miRTarBase - #MIRT701807 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MRPS25   
Synonyms MRP-S25, RPMS25
Description mitochondrial ribosomal protein S25
Transcript NM_022497   
Expression
Putative miRNA Targets on MRPS25
3'UTR of MRPS25
(miRNA target sites are highlighted)
>MRPS25|NM_022497|3'UTR
   1 GGCCCACGGTCACTGTGGGCTGGGGTGATGGTGTCTGACCAGTGGGGAGATTGGAATGGGATTACTTTGGCCCAGGGAAG
  81 CCCCTGGTTCTGTCCCTGGAGACTCTGGAAATCCTTTTGCATTAAAAGGACTTTACACACCTGTGTAAAAGGATGTGGGA
 161 GAGGAGGGTCTGAAGCTGAGCTGCTAAATGAATATCCCTGCTCTGCTGGTCAATAAAACGCTTCCTAATAGCAGCTTGGC
 241 GTGTATCTGGTCCTAGTGAAGAGGAAGGCCTGTGTAGCAGAAAGGCTTTGGGCCTGAGAGGTTAAGGCCACAGCCTGTTG
 321 ACACCTGTTTTGGTCCTGCGACCCTTTACTGGTCTCCGCTGGCTTTGAATCTTCCTCTGGGCTCTACTCTGGAGAACATA
 401 AGGGCTGCTGTGGTTGAGTCTGGCTAGCACTGTCTGTGGTTGGCAGTGTGTACACCCCTCCGTTCAGTTCCTTGGGGGTA
 481 TTTTTCAGAAATCCAAAGGCAACCCTTCGTGCAGTGCTCACTTTTTTAAGTACAGTTGATTACCCTTGCCTGCTGGGGGG
 561 CCTAGCCATGGGCCAGAGATGGAGGAGCCCCAGTGGCTGACAGGCCAGCCTCACTCAGGCACGTACCTGCTGACCAGTCA
 641 GCCACTGCCAACCCATGGCCCAGCCACTGTGTGCATTAGCAGGGAGGTTTGTAGGCCATGGAGGAAATGAGGAGACACCA
 721 CCTAGTGGAGACATTGGGGCCCTGCTGGGGGGATGGTGTCTATAGCTGGCTCTGCTGGCTCCCTCAGGCCCTGCTTACCA
 801 AGCTCTGGAGGAGGGAGTGCTGCATTACTGAGCACCTTCCTTGTTCTTTCCTCATAGGACACTGATGTTACTGTCACTTT
 881 AGTTATGCTAAAGTGGAGGTTTCAGCCTCCAGAAGACAGCAGAGCCTTCTAGGGTCACCTTAAGAATAGGTTTAGCTAGG
 961 CTGGGTGTGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGATGTGGGCGGATAGTTGAGCCCAGGAGTTCGAG
1041 ACCAGCCTGGGCAACATGGCAAGACCTTGTCTCTACAAAAAGTACAAAAATTAGATGGGTGTGGTGTTTCGCGTCTGTAG
1121 TCCCAGCTATTTGGGAAGCTGAGGTGGGAGGATCTCGAGCCTGCGAGATCAAGGCTGCAGTGAATCATGATCGTGCGCTA
1201 CTGCACTCCAGCCTGGGCCACAGAGCAAGACTGTCTCAAGAAAAAAAATTTTTTAAATAAGTTTAATTATAAAGTGAAGG
1281 ACCAGTTGGACCACGGACCCCTAGAAACTCAGCCAAGGAGACCTGACTTTATCTGAGACAGGAAGGCAGTGGTTAAAAGA
1361 ATTAAAAAAGGACAGTGGTGCTTGACAGAGCAGGACTGAAGTTTTCATTCCTCTACCTGCTGGGGCCTTGGTCAAGTCCT
1441 AAAAGCTTTCCAGGTCTGTAACTGGTTTTGTCTGTAAAATGGGGAAAAGGTTACCTTTTCTGCCACATGAAGTAGCTGGC
1521 TGGTGAAATGATGTCATACTACGATGTGTTTCATTAACTGTTGGAGATTATCACATTAAATTGAGCAGATTTGGATCTTT
1601 TACATTTGATGCTCAAGTTTGATTCTGTACCAGATCTGGGTTTGGGGTGATGGCTTGTCGGGGGTGGGAGGGGAAGGTGG
1681 GCAGAGACTGATGTATAATGGACAGGTGTTCCTTGAGTGACAGACTTACAAAGGGAGTGTTTAATTGAAATCTAGCATCT
1761 TGTCTCTCTGCTATCAGCATTTTGGCTGGGTGGAAAAAGCTCTCCTCCACAGAGAGCCCTCCCATGTCTGCTGGTTTCAG
1841 TTCCCCACCCAACTGACTGAAGTCTTGACCTTGATACCACCTGCCTGGGCGTTCTACTTGGCTGCAAGGGCTCTTCAGAA
1921 AGCACCTAGTTCCTTTTGGCTTTCATCTGCAGTGTAGGTCTCCATAGCTAGTGACACACAAAGCCTTATGAGAGTATTCC
2001 TTCCCTCTAGGGCCCAAAGAGGCTGCTAACCAGCAGGAATGTCCTGAACCAAAAGGAGTGGTGACCATTCTCTAGACAGA
2081 ATAAATGTCTGGTCCCTAATGGGACAGATAACTAGGGTTTGAGTTCAGGCTTGACACAGGAGCAATGGGCAGTGAGGTGG
2161 ACAGCCCAGACCCTGAAAGGACGTGTGGAGACAGCAGCAGTCCTGTGGTGCAGTTACTGCCTGTGTGGCCAGCTTCACAG
2241 GCAGCAGATAATTTGTGGAAATAAACATTATTTTCTTTTTTTGTTCCCTGTAGGCTACTTGATCCTGGATAGTTTCTCTT
2321 TAAACCTTTGTCTTTCCCTATTTTGTTTAGTAGTGATGAAAGATGGGTTTAAAATATACAGAAATGGGAGAAAATTAATT
2401 AGAGAAAATGTGAGGATTTTATAATTGATAACATGTTCTTAATTTTACTTGCACAAGCAGTGTTCACAGCCTTATTCTGA
2481 AGTGACCACTTTTCTTCTCTTTGAGGCACTACCTGGCAGCACCATCTAAACCTGTATCATCTGCTGTGGTCCCAGTTACT
2561 CAGGAGGCTGAGGCAGGAGGATCACTTGAGCCCAGGAGGTTGAGGCTGGAGTGAGCCATGACTGTACCACTGCATTCCAG
2641 CCTGGGTGACGGAGTGAGGCCCTATCTGCCTGCCAGTGAGTTCTGTCATGCATCAGACTTTGGACCTCAGAATTTTCACC
2721 TGGAACATGAGAGGTCAGATGACATAATGAATATGTTCTAACTTCTGAAACTTTTGGAGCTTGTTTTTGCCCTTGATAGC
2801 ACGTATCCTTAGAGAATAAGCTTGCCAATTTAAGGCCTGTCTGTAATGGCATCTGAATGTTCCAGCAGCCTAACTGTGCT
2881 CTGCTCCAGAAACATGTGTGTGGCTTCCCTACCTCCACACCAAGGAGCTGCCTTGCTGGGTGGATGTAAAGACTGTCCTG
2961 CCAGGGTTTCCCACTAAAGGTATTAATAAGTCCAGTGGACCACAGAGGGCCCAATCCCTCTTGGCCGCTAAGGCTAAGGT
3041 AGGAGCCAGAGAGCTGTAGAGACAGGACCACCAGGATGCTTCATGTCCATAACACAAGAGAGCGCTGCATTGTTTGGGGG
3121 CCAGGCATTACTACTATCATGAAGAAAAATGAAGAGCAGGATGCATGTTAGTCTTTAATTCACTTTTAATAGTATAAACC
