miRTarBase - #MIRT702174 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LYRM4   
Synonyms C6orf149, CGI-203, COXPD19, ISD11
Description LYR motif containing 4
Transcript NM_001164841   
Other Transcripts NM_001164840 , NM_020408   
Expression
Putative miRNA Targets on LYRM4
3'UTR of LYRM4
(miRNA target sites are highlighted)
>LYRM4|NM_001164841|3'UTR
   1 GGAAACCACCTGACAGACGTTTGCTCTTCCTCACAGAGCTGGTCCACATTGGCCAACTGTATTCAACTGACAAGCTGATC
  81 ATTGAGAATCGAGACATGCCCAGGACCTAGCAAGCCGGGGACCAGCCACCAGTGGCGGCCAGGGACCACCTTCAGCATCC
 161 ACTCTCTGTTTGAGATGGGGGCTCCCAAAACCAGCTTACAATAGCCTTTTGCGCTGCCTGTCCTGTGGGAGCTGATAAAC
 241 CAAGTCACATTTGCATTCTGTTGCAGGCTTAGTGAAAAAGGACTGCTGTCTTTCCTTGGTTCAAGTGTTAGAATGGAGAG
 321 CTGGAGTTCGTTCAGAATAGTGCTGTGTGTTACCACGTCTCCCCTGCACCCCATTCCTACCTTGTAGCTCATGACCATTG
 401 TGTATAGCATTTCTACACTTTGTTTCTTGGTCCTTGGCAATAAAAAGAATGATCTCCCTGAGCCTTTGACCCCAGATAAA
 481 CCCCTCCCAATTAATGCATTTTCATTTCCTACTGATACAAGGCCTGGAGAGGGCTGTTGGGGGCCCTCAGGGAGGGTTCA
 561 ACTCTGAGACGAGAACTGCCTTGGTGAAGGCAAGTTCAAGCACCACTTGAGACTGGGGGCAGCATGGAGTAGGGCAGGGC
 641 TACGGGGATACACGGTGCACCCTGCAACTTATACCTGAGCCCAGTACAACAAAGGTGACGGGTGTGTAGGTACACACCCA
 721 GAGATGGAGCACTGCAGATCAGCAACCTCAGCCCCACCTGGGAATTTGCTGGAAATGCAGGCTCAAGCCCCTCCCCACAC
 801 CTGGTGAATGAGAGAGCCCCAGCCTGACCCAAGCCCAGGGCGACTCCCATACCCTGAAGCCTGGGGCATGCTGGGCAGCA
 881 CCGGTGCCCAAATCTGGCTGGTGGACAGAAGCACCTGGAGAGTTGGAGAGCTTTTTAAAAAGACATCTCTCAGCACTTCC
 961 CTCTCTGCAGATTCTGACTCAGTAAGTGAGGGGTGAGGCACAGTCATTTTTCTCTATTCTGAAGCTCTCCCACTGTTTTC
1041 AATGTTTAACCAACTGGGGACCCCTGCTCTTTAAGTATATTACAGGTAATAAAGATATTGTTTGTATGCTTTTAAAAAAA
1121 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |:| ||||  :|||||:: 
Target 5' tgtATAGCATTTCTACACTTTg 3'
401 - 422 131.00 -11.80
2
miRNA  3' guUUGUGGUA-ACAG-UGUGAGGu 5'
            || : ||| | || :||||:| 
Target 5' aaAAAGACATCTCTCAGCACTTCc 3'
937 - 960 124.00 -14.30
3
miRNA  3' guuugugGUAACAGUGUGAGGu 5'
                 ::| | :|||| || 
Target 5' acgggtgTGTAGGTACACACCc 3'
698 - 719 115.00 -13.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
680627 221 ClinVar
680628 224 ClinVar
680629 34415 ClinVar
680636 34431 ClinVar
680631 34432 ClinVar
680632 34468 ClinVar
COSN32075635 26 COSMIC
COSN30685405 69 COSMIC
COSN17080416 80 COSMIC
COSN2166023 752 COSMIC
COSN8798141 797 COSMIC
COSN7886282 932 COSMIC
COSN25961017 976 COSMIC
COSN5631925 1093 COSMIC
COSN195610 1157 COSMIC
COSN24518184 1206 COSMIC
COSN9796802 1346 COSMIC
COSN6323767 1903 COSMIC
COSN397673 2123 COSMIC
COSN15717640 2857 COSMIC
COSN7886279 2940 COSMIC
COSN6323760 3199 COSMIC
COSN28041358 3340 COSMIC
COSN25648573 3501 COSMIC
COSN16452632 3615 COSMIC
COSN26217705 3816 COSMIC
COSN22648589 3893 COSMIC
COSN23289996 3926 COSMIC
COSN2166007 4323 COSMIC
COSN6323756 4364 COSMIC
COSN26364116 4446 COSMIC
COSN4859752 4466 COSMIC
COSN9796789 4669 COSMIC
COSN2166005 5257 COSMIC
COSN30652428 5352 COSMIC
COSN28899441 5424 COSMIC
COSN30630316 5436 COSMIC
COSN19772107 5476 COSMIC
COSN9796783 6312 COSMIC
COSN29922827 7043 COSMIC
COSN32191878 7174 COSMIC
COSN32191877 7317 COSMIC
COSN1334320 8104 COSMIC
COSN22443514 8282 COSMIC
COSN17990455 8618 COSMIC
COSN17988526 8623 COSMIC
COSN17990487 8631 COSMIC
COSN17985021 8637 COSMIC
COSN20343145 8641 COSMIC
COSN17986879 8669 COSMIC
COSN21529849 9122 COSMIC
COSN29035625 9128 COSMIC
COSN14817841 9169 COSMIC
COSN17909247 9201 COSMIC
COSN16234030 9225 COSMIC
COSN17907952 9229 COSMIC
COSN17080547 9237 COSMIC
COSN2165986 9466 COSMIC
COSN9908774 9815 COSMIC
COSN23609209 10282 COSMIC
COSN25746422 10848 COSMIC
COSN26122185 11010 COSMIC
COSN26392341 11153 COSMIC
COSN30238015 11198 COSMIC
COSN25847066 11224 COSMIC
COSN26621855 11558 COSMIC
COSN23345382 11605 COSMIC
