target 5' ctAAT-CCAATGGCACACTCTc 3'
2665 - 2685 151.00 -16.00
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |::  ||  ||:|:||||| 
Target 5' gaAGTTACAAAGTTATACTCCt 3'
1090 - 1111 140.00 -13.50
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||||| |   :|||||| 
Target 5' attGCACCACT---GCACTCCa 3'
3485 - 3503 140.00 -17.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31548586 11 COSMIC
COSN30100747 21 COSMIC
COSN23597352 23 COSMIC
COSN26302958 42 COSMIC
COSN30600840 80 COSMIC
COSN31580377 91 COSMIC
COSN30190684 92 COSMIC
COSN19706197 116 COSMIC
COSN7698913 188 COSMIC
COSN1277373 1375 COSMIC
COSN28532394 3005 COSMIC
COSN16518207 3117 COSMIC
COSN28587921 3206 COSMIC
COSN32063891 3252 COSMIC
COSN6768666 3279 COSMIC
COSN24244744 3689 COSMIC
COSN1950607 4383 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs762865421 1 dbSNP
rs749023809 5 dbSNP
rs1243407905 7 dbSNP
rs1340499184 12 dbSNP
rs1314212596 14 dbSNP
rs773268883 17 dbSNP
rs764910650 19 dbSNP
rs1308398104 23 dbSNP
rs1164546184 25 dbSNP
rs761717205 30 dbSNP
rs1421874215 33 dbSNP
rs57029395 58 dbSNP
rs1459870130 60 dbSNP
rs1339417228 62 dbSNP
rs986486025 67 dbSNP
rs1444676700 68 dbSNP
rs772900993 70 dbSNP
rs955180443 80 dbSNP
rs1377963027 82 dbSNP
rs1240539957 84 dbSNP
rs1309062418 86 dbSNP
rs1165653540 96 dbSNP
rs1223668091 99 dbSNP
rs1319741570 99 dbSNP
rs1266021398 102 dbSNP
rs1456886786 120 dbSNP
rs577718822 124 dbSNP
rs879746467 124 dbSNP
rs921542197 124 dbSNP
rs1180965229 127 dbSNP
rs1310232916 134 dbSNP
rs1407498346 149 dbSNP
rs573295574 152 dbSNP
rs1032773322 177 dbSNP
rs1464097176 178 dbSNP
rs1333466847 179 dbSNP
rs998652941 186 dbSNP
rs188271065 205 dbSNP
rs1024596045 209 dbSNP
rs1376682341 211 dbSNP
rs1014161681 214 dbSNP
rs1313253563 221 dbSNP
rs894407958 228 dbSNP
rs551739344 233 dbSNP
rs146877674 234 dbSNP
rs1463932466 235 dbSNP
rs1208972136 247 dbSNP
rs1367088419 258 dbSNP
rs768739086 261 dbSNP
rs1473942386 272 dbSNP
rs536578633 280 dbSNP
rs1182840038 285 dbSNP
rs1038420440 299 dbSNP
rs1477113924 303 dbSNP
rs1418181670 318 dbSNP
rs940147978 320 dbSNP
rs566383673 321 dbSNP
rs1414034436 334 dbSNP
rs3866724 344 dbSNP
rs1051729750 345 dbSNP
rs1449904331 358 dbSNP
rs934241499 380 dbSNP
rs376540710 382 dbSNP
rs1481614891 390 dbSNP
rs1280083647 404 dbSNP
rs1317930785 410 dbSNP
rs1218138818 417 dbSNP
rs1263597557 423 dbSNP
rs1443811948 437 dbSNP
rs1210442214 438 dbSNP
rs957032911 454 dbSNP
rs1487549696 461 dbSNP
rs1196450243 464 dbSNP
rs539230322 479 dbSNP
rs1424985108 492 dbSNP
rs925651355 505 dbSNP
rs1335204883 509 dbSNP
rs1295384717 522 dbSNP
rs1170924951 529 dbSNP
rs1427467675 547 dbSNP
rs1226750109 568 dbSNP
rs977163996 582 dbSNP
rs554731015 583 dbSNP