3201 TCATTTAGGTAGTAGTATTAAGCCACAACAATAATGCCACATTGAAACAGCATTTAATAAAATGCATAAAGCTAATTCAT
3281 GCACTGCAATACTCTATATACAAACACAACAATGCAAATTCTTCTTCAAGACTGAAGACATTGATTAGATATAAAATTCA
3361 GTTTAAAAAGAACATGCTATTTTTTAAATGCCATCACATAAACAAAGTGATTTCACAGGGAGAAGAAAGCTGTATAAAGC
3441 TGCAGCTTTCAACAGGTTTTAAACCTGGCATTAAAATGTAATGGCAAAACCAATATTTTCTATATTGTGAAGGGCAAAGG
3521 TTACAGAAACGGTCCCAAGAAAATCTAACACCCAAATTTTCCTTTGATAGATAGATGCCTTTAAAAGGGCTGGTAATGCA
3601 GTTACATTCTAACAGAGAAGTCCAAACTACAGGTAAAAACTACGGCTTGTACTGTGAAAAATGTGCAGCTTTTCAGTTAT
3681 AAAACTAGTTGAACACTGGTTTACAAGATAATCCGTAGAACAGAGAGACTGTAGAAAAATATTCCAGCACTTGAGTTGTG
3761 TGTGGCAGCAGCATTTGAGTCCATGAATGCTATGGTCATTAAAATAATTGATTATACTTTCCTAAAGAAAAGCCATTTTT
3841 TAATGCAAAGTCTACTACTTCCAAATGTTATTCCAAACATTAAATTTTAACAGTCTATCAATCAATAAATGTTGAACATT
3921 TTTTTTCTAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACA-------GUGUGAGGu 5'
            | ||: || ||       ::|||||| 
Target 5' gaATCATGATCGTGCGCTACTGCACTCCa 3'
1182 - 1210 132.00 -16.60
2
miRNA  3' guuugugGUAACA-GUGUGAGGu 5'
                 || ||| :|||| || 
Target 5' tggttggCAGTGTGTACACCCCt 3'
437 - 459 123.00 -9.20
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||:: ||  ||:|||:||: 
Target 5' gtAATG-CA--GTTACATTCTa 3'
3593 - 3611 123.00 -12.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31493251 66 COSMIC
COSN30171344 73 COSMIC
COSN31480336 94 COSMIC
COSN30461784 95 COSMIC
COSN30104207 105 COSMIC
COSN30168227 172 COSMIC
COSN17950516 539 COSMIC
COSN25915649 1018 COSMIC
COSN6736285 1025 COSMIC
COSN19316695 1320 COSMIC
COSN1269853 1693 COSMIC
COSN20877879 1947 COSMIC
COSN1921446 2097 COSMIC
COSN24400890 2284 COSMIC
COSN31484679 2318 COSMIC
COSN16323183 2373 COSMIC
COSN15732247 2383 COSMIC
COSN18776812 2393 COSMIC
COSN30678638 2405 COSMIC
COSN4812467 2513 COSMIC
COSN31962026 2630 COSMIC
COSN9136178 2756 COSMIC
COSN17687447 2767 COSMIC
COSN1921445 3046 COSMIC
COSN31551070 3153 COSMIC
COSN20853008 3209 COSMIC
COSN5523807 3259 COSMIC
COSN29356256 3266 COSMIC
COSN29461873 3310 COSMIC
COSN23459781 3319 COSMIC
COSN31609978 3436 COSMIC
COSN31609125 3455 COSMIC
COSN24299629 3464 COSMIC
COSN31590368 3593 COSMIC
COSN31582495 3737 COSMIC
COSN31483108 3873 COSMIC
COSN5038712 3888 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760401821 2 dbSNP
rs1012905061 6 dbSNP
rs1334445142 6 dbSNP
rs752614551 7 dbSNP
rs573622093 8 dbSNP
rs1279398869 10 dbSNP
rs1208280177 16 dbSNP
rs752127041 16 dbSNP
rs1237526317 19 dbSNP
rs1288837152 20 dbSNP
rs759579604 28 dbSNP
rs1244117405 29 dbSNP
rs1352039214 36 dbSNP
rs769842546 45 dbSNP
rs1165943197 47 dbSNP
rs1461192645 48 dbSNP
rs1416758568 49 dbSNP
rs1478281036 53 dbSNP
rs556800936 53 dbSNP
rs922696259 55 dbSNP
rs976798937 65 dbSNP
rs1476770382 83 dbSNP
rs964043522 84 dbSNP
rs911259709 93 dbSNP
rs1178557464 107 dbSNP
rs1425218420 108 dbSNP
rs1331658255 117 dbSNP
rs1035131674 131 dbSNP
rs984516077 134 dbSNP
rs1002606202 138 dbSNP
rs953014575 140 dbSNP
rs1297922767 153 dbSNP
rs11549889 157 dbSNP
rs145943452 158 dbSNP
rs568936897 159 dbSNP
rs1438526667 161 dbSNP
rs552283583 167 dbSNP
rs866355461 184 dbSNP
rs1320909905 188 dbSNP
rs1286431647 189 dbSNP
rs149096072 192 dbSNP
rs970834667 201 dbSNP
rs1024680127 203 dbSNP
rs1216188662 207 dbSNP
rs1262172943 219 dbSNP
rs562048169 219 dbSNP
rs566810761 220 dbSNP
rs898119025 230 dbSNP
rs1466594635 234 dbSNP
rs181451713 238 dbSNP
rs73129440 239 dbSNP
rs777619513 240 dbSNP
rs74471138 241 dbSNP
rs1419907940 243 dbSNP
rs1192875833 245 dbSNP
rs902446449 245 dbSNP
rs1446107897 247 dbSNP
rs911089105 256 dbSNP
rs1042670027 262 dbSNP
rs1324636110 264 dbSNP
rs188354392 273 dbSNP
rs923060850 274 dbSNP
rs1278904179 279 dbSNP
rs1374220817 280 dbSNP
rs576190388 288 dbSNP
rs1038878358 300 dbSNP
rs1239653251 310 dbSNP