COSN16017864 11786 COSMIC
COSN17591107 11859 COSMIC
COSN20971066 12001 COSMIC
COSN7886241 12100 COSMIC
COSN23663337 12307 COSMIC
COSN27108282 12357 COSMIC
COSN20391803 12388 COSMIC
COSN7886238 12543 COSMIC
COSN27729190 12616 COSMIC
COSN4859741 13271 COSMIC
COSN26385180 13466 COSMIC
COSN28905469 13897 COSMIC
COSN2165972 13970 COSMIC
COSN9796741 14542 COSMIC
COSN22484852 14650 COSMIC
COSN7886230 14728 COSMIC
COSN17767440 14760 COSMIC
COSN16551419 15458 COSMIC
COSN6323719 15892 COSMIC
COSN25985737 16401 COSMIC
COSN2165965 16593 COSMIC
COSN20427660 17601 COSMIC
COSN16056874 17669 COSMIC
COSN14655635 18235 COSMIC
COSN21086360 18652 COSMIC
COSN20782019 18684 COSMIC
COSN25868643 19074 COSMIC
COSN9796720 19114 COSMIC
COSN27651614 19171 COSMIC
COSN23797397 19945 COSMIC
COSN9796709 20086 COSMIC
COSN21425182 20248 COSMIC
COSN6323705 20298 COSMIC
COSN4955891 20338 COSMIC
COSN2165952 20601 COSMIC
COSN27908725 20724 COSMIC
COSN21836512 21131 COSMIC
COSN224667 21452 COSMIC
COSN26209407 21854 COSMIC
COSN29282333 22131 COSMIC
COSN26693570 22711 COSMIC
COSN14784098 22772 COSMIC
COSN9312602 23481 COSMIC
COSN6323692 24073 COSMIC
COSN24319325 24385 COSMIC
COSN23720883 24868 COSMIC
COSN29458168 25007 COSMIC
COSN2165928 25505 COSMIC
COSN21577247 26002 COSMIC
COSN18764422 26060 COSMIC
COSN20495420 26079 COSMIC
COSN27290309 26083 COSMIC
COSN27341228 26083 COSMIC
COSN27449513 26083 COSMIC
COSN29519536 26284 COSMIC
COSN27618006 26633 COSMIC
COSN21068304 26741 COSMIC
COSN16932221 26936 COSMIC
COSN20862687 26948 COSMIC
COSN9796674 27139 COSMIC
COSN20306104 27591 COSMIC
COSN26320361 27686 COSMIC
COSN26673018 27884 COSMIC
COSN29979275 27923 COSMIC
COSN17770308 27929 COSMIC
COSN5811078 28009 COSMIC
COSN32191876 28034 COSMIC
COSN5856168 28441 COSMIC
COSN5811077 28454 COSMIC
COSN32191875 28601 COSMIC
COSN26768816 28675 COSMIC
COSN5811075 28764 COSMIC
COSN21619090 28822 COSMIC
COSN32191874 28914 COSMIC
COSN15242411 29322 COSMIC
COSN5811074 29467 COSMIC
COSN5811073 29515 COSMIC
COSN5631877 29946 COSMIC
COSN24797168 30018 COSMIC
COSN24725966 30036 COSMIC
COSN16741603 30086 COSMIC
COSN5811072 30191 COSMIC
COSN9796662 30215 COSMIC
COSN4920157 30325 COSMIC
COSN4920156 30379 COSMIC
COSN7886166 30440 COSMIC
COSN20462567 30442 COSMIC
COSN29410066 30654 COSMIC
COSN20200721 30694 COSMIC
COSN31661731 30761 COSMIC
COSN5811071 30797 COSMIC
COSN9796657 30966 COSMIC
COSN1334301 31663 COSMIC
COSN5811070 31924 COSMIC
COSN27284410 31945 COSMIC
COSN5088929 31949 COSMIC
COSN5088928 31950 COSMIC
COSN5811069 32560 COSMIC
COSN6323667 32982 COSMIC
COSN7886151 33219 COSMIC
COSN24699564 33253 COSMIC
COSN7886150 33306 COSMIC
COSN63054 33453 COSMIC
COSN6591233 33579 COSMIC
COSN17572174 33732 COSMIC
COSN27484709 33870 COSMIC
COSN26846830 34205 COSMIC
COSN29212486 34319 COSMIC
COSN1334298 34641 COSMIC
COSN19693973 34651 COSMIC
COSM7351897 34687 COSMIC
COSM3430740 34710 COSMIC
COSM5568834 34710 COSMIC
COSM8416851 34712 COSMIC
COSM6174365 34716 COSMIC
COSM1487838 34719 COSMIC
COSN26983318 34757 COSMIC
COSN31539999 34761 COSMIC
COSN14232887 34762 COSMIC
COSN5273259 34763 COSMIC
COSN30101497 34782 COSMIC
COSN19728721 34785 COSMIC
COSN31493285 34787 COSMIC
COSN30179438 34788 COSMIC
COSN30490666 34796 COSMIC
COSN31491806 34816 COSMIC
COSN28135399 34838 COSMIC
COSN31569611 34853 COSMIC
COSN26983319 34858 COSMIC
COSN30515477 34913 COSMIC
COSN31516769 34975 COSMIC
COSN5811068 35217 COSMIC
COSN5811067 35279 COSMIC
COSN31484101 35283 COSMIC
COSN1334297 35516 COSMIC
COSN32063262 35572 COSMIC
COSN31570681 35577 COSMIC
COSN9796635 35600 COSMIC
COSN16403939 35615 COSMIC
rs75995699 3557 GWAS
rs466837 6711 GWAS
rs393628 35294 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1325996326 9 dbSNP