rs1397931060 584 dbSNP
rs1024126126 585 dbSNP
rs1326991649 598 dbSNP
rs571859550 608 dbSNP
rs550342323 610 dbSNP
rs1346552890 617 dbSNP
rs1234563933 621 dbSNP
rs531814706 647 dbSNP
rs536667805 658 dbSNP
rs958621985 674 dbSNP
rs1219251609 678 dbSNP
rs1034689741 680 dbSNP
rs1451557219 684 dbSNP
rs561299594 689 dbSNP
rs1248523199 692 dbSNP
rs1478431387 699 dbSNP
rs1178199877 703 dbSNP
rs113239437 704 dbSNP
rs1417591502 710 dbSNP
rs1397086721 727 dbSNP
rs1385467088 730 dbSNP
rs1166671655 732 dbSNP
rs1404662023 735 dbSNP
rs1321580023 751 dbSNP
rs549372298 752 dbSNP
rs1332303615 769 dbSNP
rs1016924563 772 dbSNP
rs1362857574 775 dbSNP
rs1181979139 776 dbSNP
rs1307990553 778 dbSNP
rs1374234819 780 dbSNP
rs1242706843 791 dbSNP
rs183607682 803 dbSNP
rs1265233746 809 dbSNP
rs1208564266 811 dbSNP
rs1292662635 816 dbSNP
rs887214127 828 dbSNP
rs139697217 837 dbSNP
rs1212950255 844 dbSNP
rs1468770778 848 dbSNP
rs900046669 859 dbSNP
rs1039980502 862 dbSNP
rs1472375732 868 dbSNP
rs1161330755 885 dbSNP
rs1461470528 898 dbSNP
rs1330120094 906 dbSNP
rs936274696 908 dbSNP
rs1207067770 910 dbSNP
rs925598972 915 dbSNP
rs977111573 919 dbSNP
rs544936224 923 dbSNP
rs1336143389 924 dbSNP
rs1198628745 929 dbSNP
rs917000255 930 dbSNP
rs1459196299 937 dbSNP
rs1241333703 945 dbSNP
rs1255750926 946 dbSNP
rs1329382882 962 dbSNP
rs992642646 964 dbSNP
rs1442217582 971 dbSNP
rs1370067043 976 dbSNP
rs1475482141 994 dbSNP
rs958789787 996 dbSNP
rs1034226573 998 dbSNP
rs1298330989 999 dbSNP
rs577812125 1012 dbSNP
rs1394604732 1030 dbSNP
rs963292894 1035 dbSNP
rs1356552852 1039 dbSNP
rs1383853715 1040 dbSNP
rs867214582 1042 dbSNP
rs1320017328 1043 dbSNP
rs1004187332 1049 dbSNP
rs879304629 1055 dbSNP
rs1030166452 1059 dbSNP
rs1202449768 1067 dbSNP
rs1259315597 1069 dbSNP
rs562340944 1072 dbSNP
rs866518522 1074 dbSNP
rs1039926392 1075 dbSNP
rs1170565077 1095 dbSNP
rs1376626880 1097 dbSNP
rs1464207649 1102 dbSNP
rs1174039887 1105 dbSNP
rs1376426070 1107 dbSNP
rs936222196 1111 dbSNP
rs1296814834 1120 dbSNP
rs904796463 1123 dbSNP
rs1382798443 1133 dbSNP
rs1300650310 1149 dbSNP
rs1310558018 1166 dbSNP
rs1235691923 1170 dbSNP
rs1285264730 1180 dbSNP
rs1207076631 1187 dbSNP
rs1283740003 1190 dbSNP
rs1486795442 1208 dbSNP
rs543931765 1212 dbSNP
rs1187081528 1231 dbSNP
rs1266054140 1237 dbSNP
rs1342988020 1247 dbSNP
rs1041377405 1253 dbSNP
rs1195045683 1284 dbSNP
rs1395310984 1285 dbSNP
rs945711982 1295 dbSNP
rs1279624279 1299 dbSNP
rs916966783 1325 dbSNP
rs1350754888 1330 dbSNP
rs1454734184 1342 dbSNP
rs992985066 1343 dbSNP
rs937140298 1345 dbSNP
rs927116333 1346 dbSNP
rs1285999256 1354 dbSNP
rs573386616 1360 dbSNP
rs973233190 1360 dbSNP
rs1376469487 1366 dbSNP
rs1238311658 1367 dbSNP