rs942790221 317 dbSNP
rs1284225015 321 dbSNP
rs1232007054 327 dbSNP
rs1211353100 330 dbSNP
rs531228799 333 dbSNP
rs1344162201 336 dbSNP
rs911277014 337 dbSNP
rs758368421 339 dbSNP
rs1429725723 346 dbSNP
rs537016905 351 dbSNP
rs17040709 357 dbSNP
rs978548143 358 dbSNP
rs1177613757 360 dbSNP
rs945545970 361 dbSNP
rs968110021 362 dbSNP
rs1459128516 374 dbSNP
rs1164154446 378 dbSNP
rs1396740377 393 dbSNP
rs1390489260 397 dbSNP
rs1022716683 398 dbSNP
rs918852398 406 dbSNP
rs972917167 410 dbSNP
rs1446204840 411 dbSNP
rs1171794453 416 dbSNP
rs1385175105 425 dbSNP
rs1245829715 426 dbSNP
rs1265788656 427 dbSNP
rs1355433485 430 dbSNP
rs752381408 431 dbSNP
rs1207986222 438 dbSNP
rs778796988 440 dbSNP
rs1025133755 442 dbSNP
rs370071613 449 dbSNP
rs1391293840 453 dbSNP
rs959141742 455 dbSNP
rs1032486045 461 dbSNP
rs1425131962 462 dbSNP
rs1000550003 463 dbSNP
rs144658793 466 dbSNP
rs902142503 468 dbSNP
rs1025353593 472 dbSNP
rs377235136 475 dbSNP
rs753514750 478 dbSNP
rs1189194817 485 dbSNP
rs184361322 494 dbSNP
rs1396797266 502 dbSNP
rs1312364785 504 dbSNP
rs1339642586 505 dbSNP
rs1038908932 508 dbSNP
rs73129438 509 dbSNP
rs1318464111 523 dbSNP
rs760262207 523 dbSNP
rs1208046774 524 dbSNP
rs1050962995 527 dbSNP
rs35921655 528 dbSNP
rs749961965 528 dbSNP
rs1200670534 533 dbSNP
rs1255113101 541 dbSNP
rs1440348940 547 dbSNP
rs1484016299 548 dbSNP
rs1275234921 551 dbSNP
rs60483663 554 dbSNP
rs1477767971 556 dbSNP
rs1169213276 557 dbSNP
rs533350116 559 dbSNP
rs573533028 564 dbSNP
rs1302352216 565 dbSNP
rs923762428 567 dbSNP
rs1402118319 568 dbSNP
rs918620923 569 dbSNP
rs536608872 580 dbSNP
rs1276299362 581 dbSNP
rs1313423325 585 dbSNP
rs1245833961 587 dbSNP
rs1233265237 588 dbSNP
rs1254906526 588 dbSNP
rs762407471 592 dbSNP
rs1311187044 598 dbSNP
rs949668242 601 dbSNP
rs918153738 602 dbSNP
rs1488207819 604 dbSNP
rs1192114873 614 dbSNP
rs1411718801 616 dbSNP
rs991240187 619 dbSNP
rs1328766505 622 dbSNP
rs556713016 623 dbSNP
rs915457484 625 dbSNP
rs1408646931 635 dbSNP
rs1376023117 638 dbSNP
rs1421725540 642 dbSNP
rs959342428 643 dbSNP
rs1416427921 655 dbSNP
rs1173523678 657 dbSNP
rs1420417402 658 dbSNP
rs1475347987 662 dbSNP
rs1416672485 665 dbSNP
rs1360920756 668 dbSNP
rs1185220829 669 dbSNP
rs1410189389 669 dbSNP
rs1473278209 670 dbSNP
rs1369557072 674 dbSNP
rs774542040 675 dbSNP
rs928221823 683 dbSNP
rs145237834 690 dbSNP
rs1241866141 691 dbSNP
rs1286361149 697 dbSNP
rs1032100805 698 dbSNP
rs979553463 700 dbSNP
rs868174881 705 dbSNP
rs769035164 712 dbSNP
rs1214823571 715 dbSNP
rs1267641516 715 dbSNP
rs1489067048 721 dbSNP
rs1203735554 725 dbSNP
rs1435962796 730 dbSNP
rs950916828 734 dbSNP
rs1214060083 742 dbSNP
rs763358749 745 dbSNP
rs1441692334 747 dbSNP
rs997164978 748 dbSNP
rs1334503767 752 dbSNP
rs1379855026 753 dbSNP
rs1291656513 757 dbSNP
rs901779901 758 dbSNP
rs1230382741 759 dbSNP
rs962792440 762 dbSNP
rs1351426678 764 dbSNP
rs577850050 764 dbSNP
rs549244878 765 dbSNP
rs1007404429 769 dbSNP
rs1368135493 772 dbSNP
rs1278973966 778 dbSNP
rs1006566643 782 dbSNP
rs1375647737 785 dbSNP
rs1221741080 790 dbSNP
rs150436253 794 dbSNP
rs1440674980 805 dbSNP
rs1352083283 807 dbSNP
rs1322736397 810 dbSNP
rs538607417 822 dbSNP
rs1048882317 840 dbSNP
rs1461227225 846 dbSNP
rs1237678783 860 dbSNP
rs1051042663 863 dbSNP
rs931420736 864 dbSNP
rs897227028 875 dbSNP
rs1162341374 879 dbSNP
rs1473328782 880 dbSNP
rs998100543 882 dbSNP
rs1037018424 886 dbSNP
rs1424237814 895 dbSNP
rs1163825890 897 dbSNP
rs949366643 903 dbSNP
rs1176086524 904 dbSNP
rs1467147692 912 dbSNP
rs115843208 922 dbSNP
rs775676226 925 dbSNP
rs946541097 931 dbSNP
rs938195496 932 dbSNP
rs181407311 934 dbSNP
rs1270967558 935 dbSNP
rs188865337 936 dbSNP
rs938019102 937 dbSNP
rs1320573429 942 dbSNP
rs1219808667 945 dbSNP