rs1313677237 10 dbSNP
rs764800709 14 dbSNP
rs1255246397 16 dbSNP
rs1416904504 17 dbSNP
rs1209531221 18 dbSNP
rs1339469516 19 dbSNP
rs1004995461 20 dbSNP
rs1282422032 26 dbSNP
rs1446560250 33 dbSNP
rs761627372 38 dbSNP
rs1210887209 44 dbSNP
rs1312083814 48 dbSNP
rs1238022533 57 dbSNP
rs1268871814 59 dbSNP
rs1437879527 60 dbSNP
rs1366818040 66 dbSNP
rs886585780 69 dbSNP
rs115753803 71 dbSNP
rs938178133 80 dbSNP
rs1405316294 85 dbSNP
rs1439739869 90 dbSNP
rs905592944 92 dbSNP
rs1361424452 98 dbSNP
rs930883572 107 dbSNP
rs186123998 110 dbSNP
rs1325289161 115 dbSNP
rs1405684430 127 dbSNP
rs900728163 135 dbSNP
rs774667825 144 dbSNP
rs1336487931 149 dbSNP
rs1039262647 153 dbSNP
rs944353387 158 dbSNP
rs1278054207 163 dbSNP
rs930987003 165 dbSNP
rs911571961 172 dbSNP
rs557683186 174 dbSNP
rs1280767531 180 dbSNP
rs918287569 185 dbSNP
rs1201621000 196 dbSNP
rs1053267203 201 dbSNP
rs1242437839 206 dbSNP
rs147002248 211 dbSNP
rs1183682087 213 dbSNP
rs1230852144 218 dbSNP
rs399120 221 dbSNP
rs445204 224 dbSNP
rs142343243 225 dbSNP
rs1467772314 228 dbSNP
rs1176413158 229 dbSNP
rs138253566 245 dbSNP
rs1401637453 254 dbSNP
rs558922964 256 dbSNP
rs953906484 261 dbSNP
rs773773008 266 dbSNP
rs1335422719 267 dbSNP
rs979523391 268 dbSNP
rs960681732 281 dbSNP
rs9504351 289 dbSNP
rs1343780015 293 dbSNP
rs147072741 303 dbSNP
rs1222788715 309 dbSNP
rs1318459523 313 dbSNP
rs950863017 315 dbSNP
rs1028160704 319 dbSNP
rs1270546661 321 dbSNP
rs1436864167 323 dbSNP
rs1013600045 325 dbSNP
rs1270581426 331 dbSNP
rs896705664 334 dbSNP
rs569664553 335 dbSNP
rs776899351 340 dbSNP
rs900698717 342 dbSNP
rs1467598992 347 dbSNP
rs1272922531 358 dbSNP
rs760392615 362 dbSNP
rs1002359926 364 dbSNP
rs1325832603 365 dbSNP
rs548060261 372 dbSNP
rs529872939 373 dbSNP
rs890102520 378 dbSNP
rs1052830816 379 dbSNP
rs1232845329 381 dbSNP
rs1365072325 387 dbSNP
rs934400521 392 dbSNP
rs1276309427 393 dbSNP
rs565553943 395 dbSNP
rs549302607 410 dbSNP
rs1338574679 412 dbSNP
rs1210192972 415 dbSNP
rs140496815 420 dbSNP
rs1043203035 424 dbSNP
rs1305931183 426 dbSNP
rs536095024 427 dbSNP
rs1037077828 429 dbSNP
rs943737716 432 dbSNP
rs912462717 442 dbSNP
rs948504966 443 dbSNP
rs1165815044 448 dbSNP
rs1473351601 448 dbSNP
rs532243548 449 dbSNP
rs932481250 467 dbSNP
rs1424191426 468 dbSNP
rs925075891 482 dbSNP
rs979240896 490 dbSNP
rs1427334111 494 dbSNP
rs915774695 518 dbSNP
rs967166207 526 dbSNP
rs1245211576 531 dbSNP
rs1316195127 535 dbSNP
rs564819848 543 dbSNP
rs992723998 550 dbSNP
rs768964757 559 dbSNP
rs992549654 560 dbSNP
rs1469787423 562 dbSNP
rs1356846990 572 dbSNP
rs927947314 577 dbSNP
rs1250122721 579 dbSNP
rs983436957 586 dbSNP
rs543451341 587 dbSNP
rs1486596266 590 dbSNP
rs950778897 591 dbSNP
rs1483672385 603 dbSNP
rs1261674583 604 dbSNP
rs1280178280 604 dbSNP
rs1027714493 606 dbSNP
rs1185821696 606 dbSNP
rs1208628575 607 dbSNP
rs1383697717 616 dbSNP
rs994896465 617 dbSNP
rs531184444 621 dbSNP
rs1280088624 635 dbSNP
rs1002495863 637 dbSNP
rs952277462 641 dbSNP
rs1017753040 643 dbSNP
rs1384192518 645 dbSNP
rs1009101256 647 dbSNP
rs890750230 648 dbSNP
rs1349444234 650 dbSNP
rs1053790428 655 dbSNP
rs998495307 657 dbSNP
rs182135858 663 dbSNP
rs1380397080 666 dbSNP
rs1411356708 667 dbSNP
rs1042798562 669 dbSNP
rs1027791304 672 dbSNP
rs1309580438 674 dbSNP
rs948473840 676 dbSNP
rs151309239 681 dbSNP
rs747298514 682 dbSNP
rs1464476556 683 dbSNP
rs1346333697 687 dbSNP
rs1206196789 688 dbSNP
rs938503026 689 dbSNP
rs1036807394 695 dbSNP
rs1461182588 699 dbSNP
rs908415230 700 dbSNP
rs1179619366 707 dbSNP
rs1252967215 708 dbSNP
rs1008297507 709 dbSNP
rs890828988 711 dbSNP
rs1378212022 716 dbSNP
rs983122437 719 dbSNP