rs963240842 1375 dbSNP
rs1318577778 1376 dbSNP
rs191835720 1381 dbSNP
rs1430515370 1383 dbSNP
rs1264804428 1387 dbSNP
rs907809313 1392 dbSNP
rs1215051749 1396 dbSNP
rs187064573 1401 dbSNP
rs1318593537 1419 dbSNP
rs1438668342 1422 dbSNP
rs951461135 1423 dbSNP
rs1029700884 1426 dbSNP
rs775267334 1427 dbSNP
rs1246965014 1430 dbSNP
rs1420114087 1430 dbSNP
rs1373104375 1439 dbSNP
rs1164611682 1446 dbSNP
rs998666499 1454 dbSNP
rs964187666 1458 dbSNP
rs1018433156 1465 dbSNP
rs1434781572 1469 dbSNP
rs1444838905 1470 dbSNP
rs1000380300 1478 dbSNP
rs1375186873 1482 dbSNP
rs1224130546 1488 dbSNP
rs1396861200 1491 dbSNP
rs1235110177 1497 dbSNP
rs1273234566 1504 dbSNP
rs1456983054 1509 dbSNP
rs1196349139 1515 dbSNP
rs150606207 1521 dbSNP
rs185285444 1522 dbSNP
rs538961127 1523 dbSNP
rs1041995921 1525 dbSNP
rs1412144599 1526 dbSNP
rs1476456861 1530 dbSNP
rs1010527887 1538 dbSNP
rs1422997606 1538 dbSNP
rs1464148041 1546 dbSNP
rs1331055948 1561 dbSNP
rs569254263 1573 dbSNP
rs895464626 1574 dbSNP
rs1056828668 1577 dbSNP
rs1195615791 1579 dbSNP
rs1440842258 1582 dbSNP
rs1353371282 1598 dbSNP
rs571894028 1608 dbSNP
rs1257072175 1615 dbSNP
rs937067839 1619 dbSNP
rs1274617505 1623 dbSNP
rs927063258 1628 dbSNP
rs1209038259 1639 dbSNP
rs1236085881 1647 dbSNP
rs1037467884 1650 dbSNP
rs1189200394 1661 dbSNP
rs1263113221 1665 dbSNP
rs941875337 1678 dbSNP
rs1169742154 1695 dbSNP
rs907756025 1698 dbSNP
rs1486677179 1706 dbSNP
rs1414088780 1711 dbSNP
rs1174302347 1727 dbSNP
rs1373378479 1730 dbSNP
rs1416404112 1733 dbSNP
rs556777261 1738 dbSNP
rs1273145425 1739 dbSNP
rs142885433 1761 dbSNP
rs1271401554 1769 dbSNP
rs745826342 1770 dbSNP
rs954680618 1771 dbSNP
rs922579127 1785 dbSNP
rs1272227253 1796 dbSNP
rs1350415112 1798 dbSNP
rs1212090490 1803 dbSNP
rs1285876599 1805 dbSNP
rs1243068405 1812 dbSNP
rs1487583352 1815 dbSNP
rs1196010519 1816 dbSNP
rs1242775254 1825 dbSNP
rs371836995 1826 dbSNP
rs1477774121 1836 dbSNP
rs1353245164 1843 dbSNP
rs1311871253 1846 dbSNP
rs764978554 1858 dbSNP
rs1397124344 1859 dbSNP
rs1436301352 1861 dbSNP
rs193080597 1863 dbSNP
rs1359707975 1867 dbSNP
rs549163507 1868 dbSNP
rs1000327665 1880 dbSNP
rs968872049 1881 dbSNP
rs367713347 1884 dbSNP
rs1409243829 1900 dbSNP
rs1020485797 1901 dbSNP
rs1010892204 1903 dbSNP
rs566745128 1904 dbSNP
rs1285592459 1910 dbSNP
rs1451041830 1914 dbSNP
rs551704434 1924 dbSNP
rs1454848221 1933 dbSNP
rs1417461844 1939 dbSNP
rs1188871738 1941 dbSNP
rs1379435858 1942 dbSNP
rs1468419018 1951 dbSNP
rs533036610 1960 dbSNP
rs905585674 1970 dbSNP
rs1323288321 1974 dbSNP
rs200944059 1975 dbSNP
rs1441179980 1976 dbSNP
rs1330333180 1981 dbSNP
rs1204443340 1982 dbSNP
rs562378454 1987 dbSNP
rs1334292183 2000 dbSNP
rs1241632275 2001 dbSNP