rs979617972 946 dbSNP
rs1317691871 956 dbSNP
rs927958481 961 dbSNP
rs982367948 965 dbSNP
rs966884687 967 dbSNP
rs1020691168 977 dbSNP
rs919489791 981 dbSNP
rs1440711362 982 dbSNP
rs567906287 988 dbSNP
rs965667853 991 dbSNP
rs1478747491 995 dbSNP
rs963540696 998 dbSNP
rs1322898212 1013 dbSNP
rs1407775180 1015 dbSNP
rs1335641806 1016 dbSNP
rs1017533898 1023 dbSNP
rs1007925524 1027 dbSNP
rs1359312748 1034 dbSNP
rs372456073 1037 dbSNP
rs1006637104 1038 dbSNP
rs1157801396 1042 dbSNP
rs1398440718 1043 dbSNP
rs531243249 1045 dbSNP
rs953731645 1047 dbSNP
rs34410685 1052 dbSNP
rs1174193763 1057 dbSNP
rs529481551 1059 dbSNP
rs1250931392 1063 dbSNP
rs998131819 1068 dbSNP
rs1486339218 1069 dbSNP
rs1241721093 1071 dbSNP
rs902440343 1080 dbSNP
rs1213800575 1083 dbSNP
rs1194286604 1092 dbSNP
rs1020845595 1094 dbSNP
rs1314014791 1098 dbSNP
rs551380520 1104 dbSNP
rs1425291530 1105 dbSNP
rs1413536491 1110 dbSNP
rs745889858 1111 dbSNP
rs893605449 1112 dbSNP
rs781352702 1113 dbSNP
rs1383109522 1117 dbSNP
rs1055170038 1124 dbSNP
rs1439244975 1126 dbSNP
rs546313026 1127 dbSNP
rs1287919211 1131 dbSNP
rs1288500186 1152 dbSNP
rs140429777 1156 dbSNP
rs185701543 1157 dbSNP
rs896451902 1160 dbSNP
rs1283335226 1161 dbSNP
rs1445163784 1162 dbSNP
rs1055047329 1164 dbSNP
rs1046367322 1167 dbSNP
rs938298060 1168 dbSNP
rs929286956 1174 dbSNP
rs1381705148 1175 dbSNP
rs369485344 1177 dbSNP
rs1158365682 1179 dbSNP
rs919506885 1182 dbSNP
rs1173664408 1185 dbSNP
rs1407542707 1188 dbSNP
rs1324854337 1189 dbSNP
rs573396681 1192 dbSNP
rs1044301424 1193 dbSNP
rs768364051 1196 dbSNP
rs1170308645 1197 dbSNP
rs913660756 1198 dbSNP
rs1239727884 1199 dbSNP
rs1278717739 1200 dbSNP
rs1368501225 1205 dbSNP
rs1348327328 1206 dbSNP
rs1211562827 1216 dbSNP
rs1290578281 1219 dbSNP
rs1467980222 1221 dbSNP
rs975787889 1225 dbSNP
rs115347829 1227 dbSNP
rs1239486446 1229 dbSNP
rs778761368 1231 dbSNP
rs1180692071 1234 dbSNP
rs1362414185 1237 dbSNP
rs953764395 1246 dbSNP
rs193246327 1248 dbSNP
rs1460370098 1249 dbSNP
rs187778486 1249 dbSNP
rs966362760 1249 dbSNP
rs557739999 1250 dbSNP
rs1021298554 1251 dbSNP
rs564652426 1254 dbSNP
rs1333754969 1255 dbSNP
rs201759705 1255 dbSNP
rs893667106 1257 dbSNP
rs573184757 1259 dbSNP
rs1284597367 1263 dbSNP
rs184267945 1264 dbSNP
rs1033453899 1266 dbSNP
rs1210217111 1269 dbSNP
rs1002271023 1274 dbSNP
rs1457874257 1276 dbSNP
rs1485007028 1283 dbSNP
rs79870383 1286 dbSNP
rs1443795452 1294 dbSNP
rs1046427059 1295 dbSNP
rs993753365 1299 dbSNP
rs1417624602 1308 dbSNP
rs1173504970 1310 dbSNP
rs1424423934 1315 dbSNP
rs1307289098 1319 dbSNP
rs1166244237 1325 dbSNP
rs961821631 1330 dbSNP
rs1404566095 1331 dbSNP
rs1396849913 1332 dbSNP
rs1313238405 1335 dbSNP
rs897820096 1338 dbSNP
rs191819202 1339 dbSNP
rs1013662977 1341 dbSNP
rs896569191 1353 dbSNP
rs1318526726 1360 dbSNP
rs1225980335 1364 dbSNP
rs1212467542 1370 dbSNP
rs1249150128 1370 dbSNP
rs1200728462 1376 dbSNP
rs557593458 1378 dbSNP
rs1002185525 1379 dbSNP
rs1196453766 1380 dbSNP
rs1264457867 1381 dbSNP
rs1413605858 1383 dbSNP
rs1428472966 1384 dbSNP
rs904115674 1394 dbSNP
rs1299806705 1398 dbSNP
rs574998865 1402 dbSNP
rs1353717690 1413 dbSNP
rs1167993649 1418 dbSNP
rs1043949743 1424 dbSNP
rs755846776 1425 dbSNP
rs945538501 1427 dbSNP
rs1432564520 1434 dbSNP
rs537616869 1438 dbSNP
rs1299807652 1441 dbSNP
rs1362527723 1444 dbSNP
rs1187389226 1450 dbSNP
rs1040554079 1462 dbSNP
rs1292796685 1469 dbSNP
rs1332362464 1470 dbSNP
rs1233517287 1474 dbSNP
rs1279237205 1483 dbSNP
rs1474266685 1487 dbSNP
rs187045283 1507 dbSNP
rs1196900285 1530 dbSNP
rs1480565708 1533 dbSNP
rs1250009604 1534 dbSNP
rs571927264 1540 dbSNP
rs551818366 1542 dbSNP
rs528758551 1543 dbSNP
rs930298889 1545 dbSNP
rs565585314 1559 dbSNP
rs1393425184 1563 dbSNP