rs142412794 721 dbSNP
rs553610241 725 dbSNP
rs149184401 727 dbSNP
rs1043925768 728 dbSNP
rs1389251007 732 dbSNP
rs1184808415 733 dbSNP
rs945252027 735 dbSNP
rs747871708 739 dbSNP
rs1473158654 749 dbSNP
rs913960898 751 dbSNP
rs1224790958 754 dbSNP
rs1180665603 758 dbSNP
rs146637282 759 dbSNP
rs960693336 778 dbSNP
rs779697168 780 dbSNP
rs1479785461 787 dbSNP
rs926571310 799 dbSNP
rs1268306077 801 dbSNP
rs1257267957 803 dbSNP
rs1481489592 803 dbSNP
rs1210158773 805 dbSNP
rs1170878048 812 dbSNP
rs1017721809 815 dbSNP
rs987568606 821 dbSNP
rs1460264737 822 dbSNP
rs1297300347 824 dbSNP
rs955049441 830 dbSNP
rs1406278352 836 dbSNP
rs1229837632 841 dbSNP
rs1329686684 851 dbSNP
rs1027889433 855 dbSNP
rs144466835 856 dbSNP
rs1298375059 865 dbSNP
rs745426318 865 dbSNP
rs774222170 876 dbSNP
rs537482081 879 dbSNP
rs1015765800 884 dbSNP
rs1220363989 890 dbSNP
rs1268183744 892 dbSNP
rs770883112 902 dbSNP
rs1187095994 912 dbSNP
rs1021337705 928 dbSNP
rs890870141 929 dbSNP
rs1012661238 930 dbSNP
rs1385503825 932 dbSNP
rs1049416372 933 dbSNP
rs1300751636 936 dbSNP
rs996451425 944 dbSNP
rs1364491357 948 dbSNP
rs1430811580 951 dbSNP
rs1291198940 955 dbSNP
rs1378430485 956 dbSNP
rs894195507 957 dbSNP
rs372490066 958 dbSNP
rs869297839 958 dbSNP
rs67715436 960 dbSNP
rs114283566 961 dbSNP
rs147146820 961 dbSNP
rs58528949 961 dbSNP
rs1185730188 963 dbSNP
rs1243457039 964 dbSNP
rs1446223570 971 dbSNP
rs145918392 975 dbSNP
rs938470304 975 dbSNP
rs1257391832 976 dbSNP
rs1400825757 978 dbSNP
rs1160607686 985 dbSNP
rs1343958456 986 dbSNP
rs1430558216 994 dbSNP
rs1043623103 1001 dbSNP
rs10458182 1003 dbSNP
rs1245661285 1010 dbSNP
rs1046963821 1013 dbSNP
rs1210249564 1016 dbSNP
rs1465048117 1018 dbSNP
rs913696430 1019 dbSNP
rs139138725 1023 dbSNP
rs1056698886 1024 dbSNP
rs1242284248 1034 dbSNP
rs931247816 1037 dbSNP
rs1351621081 1038 dbSNP
rs549823170 1043 dbSNP
rs920603931 1043 dbSNP
rs1282173804 1044 dbSNP
rs973410197 1045 dbSNP
rs1208104799 1059 dbSNP
rs1313427502 1060 dbSNP
rs778945714 1070 dbSNP
rs1227574888 1075 dbSNP
rs1363167087 1076 dbSNP
rs1462529620 1077 dbSNP
rs1181495554 1080 dbSNP
rs910599349 1081 dbSNP
rs980791006 1089 dbSNP
rs952000910 1090 dbSNP
rs987535939 1108 dbSNP
rs920856573 1111 dbSNP
rs1399598385 1113 dbSNP
rs972306561 1116 dbSNP
rs954873595 1117 dbSNP
rs146182611 1120 dbSNP
rs1336428930 1132 dbSNP
rs756711621 1133 dbSNP
rs374811390 1143 dbSNP
rs1278000107 1145 dbSNP
rs1028007627 1153 dbSNP
rs1224180476 1156 dbSNP
rs1170441919 1157 dbSNP
rs996482473 1161 dbSNP
rs1201563782 1164 dbSNP
rs547609676 1169 dbSNP
rs1438178356 1170 dbSNP
rs1206246785 1173 dbSNP
rs1230791750 1179 dbSNP
rs1472001184 1183 dbSNP
rs1199459276 1187 dbSNP
rs149699366 1188 dbSNP
rs1012548253 1199 dbSNP
rs753324841 1200 dbSNP
rs1035409065 1224 dbSNP
rs1465091529 1227 dbSNP
rs139505865 1232 dbSNP
rs150526479 1233 dbSNP
rs531398536 1234 dbSNP
rs1047377666 1236 dbSNP
rs189489786 1237 dbSNP
rs1339917989 1238 dbSNP
rs777305147 1239 dbSNP
rs1039602643 1240 dbSNP
rs548949892 1243 dbSNP
rs943351339 1244 dbSNP
rs185033019 1245 dbSNP
rs1388737836 1249 dbSNP
rs1270484033 1253 dbSNP
rs1482495301 1254 dbSNP
rs1222601077 1261 dbSNP
rs1270333490 1262 dbSNP
rs1051777037 1266 dbSNP
rs933439316 1272 dbSNP
rs924793363 1280 dbSNP
rs920566142 1281 dbSNP
rs1307780210 1282 dbSNP
rs977956273 1290 dbSNP
rs972469769 1291 dbSNP
rs940984549 1293 dbSNP
rs141745752 1299 dbSNP
rs968916536 1305 dbSNP
rs138064841 1306 dbSNP
rs796505427 1307 dbSNP
rs200863 1308 dbSNP
rs1322853145 1309 dbSNP
rs958346427 1313 dbSNP
rs1229368500 1319 dbSNP
rs565413467 1320 dbSNP
rs1002625371 1322 dbSNP
rs180749302 1324 dbSNP
rs951240316 1325 dbSNP
rs147433410 1346 dbSNP
rs554552196 1347 dbSNP