rs1326508246 2002 dbSNP
rs1356233824 2005 dbSNP
rs1232042357 2006 dbSNP
rs148530013 2011 dbSNP
rs1469008264 2016 dbSNP
rs1198181255 2017 dbSNP
rs188943622 2024 dbSNP
rs1334583391 2030 dbSNP
rs1292333100 2031 dbSNP
rs1364221699 2038 dbSNP
rs907703566 2039 dbSNP
rs1356833320 2041 dbSNP
rs1277197506 2050 dbSNP
rs1440833663 2058 dbSNP
rs1461522309 2068 dbSNP
rs760443615 2081 dbSNP
rs1330774494 2083 dbSNP
rs1329926023 2085 dbSNP
rs1340314408 2089 dbSNP
rs1413457588 2094 dbSNP
rs1459707126 2107 dbSNP
rs933212048 2110 dbSNP
rs923228446 2112 dbSNP
rs977125584 2114 dbSNP
rs561830490 2115 dbSNP
rs1196647026 2119 dbSNP
rs1393393406 2122 dbSNP
rs1485256999 2124 dbSNP
rs942682023 2129 dbSNP
rs1476270366 2140 dbSNP
rs539941653 2146 dbSNP
rs1406052506 2153 dbSNP
rs911266202 2166 dbSNP
rs1370883390 2167 dbSNP
rs978833755 2168 dbSNP
rs1168195682 2178 dbSNP
rs571797461 2196 dbSNP
rs1401868504 2201 dbSNP
rs184048019 2208 dbSNP
rs193012740 2215 dbSNP
rs1356679660 2217 dbSNP
rs1470538575 2225 dbSNP
rs1399978643 2242 dbSNP
rs374445805 2246 dbSNP
rs578253492 2247 dbSNP
rs989011951 2248 dbSNP
rs1468339537 2251 dbSNP
rs1346801003 2263 dbSNP
rs960539495 2273 dbSNP
rs1213936627 2278 dbSNP
rs1282319604 2291 dbSNP
rs1485940053 2296 dbSNP
rs1185926364 2314 dbSNP
rs1336581900 2320 dbSNP
rs1035952912 2321 dbSNP
rs1001116114 2326 dbSNP
rs905531912 2328 dbSNP
rs1452904546 2329 dbSNP
rs1015914831 2333 dbSNP
rs1222757990 2335 dbSNP
rs1005911797 2340 dbSNP
rs1373376593 2340 dbSNP
rs1419626585 2352 dbSNP
rs886209865 2353 dbSNP
rs1387162895 2370 dbSNP
rs1382853714 2373 dbSNP
rs1300803790 2386 dbSNP
rs1047993902 2389 dbSNP
rs1438548246 2405 dbSNP
rs1305352705 2423 dbSNP
rs1348395878 2426 dbSNP
rs1369980678 2427 dbSNP
rs1326405135 2438 dbSNP
rs1462804216 2439 dbSNP
rs1205225643 2441 dbSNP
rs1251884391 2444 dbSNP
rs1343700498 2450 dbSNP
rs1195188220 2463 dbSNP
rs1158622820 2467 dbSNP
rs1401395301 2473 dbSNP
rs1418878553 2490 dbSNP
rs1410194215 2497 dbSNP
rs1157477980 2501 dbSNP
rs1192325403 2502 dbSNP
rs1454171001 2508 dbSNP
rs1366090684 2522 dbSNP
rs1454333175 2523 dbSNP
rs1292994386 2539 dbSNP
rs933178078 2560 dbSNP
rs1326841733 2562 dbSNP
rs556865495 2575 dbSNP
rs1195958420 2593 dbSNP
rs1223029939 2599 dbSNP
rs1485084554 2622 dbSNP
rs1318627705 2636 dbSNP
rs901720362 2649 dbSNP
rs1271987730 2662 dbSNP
rs1466800088 2665 dbSNP
rs1215116510 2681 dbSNP
rs1253247899 2689 dbSNP
rs1240033817 2691 dbSNP
rs1175874175 2704 dbSNP
rs1253166873 2705 dbSNP
rs1420173121 2711 dbSNP
rs1164900388 2723 dbSNP
rs1415694773 2724 dbSNP
rs1463082496 2741 dbSNP
rs538446690 2750 dbSNP
rs1214570788 2773 dbSNP
rs1038948925 2782 dbSNP
rs1296203867 2782 dbSNP
rs879928033 2782 dbSNP
rs1317000082 2784 dbSNP