rs1441813930 1564 dbSNP
rs920517518 1569 dbSNP
rs111856392 1573 dbSNP
rs1293513950 1574 dbSNP
rs1345621873 1578 dbSNP
rs146790871 1582 dbSNP
rs528964614 1583 dbSNP
rs989825367 1586 dbSNP
rs1440931636 1591 dbSNP
rs767086851 1597 dbSNP
rs1368272704 1602 dbSNP
rs961933951 1604 dbSNP
rs1241932595 1606 dbSNP
rs1308116774 1608 dbSNP
rs1024127224 1612 dbSNP
rs371785281 1619 dbSNP
rs1214254499 1621 dbSNP
rs562996694 1622 dbSNP
rs1267690264 1633 dbSNP
rs1033527386 1635 dbSNP
rs992607585 1638 dbSNP
rs960795164 1639 dbSNP
rs1033739306 1640 dbSNP
rs1459244349 1653 dbSNP
rs543234595 1653 dbSNP
rs1296290909 1659 dbSNP
rs993597098 1660 dbSNP
rs1395585095 1665 dbSNP
rs143862984 1667 dbSNP
rs1460019366 1673 dbSNP
rs1414311813 1680 dbSNP
rs903813084 1687 dbSNP
rs1461924198 1688 dbSNP
rs1037695236 1690 dbSNP
rs1391700514 1695 dbSNP
rs1006607463 1697 dbSNP
rs759307474 1702 dbSNP
rs1022713411 1706 dbSNP
rs1249003754 1707 dbSNP
rs1222352796 1708 dbSNP
rs1009854239 1712 dbSNP
rs116960223 1715 dbSNP
rs1469185999 1721 dbSNP
rs533269688 1723 dbSNP
rs866339633 1723 dbSNP
rs1271320048 1735 dbSNP
rs1459200573 1751 dbSNP
rs1189653501 1770 dbSNP
rs1205473608 1771 dbSNP
rs1040587175 1773 dbSNP
rs1479783141 1780 dbSNP
rs944834596 1784 dbSNP
rs773315882 1789 dbSNP
rs1041232570 1793 dbSNP
rs888883673 1808 dbSNP
rs1050150508 1809 dbSNP
rs541013674 1814 dbSNP
rs930309902 1816 dbSNP
rs1466676239 1817 dbSNP
rs7640547 1823 dbSNP
rs761271955 1824 dbSNP
rs752085061 1825 dbSNP
rs1439596012 1835 dbSNP
rs1304941163 1838 dbSNP
rs1239115539 1843 dbSNP
rs957904473 1844 dbSNP
rs556840024 1846 dbSNP
rs1304784003 1851 dbSNP
rs1442933112 1852 dbSNP
rs940642245 1853 dbSNP
rs1215169038 1855 dbSNP
rs1371476471 1855 dbSNP
rs1272420078 1858 dbSNP
rs1324918030 1859 dbSNP
rs917147051 1865 dbSNP
rs1305936717 1869 dbSNP
rs1439025354 1869 dbSNP
rs62240397 1875 dbSNP
rs1159268916 1877 dbSNP
rs1485909606 1884 dbSNP
rs183110952 1889 dbSNP
rs958496206 1890 dbSNP
rs574204994 1891 dbSNP
rs1255228898 1895 dbSNP
rs557459163 1899 dbSNP
rs1024745232 1900 dbSNP
rs75860679 1907 dbSNP
rs745427619 1909 dbSNP
rs1455038961 1917 dbSNP
rs780982722 1925 dbSNP
rs1177880871 1928 dbSNP
rs962166071 1932 dbSNP
rs1434428926 1933 dbSNP
rs1252783861 1938 dbSNP
rs1311448918 1940 dbSNP
rs1342896379 1944 dbSNP
rs1016739252 1947 dbSNP
rs1269638298 1958 dbSNP
rs571773252 1960 dbSNP
rs1221141843 1961 dbSNP
rs980917986 1965 dbSNP
rs1192095534 1966 dbSNP
rs544884990 1970 dbSNP
rs1209833504 1988 dbSNP
rs1277948746 1990 dbSNP
rs1448635022 1993 dbSNP
rs79399840 1999 dbSNP
rs1263394948 2000 dbSNP
rs1474176447 2004 dbSNP
rs1022321440 2005 dbSNP
rs1205279133 2006 dbSNP
rs1050699424 2008 dbSNP
rs1009550447 2011 dbSNP
rs1453453376 2021 dbSNP
rs1172111371 2034 dbSNP
rs1362903095 2035 dbSNP
rs535046360 2043 dbSNP
rs1318310602 2049 dbSNP
rs1343962957 2050 dbSNP
rs902033605 2062 dbSNP
rs1041874519 2063 dbSNP
rs1349340355 2066 dbSNP
rs757255178 2070 dbSNP
rs1258377420 2071 dbSNP
rs913668325 2073 dbSNP
rs1236433889 2078 dbSNP
rs1053914235 2079 dbSNP
rs1224264299 2081 dbSNP
rs936376893 2087 dbSNP
rs1445215732 2092 dbSNP
rs1214970861 2095 dbSNP
rs1253110568 2101 dbSNP
rs544293525 2103 dbSNP
rs190748101 2107 dbSNP
rs1019181666 2117 dbSNP
rs980681807 2121 dbSNP
rs1231773611 2126 dbSNP
rs1009079498 2146 dbSNP
rs970606063 2148 dbSNP
rs1407592545 2149 dbSNP
rs1326633777 2157 dbSNP
rs548571570 2166 dbSNP
rs1438982558 2171 dbSNP
rs889252887 2173 dbSNP
rs917804977 2182 dbSNP
rs1051030665 2183 dbSNP
rs1239421148 2184 dbSNP
rs575564610 2189 dbSNP
rs1278771690 2190 dbSNP
rs1348395078 2193 dbSNP
rs930444568 2195 dbSNP
rs1016355706 2198 dbSNP
rs763236610 2199 dbSNP
rs1211292703 2201 dbSNP
rs1028980145 2202 dbSNP
rs775845786 2204 dbSNP
rs528829641 2208 dbSNP
rs997793318 2210 dbSNP
rs1036012052 2212 dbSNP