rs1025401385 1350 dbSNP
rs1449193605 1354 dbSNP
rs995710576 1355 dbSNP
rs1247863574 1357 dbSNP
rs898355384 1362 dbSNP
rs1165758503 1363 dbSNP
rs1344485381 1365 dbSNP
rs1039569225 1366 dbSNP
rs1006792744 1380 dbSNP
rs892406179 1381 dbSNP
rs1331846104 1388 dbSNP
rs1035324266 1390 dbSNP
rs1383784545 1390 dbSNP
rs1364267852 1391 dbSNP
rs79626314 1400 dbSNP
rs1052231538 1410 dbSNP
rs1408314431 1417 dbSNP
rs1243464983 1423 dbSNP
rs766583584 1425 dbSNP
rs1352702822 1426 dbSNP
rs1353477988 1431 dbSNP
rs1203949926 1435 dbSNP
rs924649480 1440 dbSNP
rs1268025477 1441 dbSNP
rs1185766215 1463 dbSNP
rs369201638 1463 dbSNP
rs868735367 1463 dbSNP
rs1414374307 1472 dbSNP
rs1423402674 1483 dbSNP
rs1045174216 1484 dbSNP
rs1041824691 1485 dbSNP
rs867908424 1487 dbSNP
rs947507311 1488 dbSNP
rs899235661 1498 dbSNP
rs1036390702 1504 dbSNP
rs188242793 1517 dbSNP
rs912162789 1530 dbSNP
rs1338403997 1532 dbSNP
rs1376540808 1541 dbSNP
rs1395026274 1552 dbSNP
rs914771854 1564 dbSNP
rs1337063025 1568 dbSNP
rs987651110 1569 dbSNP
rs6597115 1571 dbSNP
rs1429473483 1575 dbSNP
rs958983578 1579 dbSNP
rs1205980070 1581 dbSNP
rs1261585578 1583 dbSNP
rs928277180 1586 dbSNP
rs981480643 1587 dbSNP
rs1483125993 1598 dbSNP
rs1181206707 1602 dbSNP
rs1471519655 1603 dbSNP
rs951084771 1603 dbSNP
rs184529280 1604 dbSNP
rs973863897 1613 dbSNP
rs1252901848 1618 dbSNP
rs978892800 1619 dbSNP
rs967852457 1621 dbSNP
rs559637149 1635 dbSNP
rs1480690649 1659 dbSNP
rs549918045 1661 dbSNP
rs1441747681 1663 dbSNP
rs956543937 1678 dbSNP
rs1398133276 1679 dbSNP
rs1034942195 1690 dbSNP
rs1006753432 1701 dbSNP
rs1346701020 1708 dbSNP
rs1202205281 1713 dbSNP
rs6597114 1714 dbSNP
rs1029581350 1718 dbSNP
rs1226793440 1719 dbSNP
rs142881912 1725 dbSNP
rs200862 1726 dbSNP
rs1204545088 1739 dbSNP
rs755085670 1741 dbSNP
rs1269617671 1747 dbSNP
rs527281103 1752 dbSNP
rs903197817 1754 dbSNP
rs1289356436 1759 dbSNP
rs1422931825 1761 dbSNP
rs200225401 1770 dbSNP
rs1447970827 1774 dbSNP
rs1170817981 1777 dbSNP
rs1374447885 1779 dbSNP
rs899267878 1781 dbSNP
rs1331631030 1783 dbSNP
rs560025102 1789 dbSNP
rs751712748 1798 dbSNP
rs192540415 1802 dbSNP
rs1365719775 1807 dbSNP
rs563344715 1809 dbSNP
rs532807248 1812 dbSNP
rs1367471032 1814 dbSNP
rs890414536 1816 dbSNP
rs200861 1823 dbSNP
rs146543041 1825 dbSNP
rs796650592 1825 dbSNP
rs1413964492 1826 dbSNP
rs867515428 1831 dbSNP
rs1292767389 1840 dbSNP
rs1158880788 1845 dbSNP
rs922175105 1847 dbSNP
rs1056010040 1865 dbSNP
rs1488082364 1868 dbSNP
rs1366575820 1871 dbSNP
rs1189721012 1873 dbSNP
rs947518143 1876 dbSNP
rs937500901 1879 dbSNP
rs988260965 1886 dbSNP
rs1162038219 1888 dbSNP
rs776842182 1889 dbSNP
rs1247459833 1890 dbSNP
rs956400333 1894 dbSNP
rs1363543565 1895 dbSNP
rs138342024 1904 dbSNP
rs929605155 1907 dbSNP
rs918289921 1908 dbSNP
rs974212785 1914 dbSNP
rs1023535803 1921 dbSNP
rs962467877 1928 dbSNP
rs1017984688 1929 dbSNP
rs994695394 1931 dbSNP
rs576168539 1945 dbSNP
rs955224412 1946 dbSNP
rs1194658944 1952 dbSNP
rs1187654547 1954 dbSNP
rs963511299 1958 dbSNP
rs1179615805 1960 dbSNP
rs1354880937 1970 dbSNP
rs1015014342 1971 dbSNP
rs1161982413 1978 dbSNP
rs1387034493 1987 dbSNP
rs1005418420 1990 dbSNP
rs115922610 1995 dbSNP
rs542639442 1996 dbSNP
rs1029963546 2008 dbSNP
rs1374207645 2011 dbSNP
rs999478166 2013 dbSNP
rs765625544 2014 dbSNP
rs572091887 2038 dbSNP
rs554098931 2039 dbSNP
rs996115529 2040 dbSNP
rs1443927064 2041 dbSNP
rs1207660895 2047 dbSNP
rs768913276 2048 dbSNP
rs900781944 2060 dbSNP
rs200860 2061 dbSNP
rs1390334731 2064 dbSNP
rs775788917 2073 dbSNP
rs1177778393 2076 dbSNP
rs1431973287 2083 dbSNP
rs147032206 2084 dbSNP
rs541069907 2087 dbSNP
rs148920228 2093 dbSNP
rs1053286962 2094 dbSNP