rs1375339218 2788 dbSNP
rs1287454936 2789 dbSNP
rs1391888542 2792 dbSNP
rs6780236 2793 dbSNP
rs1347130290 2798 dbSNP
rs1304035096 2801 dbSNP
rs911212539 2805 dbSNP
rs978782661 2806 dbSNP
rs947428622 2808 dbSNP
rs913329633 2811 dbSNP
rs368289319 2817 dbSNP
rs555872541 2819 dbSNP
rs989350438 2837 dbSNP
rs1481172098 2840 dbSNP
rs1187771829 2841 dbSNP
rs1256059292 2846 dbSNP
rs1476198296 2904 dbSNP
rs1188716726 2912 dbSNP
rs1418941087 2913 dbSNP
rs1408420294 2915 dbSNP
rs1347047220 2916 dbSNP
rs960236510 2918 dbSNP
rs1312159898 2937 dbSNP
rs1036306534 2941 dbSNP
rs1416597974 2971 dbSNP
rs980312708 2975 dbSNP
rs1360747031 2984 dbSNP
rs367935915 2998 dbSNP
rs1274681941 2999 dbSNP
rs374371674 3005 dbSNP
rs1308405315 3011 dbSNP
rs1434170770 3018 dbSNP
rs970310042 3020 dbSNP
rs1396263202 3026 dbSNP
rs1176043883 3029 dbSNP
rs1427131254 3056 dbSNP
rs1474477577 3058 dbSNP
rs1188441111 3070 dbSNP
rs1419182373 3083 dbSNP
rs1185575212 3096 dbSNP
rs1449800465 3101 dbSNP
rs1486027290 3115 dbSNP
rs1264860075 3116 dbSNP
rs370412563 3117 dbSNP
rs1015861718 3125 dbSNP
rs1485038278 3127 dbSNP
rs1428073965 3133 dbSNP
rs1280998071 3135 dbSNP
rs1271522140 3140 dbSNP
rs1441998159 3156 dbSNP
rs1235265404 3157 dbSNP
rs1005857795 3164 dbSNP
rs1233158651 3171 dbSNP
rs1294504631 3171 dbSNP
rs886156928 3171 dbSNP
rs1350572529 3179 dbSNP
rs1026067476 3189 dbSNP
rs997715833 3194 dbSNP
rs1214938266 3198 dbSNP
rs73829680 3206 dbSNP
rs901669323 3209 dbSNP
rs1311267140 3212 dbSNP
rs1192062410 3214 dbSNP
rs1414288635 3215 dbSNP
rs1376094060 3217 dbSNP
rs1393025178 3218 dbSNP
rs1038915757 3219 dbSNP
rs868022482 3223 dbSNP
rs1460857157 3224 dbSNP
rs6803405 3226 dbSNP
rs903791388 3231 dbSNP
rs1388812206 3232 dbSNP
rs1430638187 3253 dbSNP
rs1043048802 3254 dbSNP
rs1425373992 3257 dbSNP
rs1185290238 3263 dbSNP
rs1373565273 3275 dbSNP
rs372844577 3279 dbSNP
rs3205460 3280 dbSNP
rs947377716 3282 dbSNP
rs1257540447 3297 dbSNP
rs913267055 3306 dbSNP
rs1268845981 3307 dbSNP
rs1479657133 3313 dbSNP
rs1211996757 3318 dbSNP
rs1250679322 3321 dbSNP
rs373867335 3323 dbSNP
rs1199276556 3327 dbSNP
rs1232126510 3332 dbSNP
rs1468528375 3335 dbSNP
rs938798046 3336 dbSNP
rs1319700085 3341 dbSNP
rs551470097 3347 dbSNP
rs970257532 3348 dbSNP
rs1291699678 3363 dbSNP
rs1328567196 3364 dbSNP
rs1334427121 3365 dbSNP
rs909478675 3379 dbSNP
rs1289540486 3381 dbSNP
rs984383260 3386 dbSNP
rs1232839643 3387 dbSNP
rs528639275 3390 dbSNP
rs1026434322 3399 dbSNP
rs1357280615 3400 dbSNP
rs1195509374 3404 dbSNP
rs1272003264 3409 dbSNP
rs1435878396 3409 dbSNP
rs1184167437 3410 dbSNP
rs533123546 3410 dbSNP
rs1252495995 3414 dbSNP
rs997264149 3424 dbSNP
rs1141633 3427 dbSNP
rs1389725861 3429 dbSNP