rs902107299 2217 dbSNP
rs1459892088 2219 dbSNP
rs1169732136 2220 dbSNP
rs1476593192 2227 dbSNP
rs1373932894 2230 dbSNP
rs1391060953 2240 dbSNP
rs146649559 2240 dbSNP
rs1193478231 2248 dbSNP
rs1333808417 2251 dbSNP
rs1010413377 2253 dbSNP
rs549493708 2255 dbSNP
rs1446017000 2258 dbSNP
rs1293767169 2267 dbSNP
rs373366121 2271 dbSNP
rs759783203 2274 dbSNP
rs1230883103 2275 dbSNP
rs564167673 2276 dbSNP
rs1252573411 2277 dbSNP
rs1339628617 2278 dbSNP
rs1212368336 2282 dbSNP
rs1271313557 2283 dbSNP
rs542127954 2286 dbSNP
rs188596354 2287 dbSNP
rs936409446 2290 dbSNP
rs1288362082 2294 dbSNP
rs1279504933 2321 dbSNP
rs1195357592 2328 dbSNP
rs1373769874 2330 dbSNP
rs1461644236 2332 dbSNP
rs1166441566 2335 dbSNP
rs1231894337 2338 dbSNP
rs904896986 2340 dbSNP
rs1044723216 2346 dbSNP
rs1313293848 2348 dbSNP
rs1436279482 2348 dbSNP
rs1354687649 2351 dbSNP
rs927180908 2352 dbSNP
rs771018776 2360 dbSNP
rs978986633 2362 dbSNP
rs968182045 2364 dbSNP
rs1226220598 2365 dbSNP
rs1267988542 2365 dbSNP
rs879068354 2391 dbSNP
rs1349609753 2394 dbSNP
rs1226991112 2397 dbSNP
rs917844815 2402 dbSNP
rs1295240320 2404 dbSNP
rs1415449626 2409 dbSNP
rs1262513743 2410 dbSNP
rs748430272 2410 dbSNP
rs747112130 2421 dbSNP
rs915286920 2425 dbSNP
rs988155059 2427 dbSNP
rs1412080831 2432 dbSNP
rs142919687 2433 dbSNP
rs1174003563 2441 dbSNP
rs1374664945 2454 dbSNP
rs1464476718 2455 dbSNP
rs780561108 2456 dbSNP
rs909035426 2458 dbSNP
rs758855825 2460 dbSNP
rs773832705 2465 dbSNP
rs770471808 2467 dbSNP
rs1484847131 2469 dbSNP
rs1385601793 2470 dbSNP
rs1019212849 2479 dbSNP
rs1214127104 2480 dbSNP
rs1381099744 2486 dbSNP
rs762540985 2486 dbSNP
rs1333814833 2492 dbSNP
rs1271556713 2494 dbSNP
rs1220657077 2495 dbSNP
rs755715294 2496 dbSNP
rs750586172 2499 dbSNP
rs1243485840 2503 dbSNP
rs1294924795 2506 dbSNP
rs765535188 2510 dbSNP
rs1370370985 2511 dbSNP
rs1327118516 2512 dbSNP
rs1440657996 2514 dbSNP
rs1392710015 2516 dbSNP
rs1323533201 2519 dbSNP
rs984896948 2521 dbSNP
rs1463198124 2522 dbSNP
rs953426993 2524 dbSNP
rs1373208638 2533 dbSNP
rs1169154477 2534 dbSNP
rs1426176286 2536 dbSNP
rs772862365 2538 dbSNP
rs1485844590 2539 dbSNP
rs561937199 2540 dbSNP
rs1467896619 2545 dbSNP
rs1250903467 2546 dbSNP
rs543062250 2558 dbSNP
rs761970807 2563 dbSNP
rs976097107 2566 dbSNP
rs1481089075 2567 dbSNP
rs774337705 2579 dbSNP
rs1202564911 2584 dbSNP
rs1313977003 2586 dbSNP
rs953750371 2590 dbSNP
rs1234162824 2591 dbSNP
rs1369335110 2596 dbSNP
rs1311905023 2598 dbSNP
rs1364273989 2600 dbSNP
rs1452998867 2601 dbSNP
rs1392272442 2606 dbSNP
rs1317932718 2607 dbSNP
rs1029192331 2613 dbSNP
rs1396776279 2615 dbSNP
rs965993971 2616 dbSNP
rs1020570741 2626 dbSNP
rs995396510 2630 dbSNP
rs1460067438 2634 dbSNP
rs1365054652 2641 dbSNP
rs1010903810 2642 dbSNP
rs772434506 2650 dbSNP
rs1033584452 2651 dbSNP
rs1453711192 2660 dbSNP
rs758572691 2663 dbSNP
rs1183726753 2664 dbSNP
rs1194978731 2665 dbSNP
rs1335613158 2667 dbSNP
rs1213155661 2668 dbSNP
rs1251303489 2673 dbSNP
rs1481761473 2675 dbSNP
rs898933870 2680 dbSNP
rs1251040663 2685 dbSNP
rs6807852 2688 dbSNP
rs1044755341 2689 dbSNP
rs1004507254 2692 dbSNP
rs1234061698 2696 dbSNP
rs10510437 2700 dbSNP
rs114431034 2704 dbSNP
rs937300140 2717 dbSNP
rs1348361600 2721 dbSNP
rs780019201 2723 dbSNP
rs1347704005 2725 dbSNP
rs927182191 2726 dbSNP
rs1463246506 2727 dbSNP
rs1299069942 2736 dbSNP
rs1373136272 2749 dbSNP
rs1336839347 2751 dbSNP
rs1356662599 2753 dbSNP
rs1232710774 2755 dbSNP
rs114486607 2767 dbSNP
rs558075435 2774 dbSNP
rs1251668913 2783 dbSNP
rs1408561606 2784 dbSNP
rs1179767607 2788 dbSNP
rs1259474782 2788 dbSNP
rs1397754025 2790 dbSNP
rs1186572955 2792 dbSNP
rs1411041896 2795 dbSNP
rs1429923460 2796 dbSNP
rs535171973 2797 dbSNP
rs572424938 2798 dbSNP
rs755791006 2800 dbSNP