rs1306199763 2096 dbSNP
rs1210790831 2099 dbSNP
rs935107914 2121 dbSNP
rs907383699 2122 dbSNP
rs567418496 2123 dbSNP
rs930269147 2137 dbSNP
rs555481940 2139 dbSNP
rs918237136 2144 dbSNP
rs767210098 2145 dbSNP
rs745702650 2147 dbSNP
rs533807847 2151 dbSNP
rs973691150 2153 dbSNP
rs112611928 2154 dbSNP
rs551329811 2155 dbSNP
rs1166945555 2156 dbSNP
rs368251009 2156 dbSNP
rs574929463 2156 dbSNP
rs796751980 2156 dbSNP
rs150207290 2162 dbSNP
rs1332721859 2171 dbSNP
rs922483751 2173 dbSNP
rs996146498 2174 dbSNP
rs978411089 2176 dbSNP
rs367661604 2183 dbSNP
rs1230231551 2195 dbSNP
rs966686360 2198 dbSNP
rs1296269103 2199 dbSNP
rs1225462379 2211 dbSNP
rs1366932266 2216 dbSNP
rs1270123547 2217 dbSNP
rs1450331539 2219 dbSNP
rs571899062 2222 dbSNP
rs1243125898 2226 dbSNP
rs773851408 2232 dbSNP
rs61143012 2234 dbSNP
rs957376810 2235 dbSNP
rs1389752231 2237 dbSNP
rs1425421615 2239 dbSNP
rs892038784 2240 dbSNP
rs1392795467 2244 dbSNP
rs1325226490 2246 dbSNP
rs1425256873 2247 dbSNP
rs1369806339 2250 dbSNP
rs1326855483 2252 dbSNP
rs1034406882 2257 dbSNP
rs1053722030 2277 dbSNP
rs1294987152 2288 dbSNP
rs531766493 2291 dbSNP
rs1001649952 2298 dbSNP
rs1363948437 2302 dbSNP
rs1246095561 2310 dbSNP
rs1166813558 2323 dbSNP
rs561079328 2344 dbSNP
rs1045940350 2345 dbSNP
rs1285534441 2352 dbSNP
rs938811355 2354 dbSNP
rs1207157802 2355 dbSNP
rs994749711 2357 dbSNP
rs777253833 2358 dbSNP
rs1190868166 2363 dbSNP
rs947705455 2372 dbSNP
rs916290244 2381 dbSNP
rs542727185 2389 dbSNP
rs1162642604 2395 dbSNP
rs755636275 2399 dbSNP
rs571630113 2404 dbSNP
rs1458648119 2412 dbSNP
rs941000508 2416 dbSNP
rs527757000 2417 dbSNP
rs973086125 2421 dbSNP
rs941972242 2428 dbSNP
rs560286772 2430 dbSNP
rs1049449492 2431 dbSNP
rs1280666619 2432 dbSNP
rs1331781729 2437 dbSNP
rs907766238 2437 dbSNP
rs983708190 2457 dbSNP
rs933794836 2458 dbSNP
rs922420972 2466 dbSNP
rs1202442694 2473 dbSNP
rs1218302765 2475 dbSNP
rs977917837 2476 dbSNP
rs1254312236 2482 dbSNP
rs966950008 2483 dbSNP
rs141050224 2494 dbSNP
rs1405273726 2495 dbSNP
rs1030381390 2497 dbSNP
rs1349642083 2497 dbSNP
rs577903067 2500 dbSNP
rs964761248 2513 dbSNP
rs1304274839 2526 dbSNP
rs752250168 2534 dbSNP
rs1399547953 2546 dbSNP
rs146604873 2549 dbSNP
rs1175385015 2553 dbSNP
rs1328864001 2555 dbSNP
rs1413008408 2566 dbSNP
rs1011562566 2567 dbSNP
rs1227167925 2578 dbSNP
rs12204382 2581 dbSNP
rs1031897286 2588 dbSNP
rs1235822482 2592 dbSNP
rs185153133 2596 dbSNP
rs971470584 2612 dbSNP
rs193181068 2616 dbSNP
rs1196469318 2621 dbSNP
rs1254143559 2622 dbSNP
rs1482111762 2625 dbSNP
rs533897482 2631 dbSNP
rs566515115 2637 dbSNP
rs1433577460 2638 dbSNP
rs1044583092 2645 dbSNP
rs1375571751 2652 dbSNP
rs754634689 2655 dbSNP
rs897325745 2656 dbSNP
rs1481218726 2663 dbSNP
rs1038574735 2665 dbSNP
rs557478575 2666 dbSNP
rs867005178 2667 dbSNP
rs1005780629 2669 dbSNP
rs1388892402 2669 dbSNP
rs750768377 2670 dbSNP
rs555980793 2671 dbSNP
rs1311961483 2674 dbSNP
rs1310092664 2677 dbSNP
rs1276999109 2678 dbSNP
rs561037732 2683 dbSNP
rs539414343 2684 dbSNP
rs1204459107 2689 dbSNP
rs933659886 2691 dbSNP
rs922337903 2698 dbSNP
rs1192715074 2701 dbSNP
rs1265092398 2702 dbSNP
rs1432358374 2710 dbSNP
rs1188864385 2711 dbSNP
rs140706675 2717 dbSNP
rs1286200296 2722 dbSNP
rs1427300079 2724 dbSNP
rs1167344645 2737 dbSNP
rs769599045 2739 dbSNP
rs544523985 2750 dbSNP
rs1350989723 2759 dbSNP
rs73361401 2767 dbSNP
rs781517650 2768 dbSNP
rs989380269 2770 dbSNP
rs937952551 2772 dbSNP
rs933155827 2789 dbSNP
rs1363238034 2790 dbSNP
rs1227764887 2807 dbSNP
rs923146188 2808 dbSNP
rs1323581902 2809 dbSNP
rs974538624 2810 dbSNP
rs754406346 2830 dbSNP
rs74525462 2834 dbSNP
rs980085782 2835 dbSNP
rs1410246608 2836 dbSNP