rs761502652 3430 dbSNP
rs34296624 3434 dbSNP
rs3205463 3435 dbSNP
rs568835810 3443 dbSNP
rs1394715234 3449 dbSNP
rs34787237 3450 dbSNP
rs1412005313 3458 dbSNP
rs1309114765 3460 dbSNP
rs138064610 3461 dbSNP
rs1007412268 3468 dbSNP
rs903737528 3469 dbSNP
rs574479060 3473 dbSNP
rs1162372614 3477 dbSNP
rs1460536074 3478 dbSNP
rs1418121809 3482 dbSNP
rs377016950 3490 dbSNP
rs373344137 3493 dbSNP
rs1275153501 3498 dbSNP
rs1485288756 3499 dbSNP
rs529092513 3501 dbSNP
rs548642942 3515 dbSNP
rs1458935985 3521 dbSNP
rs1191944771 3527 dbSNP
rs1371004846 3532 dbSNP
rs891784874 3540 dbSNP
rs1212831304 3542 dbSNP
rs1169588177 3544 dbSNP
rs1335799234 3560 dbSNP
rs1433382116 3561 dbSNP
rs1053556007 3569 dbSNP
rs1402915824 3571 dbSNP
rs1267429308 3574 dbSNP
rs1381750267 3575 dbSNP
rs1237021248 3582 dbSNP
rs71325038 3587 dbSNP
rs1316436934 3598 dbSNP
rs1328406261 3600 dbSNP
rs1335201127 3603 dbSNP
rs1308362490 3605 dbSNP
rs1298061478 3619 dbSNP
rs1346956320 3620 dbSNP
rs540350820 3630 dbSNP
rs868598178 3632 dbSNP
rs6792299 3633 dbSNP
rs1369252402 3635 dbSNP
rs1204013061 3637 dbSNP
rs1259102988 3645 dbSNP
rs1465972652 3648 dbSNP
rs1325733920 3657 dbSNP
rs142853212 3660 dbSNP
rs948894765 3672 dbSNP
rs1452964362 3676 dbSNP
rs1164609723 3679 dbSNP
rs909426237 3686 dbSNP
rs1362663078 3689 dbSNP
rs985002527 3700 dbSNP
rs951063867 3703 dbSNP
rs918912942 3704 dbSNP
rs1357196751 3705 dbSNP
rs976172250 3709 dbSNP
rs747739749 3726 dbSNP
rs1369887844 3731 dbSNP
rs1438483243 3739 dbSNP
rs1303198226 3740 dbSNP
rs965795523 3741 dbSNP
rs1238325393 3746 dbSNP
rs1017373597 3755 dbSNP
rs1007360215 3756 dbSNP
rs545833901 3766 dbSNP
rs1252021090 3767 dbSNP
rs1192825912 3769 dbSNP
rs1022171429 3771 dbSNP
rs377045267 3775 dbSNP
rs538950658 3783 dbSNP
rs1031645464 3786 dbSNP
rs1157635749 3790 dbSNP
rs1414202290 3805 dbSNP
rs1203561804 3806 dbSNP
rs1164431614 3807 dbSNP
rs1003295155 3810 dbSNP
rs374260936 3816 dbSNP
rs867662541 3843 dbSNP
rs1261322255 3855 dbSNP
rs1202107654 3859 dbSNP
rs1368109778 3865 dbSNP
rs1390691340 3872 dbSNP
rs907260156 3873 dbSNP
rs1346418479 3875 dbSNP
rs556907947 3877 dbSNP
rs1044459173 3883 dbSNP
rs1303286050 3887 dbSNP
rs1228493467 3899 dbSNP
rs866953548 3917 dbSNP
rs1332181830 3920 dbSNP
rs1442153613 3924 dbSNP
rs1223405593 3935 dbSNP
rs186696201 3939 dbSNP
rs1480518915 3945 dbSNP
rs1175925520 3950 dbSNP
rs1325143311 3950 dbSNP
rs1380102729 3953 dbSNP
rs1141637 3954 dbSNP
rs1187270358 3959 dbSNP
rs1415856032 3965 dbSNP
rs1383786556 3966 dbSNP
rs1298338149 3973 dbSNP
rs1165766029 3974 dbSNP
rs1350181998 3980 dbSNP
rs1461319302 3981 dbSNP
rs1306052719 3986 dbSNP
rs948842235 3987 dbSNP
rs887934225 3988 dbSNP
rs1420961064 3991 dbSNP
rs574333818 3995 dbSNP