rs745504411 2802 dbSNP
rs555606511 2803 dbSNP
rs761276535 2805 dbSNP
rs35420346 2809 dbSNP
rs1414770358 2812 dbSNP
rs143941558 2816 dbSNP
rs911932314 2822 dbSNP
rs1364259646 2828 dbSNP
rs1215372940 2835 dbSNP
rs756779182 2839 dbSNP
rs1471140618 2840 dbSNP
rs987456863 2841 dbSNP
rs1233361099 2842 dbSNP
rs1180891718 2846 dbSNP
rs1456282802 2851 dbSNP
rs1274757421 2855 dbSNP
rs576883640 2858 dbSNP
rs1485938349 2859 dbSNP
rs1209410816 2865 dbSNP
rs976158076 2868 dbSNP
rs556990076 2876 dbSNP
rs764525765 2883 dbSNP
rs995022690 2893 dbSNP
rs957869954 2894 dbSNP
rs1033202854 2895 dbSNP
rs775428210 2896 dbSNP
rs569359643 2897 dbSNP
rs1431492040 2903 dbSNP
rs758927419 2910 dbSNP
rs1363257547 2921 dbSNP
rs1236816505 2931 dbSNP
rs184060881 2932 dbSNP
rs1023373995 2939 dbSNP
rs1373660550 2953 dbSNP
rs374817386 2958 dbSNP
rs1276335685 2963 dbSNP
rs1013283775 2965 dbSNP
rs1441218403 2979 dbSNP
rs1004623452 2980 dbSNP
rs895553452 2983 dbSNP
rs1477873871 2985 dbSNP
rs896175012 2986 dbSNP
rs1410753216 2987 dbSNP
rs1056746183 2998 dbSNP
rs1401843791 3010 dbSNP
rs1158434508 3016 dbSNP
rs1001582473 3017 dbSNP
rs1386627286 3022 dbSNP
rs905791625 3023 dbSNP
rs1043332977 3026 dbSNP
rs570482669 3027 dbSNP
rs1435443791 3039 dbSNP
rs148431054 3040 dbSNP
rs1352728811 3042 dbSNP
rs947244951 3047 dbSNP
rs891675627 3061 dbSNP
rs1437695745 3062 dbSNP
rs1326537175 3065 dbSNP
rs1215037889 3069 dbSNP
rs1450717286 3075 dbSNP
rs1197169817 3080 dbSNP
rs547300238 3082 dbSNP
rs527450533 3083 dbSNP
rs1048967755 3084 dbSNP
rs1182159211 3087 dbSNP
rs753017884 3088 dbSNP
rs192272659 3096 dbSNP
rs548534376 3101 dbSNP
rs1040506292 3103 dbSNP
rs765553289 3104 dbSNP
rs531631652 3106 dbSNP
rs759940236 3107 dbSNP
rs1442819745 3119 dbSNP
rs563711035 3120 dbSNP
rs1447658396 3122 dbSNP
rs1287589154 3133 dbSNP
rs774979745 3134 dbSNP
rs922210245 3135 dbSNP
rs1234550447 3139 dbSNP
rs1350626227 3141 dbSNP
rs766573171 3143 dbSNP
rs1355167511 3149 dbSNP
rs1304679719 3151 dbSNP
rs543757981 3154 dbSNP
rs1233990969 3156 dbSNP
rs913287269 3159 dbSNP
rs1369861545 3161 dbSNP
rs989239368 3166 dbSNP
rs149489735 3171 dbSNP
rs1476485513 3179 dbSNP
rs1188718157 3189 dbSNP
rs963654222 3191 dbSNP
rs1015074815 3208 dbSNP
rs1471931460 3210 dbSNP
rs983563535 3218 dbSNP
rs1169928228 3221 dbSNP
rs926217361 3223 dbSNP
rs1345295484 3225 dbSNP
rs959798966 3225 dbSNP
rs1307219775 3229 dbSNP
rs1316971325 3231 dbSNP
rs1035372128 3233 dbSNP
rs1001214972 3235 dbSNP
rs1471441903 3236 dbSNP
rs905488204 3242 dbSNP
rs1416584241 3245 dbSNP
rs564574924 3274 dbSNP
rs1293363074 3277 dbSNP
rs1339421712 3277 dbSNP
rs1396791878 3281 dbSNP
rs1174094248 3287 dbSNP
rs1339696158 3289 dbSNP
rs1453574033 3295 dbSNP
rs1204822233 3296 dbSNP
rs1272993587 3297 dbSNP
rs1486923399 3298 dbSNP
rs541278999 3301 dbSNP
rs765121543 3307 dbSNP
rs970238027 3311 dbSNP
rs1188515930 3313 dbSNP
rs1024408308 3314 dbSNP
rs1486286592 3321 dbSNP
rs760745177 3324 dbSNP
rs1449118106 3327 dbSNP
rs1013363468 3328 dbSNP
rs1388159262 3329 dbSNP
rs139419191 3332 dbSNP
rs368637222 3337 dbSNP
rs555518307 3339 dbSNP
rs535786898 3341 dbSNP
rs1393748901 3343 dbSNP
rs374450324 3343 dbSNP
rs773183266 3345 dbSNP
rs1365443394 3347 dbSNP
rs1281649930 3352 dbSNP
rs943830129 3352 dbSNP
rs1295855438 3358 dbSNP
rs1210700289 3360 dbSNP
rs1004957659 3361 dbSNP
rs1255852170 3363 dbSNP
rs1343535624 3365 dbSNP
rs1206927180 3367 dbSNP
rs1262581275 3370 dbSNP
rs1464606797 3370 dbSNP
rs887415637 3374 dbSNP
rs1049040314 3377 dbSNP
rs768668248 3379 dbSNP
rs1176563183 3380 dbSNP
rs1298123235 3381 dbSNP
rs996077116 3383 dbSNP
rs1052240673 3385 dbSNP
rs1159761584 3398 dbSNP
rs900366731 3399 dbSNP
rs1215994654 3407 dbSNP
rs932081199 3409 dbSNP
rs1040245002 3412 dbSNP
rs754000525 3415 dbSNP
rs1318054077 3420 dbSNP