rs1161778491 2838 dbSNP
rs1249512186 2841 dbSNP
rs914641741 2845 dbSNP
rs971819787 2846 dbSNP
rs1024363453 2848 dbSNP
rs973255629 2865 dbSNP
rs961505982 2869 dbSNP
rs990572579 2870 dbSNP
rs1017095549 2873 dbSNP
rs567539200 2876 dbSNP
rs956033872 2885 dbSNP
rs1244415726 2888 dbSNP
rs114395717 2892 dbSNP
rs1028534567 2898 dbSNP
rs187917641 2901 dbSNP
rs1464122128 2903 dbSNP
rs1266040009 2918 dbSNP
rs900848795 2924 dbSNP
rs1228793557 2932 dbSNP
rs1003167115 2943 dbSNP
rs560622766 2945 dbSNP
rs1240836199 2959 dbSNP
rs1317460481 2961 dbSNP
rs183323300 2968 dbSNP
rs945144970 2972 dbSNP
rs893643467 2973 dbSNP
rs79406314 2974 dbSNP
rs200859 2975 dbSNP
rs76720514 2976 dbSNP
rs1473169475 2977 dbSNP
rs539524007 2979 dbSNP
rs937828010 2981 dbSNP
rs1457028127 2985 dbSNP
rs1335133591 2986 dbSNP
rs1386644375 2987 dbSNP
rs1322984782 2995 dbSNP
rs1454689001 2999 dbSNP
rs1006308393 3003 dbSNP
rs747018728 3009 dbSNP
rs189727695 3012 dbSNP
rs570645328 3014 dbSNP
rs933271947 3021 dbSNP
rs923175825 3028 dbSNP
rs1183623416 3033 dbSNP
rs1385935514 3034 dbSNP
rs1313513379 3040 dbSNP
rs1207427397 3056 dbSNP
rs1256257494 3057 dbSNP
rs950066065 3063 dbSNP
rs917261094 3074 dbSNP
rs1038866012 3075 dbSNP
rs1448500457 3082 dbSNP
rs972839167 3086 dbSNP
rs544536238 3091 dbSNP
rs961474896 3102 dbSNP
rs1427544910 3105 dbSNP
rs1413041586 3123 dbSNP
rs1206512915 3124 dbSNP
rs1486110448 3126 dbSNP
rs1016981551 3128 dbSNP
rs573956114 3130 dbSNP
rs1411716234 3134 dbSNP
rs1309797250 3135 dbSNP
rs142070630 3135 dbSNP
rs1441209165 3138 dbSNP
rs1275159898 3144 dbSNP
rs186794324 3145 dbSNP
rs1217181926 3150 dbSNP
rs1361456883 3155 dbSNP
rs183233124 3156 dbSNP
rs1315827872 3169 dbSNP
rs190987537 3171 dbSNP
rs539094405 3174 dbSNP
rs971664565 3180 dbSNP
rs574908959 3185 dbSNP
rs1023199117 3186 dbSNP
rs1021080777 3188 dbSNP
rs1298090326 3189 dbSNP
rs1382964113 3203 dbSNP
rs1367408393 3206 dbSNP
rs772320766 3214 dbSNP
rs962876122 3215 dbSNP
rs1016430367 3227 dbSNP
rs1009314691 3228 dbSNP
rs1366657520 3229 dbSNP
rs1368640871 3230 dbSNP
rs1006007190 3239 dbSNP
rs1324118901 3244 dbSNP
rs886179872 3247 dbSNP
rs1433973939 3249 dbSNP
rs1025963431 3250 dbSNP
rs1229997253 3253 dbSNP
rs1428612220 3253 dbSNP
rs997118792 3258 dbSNP
rs556507800 3264 dbSNP
rs78810619 3270 dbSNP
rs1053550013 3278 dbSNP
rs1450261810 3282 dbSNP
rs567576360 3283 dbSNP
rs1248884428 3284 dbSNP
rs1451494240 3285 dbSNP
rs1428722987 3297 dbSNP
rs893011805 3307 dbSNP
rs1189179084 3314 dbSNP
rs1360399407 3317 dbSNP
rs774193071 3323 dbSNP
rs148604942 3328 dbSNP
rs905054419 3337 dbSNP
rs1046291857 3339 dbSNP
rs1292482976 3350 dbSNP
rs949367874 3352 dbSNP
rs749168785 3355 dbSNP
rs1403400194 3358 dbSNP
rs187594705 3367 dbSNP
rs572878288 3368 dbSNP
rs181682054 3374 dbSNP
rs1340187903 3375 dbSNP
rs1253131072 3377 dbSNP
rs940026969 3378 dbSNP
rs73717678 3383 dbSNP
rs981459915 3389 dbSNP
rs1311784257 3391 dbSNP
rs1354778199 3393 dbSNP
rs1233072251 3401 dbSNP
rs950003416 3405 dbSNP
rs1207101864 3406 dbSNP
rs916174016 3411 dbSNP
rs1407082063 3413 dbSNP
rs991715513 3420 dbSNP
rs1370138473 3425 dbSNP
rs963284793 3427 dbSNP
rs1164124738 3429 dbSNP
rs191952908 3443 dbSNP
rs954199858 3446 dbSNP
rs1458599046 3462 dbSNP
rs1156468416 3463 dbSNP
rs769243197 3477 dbSNP
rs186251224 3479 dbSNP
rs1025994374 3489 dbSNP
rs181215441 3496 dbSNP
rs901481722 3499 dbSNP
rs1021217097 3502 dbSNP
rs1289487063 3507 dbSNP
rs1376661120 3507 dbSNP
rs1331716407 3508 dbSNP
rs187990395 3509 dbSNP
rs1007511051 3510 dbSNP
rs1269299400 3517 dbSNP
rs747671254 3523 dbSNP
rs1482006159 3540 dbSNP
rs549217100 3543 dbSNP
rs75995699 3557 dbSNP
rs754182771 3560 dbSNP
rs903282962 3564 dbSNP
rs1032080282 3577 dbSNP