rs866248323 3996 dbSNP
rs1172889829 3997 dbSNP
rs1478244042 3998 dbSNP
rs555662499 4006 dbSNP
rs1379092023 4008 dbSNP
rs1049720160 4011 dbSNP
rs929550876 4017 dbSNP
rs919516576 4027 dbSNP
rs975739854 4040 dbSNP
rs1262683025 4046 dbSNP
rs1473820386 4052 dbSNP
rs1218956340 4054 dbSNP
rs1182622866 4060 dbSNP
rs1419097939 4065 dbSNP
rs1427008338 4076 dbSNP
rs944374299 4080 dbSNP
rs1166453608 4081 dbSNP
rs1391861059 4083 dbSNP
rs534336423 4084 dbSNP
rs1235596923 4088 dbSNP
rs573272132 4092 dbSNP
rs182081658 4093 dbSNP
rs1449625821 4095 dbSNP
rs1227136402 4096 dbSNP
rs539456381 4102 dbSNP
rs1225806032 4104 dbSNP
rs1300251346 4121 dbSNP
rs369190403 4125 dbSNP
rs1278401049 4126 dbSNP
rs544947196 4136 dbSNP
rs11546549 4142 dbSNP
rs1373041886 4145 dbSNP
rs1241634187 4151 dbSNP
rs187886874 4152 dbSNP
rs190179702 4155 dbSNP
rs541236716 4158 dbSNP
rs1449856990 4159 dbSNP
rs573683142 4160 dbSNP
rs376722253 4161 dbSNP
rs1166002650 4162 dbSNP
rs1172893497 4168 dbSNP
rs1474949246 4179 dbSNP
rs1176121079 4188 dbSNP
rs11546548 4197 dbSNP
rs956619441 4205 dbSNP
rs1424657100 4209 dbSNP
rs1196067587 4216 dbSNP
rs1035353612 4224 dbSNP
rs1422156237 4225 dbSNP
rs1256826568 4226 dbSNP
rs1211680346 4227 dbSNP
rs1220381625 4230 dbSNP
rs112289209 4231 dbSNP
rs907207778 4237 dbSNP
rs1271473887 4245 dbSNP
rs1195626260 4253 dbSNP
rs1465145480 4254 dbSNP
rs1022953013 4261 dbSNP
rs757407344 4267 dbSNP
rs1278465414 4297 dbSNP
rs1191713638 4304 dbSNP
rs1159856359 4315 dbSNP
rs1455213931 4317 dbSNP
rs370493969 4324 dbSNP
rs887881637 4325 dbSNP
rs1460632610 4340 dbSNP
rs1049201368 4345 dbSNP
rs1333251512 4356 dbSNP
rs929472739 4358 dbSNP
rs1279493806 4366 dbSNP
rs1348666025 4376 dbSNP
rs1230335344 4380 dbSNP
rs3762 4385 dbSNP
rs112888446 4394 dbSNP
rs1041023883 4402 dbSNP
rs1287394948 4412 dbSNP
rs1292212564 4416 dbSNP
rs944974492 4419 dbSNP
rs1342248429 4424 dbSNP
rs1232253120 4428 dbSNP
rs1471597330 4453 dbSNP
rs1326736773 4470 dbSNP
rs1183673239 4474 dbSNP
rs1422027788 4477 dbSNP
rs564027899 4499 dbSNP
rs985815538 4509 dbSNP
rs946423521 4510 dbSNP
rs1460012230 4511 dbSNP
rs1406350068 4515 dbSNP
rs1328718291 4527 dbSNP
rs1058705 4531 dbSNP
rs1417397552 4532 dbSNP
rs1182566274 4553 dbSNP
rs1412273864 4557 dbSNP
rs555115844 4570 dbSNP
rs1231704060 4578 dbSNP
rs1242793275 4584 dbSNP
rs183571690 4586 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||||| |   :|||||| 
Target 5' auuGCACCACU---GCACUCCa 3'
10 - 28
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048188
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_ptb_knockdown
Location of target site ENST00000296121.4 | 3UTR | UGAGCUAUGAUUGCACCACUGCACUCCAGCCUGGGCAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*