rs944534184 3423 dbSNP
rs1178076696 3428 dbSNP
rs913311561 3431 dbSNP
rs1301047026 3432 dbSNP
rs1310937078 3438 dbSNP
rs576289118 3443 dbSNP
rs1261369557 3445 dbSNP
rs761024411 3451 dbSNP
rs1471362777 3456 dbSNP
rs1275234607 3458 dbSNP
rs772569104 3460 dbSNP
rs1191533371 3464 dbSNP
rs1053177900 3467 dbSNP
rs575788239 3469 dbSNP
rs1431363731 3471 dbSNP
rs1397579425 3476 dbSNP
rs936035742 3476 dbSNP
rs1377275363 3478 dbSNP
rs925951602 3482 dbSNP
rs980343260 3484 dbSNP
rs1313416491 3489 dbSNP
rs1396162844 3491 dbSNP
rs973415542 3493 dbSNP
rs1357233575 3502 dbSNP
rs111789770 3506 dbSNP
rs555890366 3515 dbSNP
rs1365999000 3516 dbSNP
rs908109185 3520 dbSNP
rs993423703 3523 dbSNP
rs1350442490 3525 dbSNP
rs983596446 3530 dbSNP
rs1419046615 3531 dbSNP
rs547059719 3534 dbSNP
rs528895409 3535 dbSNP
rs960163393 3538 dbSNP
rs1187897744 3542 dbSNP
rs1487350894 3546 dbSNP
rs775018747 3551 dbSNP
rs1035448991 3552 dbSNP
rs775768528 3555 dbSNP
rs1424028523 3564 dbSNP
rs1253493074 3566 dbSNP
rs1163558210 3569 dbSNP
rs983212674 3569 dbSNP
rs749271920 3572 dbSNP
rs1027310894 3573 dbSNP
rs1257030496 3576 dbSNP
rs1408580152 3577 dbSNP
rs995813793 3577 dbSNP
rs1356834339 3579 dbSNP
rs1293312974 3583 dbSNP
rs539393985 3587 dbSNP
rs1380052682 3593 dbSNP
rs1021738126 3594 dbSNP
rs1376841639 3599 dbSNP
rs1299716533 3601 dbSNP
rs1462291885 3605 dbSNP
rs1230281920 3609 dbSNP
rs1399925818 3609 dbSNP
rs1011225823 3613 dbSNP
rs775610190 3614 dbSNP
rs1275151917 3615 dbSNP
rs79202900 3616 dbSNP
rs769692572 3617 dbSNP
rs1483250341 3629 dbSNP
rs1168798182 3631 dbSNP
rs1180803109 3643 dbSNP
rs570471498 3644 dbSNP
rs547507611 3648 dbSNP
rs926643130 3649 dbSNP
rs891620775 3650 dbSNP
rs35143785 3662 dbSNP
rs982546740 3662 dbSNP
rs1422633634 3665 dbSNP
rs1428367321 3672 dbSNP
rs1315287343 3679 dbSNP
rs1360256857 3680 dbSNP
rs1008073172 3681 dbSNP
rs891002700 3682 dbSNP
rs745369775 3691 dbSNP
rs936080704 3696 dbSNP
rs185962062 3704 dbSNP
rs996692052 3705 dbSNP
rs745708505 3707 dbSNP
rs568306398 3710 dbSNP
rs548393239 3713 dbSNP
rs1236671907 3714 dbSNP
rs180696818 3715 dbSNP
rs942006444 3719 dbSNP
rs908141853 3725 dbSNP
rs1235282561 3729 dbSNP
rs567703146 3740 dbSNP
rs940216604 3742 dbSNP
rs938935854 3744 dbSNP
rs1447974324 3745 dbSNP
rs928830954 3747 dbSNP
rs1414450739 3753 dbSNP
rs980282198 3759 dbSNP
rs951788909 3771 dbSNP
rs1027383369 3772 dbSNP
rs970235887 3774 dbSNP
rs1319915018 3781 dbSNP
rs1309052179 3784 dbSNP
rs1432568657 3792 dbSNP
rs1391830477 3793 dbSNP
rs1368175434 3804 dbSNP
rs371257586 3806 dbSNP
rs1218641215 3813 dbSNP
rs1275878437 3821 dbSNP
rs1330533143 3833 dbSNP
rs1208816360 3834 dbSNP
rs1328999013 3835 dbSNP
rs776213938 3842 dbSNP
rs1201435755 3852 dbSNP
rs1247699856 3854 dbSNP
rs1477987296 3854 dbSNP
rs1190041975 3856 dbSNP
rs1414860786 3857 dbSNP
rs1443435978 3871 dbSNP
rs964342040 3874 dbSNP
rs549308161 3880 dbSNP
rs1456454752 3883 dbSNP
rs1008814470 3886 dbSNP
rs1463246285 3890 dbSNP
rs780817655 3893 dbSNP
rs1350309481 3900 dbSNP
rs1418958765 3900 dbSNP
rs1272933415 3904 dbSNP
rs1352291324 3904 dbSNP
rs1287218833 3907 dbSNP
rs891645719 3907 dbSNP
rs34458561 3913 dbSNP
rs1378882179 3914 dbSNP
rs1031488347 3916 dbSNP
rs1195854070 3917 dbSNP
rs1211338919 3918 dbSNP
rs1291024662 3919 dbSNP
rs999954732 3920 dbSNP
rs1219835115 3922 dbSNP
rs1254527791 3926 dbSNP
rs1181506782 3927 dbSNP
rs1473230887 3927 dbSNP
rs768359396 3927 dbSNP
rs904631635 3927 dbSNP
rs1044420273 3929 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guUUGUGGUAACA-------GUGUGAGGu 5'
            | ||: || ||       ::|||||| 
Target 5' gaAUCAUGAUCGUGCGCUACUGCACUCCa 3'
2 - 30
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000253686.2 | 3UTR | UGAAUCAUGAUCGUGCGCUACUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*