rs746695105 3578 dbSNP
rs374889242 3579 dbSNP
rs1254542398 3581 dbSNP
rs1179313041 3587 dbSNP
rs1225578058 3597 dbSNP
rs1324765869 3599 dbSNP
rs1288087646 3600 dbSNP
rs28475058 3607 dbSNP
rs540081546 3611 dbSNP
rs1173961429 3612 dbSNP
rs1373129175 3624 dbSNP
rs991891917 3627 dbSNP
rs1309191826 3630 dbSNP
rs1352800910 3630 dbSNP
rs1046693191 3631 dbSNP
rs1408402962 3649 dbSNP
rs1337984173 3650 dbSNP
rs941650132 3670 dbSNP
rs572978535 3680 dbSNP
rs557085066 3682 dbSNP
rs1254461933 3687 dbSNP
rs1013428259 3691 dbSNP
rs1026026160 3692 dbSNP
rs1483962014 3699 dbSNP
rs1175398028 3703 dbSNP
rs757698920 3705 dbSNP
rs1036300518 3708 dbSNP
rs1200609628 3711 dbSNP
rs79445944 3718 dbSNP
rs1453275122 3719 dbSNP
rs909915456 3722 dbSNP
rs111654059 3727 dbSNP
rs144949608 3730 dbSNP
rs533052221 3738 dbSNP
rs751267234 3739 dbSNP
rs1298077009 3743 dbSNP
rs1429767947 3751 dbSNP
rs1007621474 3757 dbSNP
rs564216638 3760 dbSNP
rs957328843 3764 dbSNP
rs1370439317 3765 dbSNP
rs116369808 3766 dbSNP
rs1299986386 3771 dbSNP
rs752794597 3786 dbSNP
rs1202399967 3787 dbSNP
rs540774259 3792 dbSNP
rs902980693 3793 dbSNP
rs1211368288 3798 dbSNP
rs914109564 3801 dbSNP
rs1014380370 3802 dbSNP
rs1188805657 3802 dbSNP
rs988418531 3802 dbSNP
rs894550604 3808 dbSNP
rs865776008 3816 dbSNP
rs957672246 3817 dbSNP
rs1369513475 3818 dbSNP
rs1267926628 3825 dbSNP
rs1032048331 3827 dbSNP
rs1207155081 3830 dbSNP
rs1324233474 3840 dbSNP
rs1055822483 3841 dbSNP
rs1436176353 3844 dbSNP
rs571966409 3854 dbSNP
rs1360010123 3856 dbSNP
rs969508445 3870 dbSNP
rs1294805247 3874 dbSNP
rs941333131 3878 dbSNP
rs115579061 3880 dbSNP
rs1047726102 3881 dbSNP
rs1312226837 3886 dbSNP
rs1013813949 3887 dbSNP
rs930145861 3890 dbSNP
rs1249448863 3894 dbSNP
rs149894425 3911 dbSNP
rs1185365036 3917 dbSNP
rs1257498064 3918 dbSNP
rs1319655998 3926 dbSNP
rs1036225526 3927 dbSNP
rs139707420 3932 dbSNP
rs1458070889 3937 dbSNP
rs910273152 3940 dbSNP
rs72811643 3944 dbSNP
rs1048417335 3947 dbSNP
rs562532811 3947 dbSNP
rs957228255 3947 dbSNP
rs1159115572 3951 dbSNP
rs932678834 3954 dbSNP
rs1291341629 3955 dbSNP
rs181020748 3956 dbSNP
rs1185451468 3957 dbSNP
rs967278258 3959 dbSNP
rs1445484651 3964 dbSNP
rs1041144844 3965 dbSNP
rs1247706363 3967 dbSNP
rs1256143708 3968 dbSNP
rs1483928833 3978 dbSNP
rs944188401 3985 dbSNP
rs1186483355 3993 dbSNP
rs368572420 3996 dbSNP
rs914095495 3997 dbSNP
rs1184701767 3999 dbSNP
rs1406227183 4002 dbSNP
rs988387528 4003 dbSNP
rs551657981 4009 dbSNP
rs1361021417 4010 dbSNP
rs894579996 4018 dbSNP
rs1056250921 4036 dbSNP
rs1449139488 4037 dbSNP
rs1410225072 4039 dbSNP
rs1281126650 4043 dbSNP
rs373517128 4045 dbSNP
rs925532060 4046 dbSNP
rs1209795900 4048 dbSNP
rs539926314 4054 dbSNP
rs1280244796 4056 dbSNP
rs980393691 4058 dbSNP
rs1483633231 4069 dbSNP
rs773039165 4082 dbSNP
rs1047052241 4097 dbSNP
rs930258603 4099 dbSNP
rs1469930196 4101 dbSNP
rs922840772 4101 dbSNP
rs1427480441 4111 dbSNP
rs1452664549 4121 dbSNP
rs1173023644 4125 dbSNP
rs117846136 4142 dbSNP
rs1430400598 4143 dbSNP
rs147404177 4145 dbSNP
rs529302542 4147 dbSNP
rs556322051 4148 dbSNP
rs561996826 4152 dbSNP
rs957141895 4155 dbSNP
rs1428175041 4161 dbSNP
rs962169125 4162 dbSNP
rs1231453588 4166 dbSNP
rs925643826 4167 dbSNP
rs546887478 4173 dbSNP
rs1014750915 4176 dbSNP
rs528346207 4179 dbSNP
rs769687568 4187 dbSNP
rs1006088206 4196 dbSNP
rs887664022 4199 dbSNP
rs1404725522 4201 dbSNP
rs1028871563 4207 dbSNP
rs967312330 4213 dbSNP
rs1222685906 4214 dbSNP
rs564306163 4215 dbSNP
rs1255142358 4222 dbSNP
rs1467355618 4227 dbSNP
rs72811642 4228 dbSNP
rs992671729 4238 dbSNP
rs899857810 4239 dbSNP
rs1169600156 4258 dbSNP
rs1417245600 4263 dbSNP
rs1409157043 4264 dbSNP
rs142923047 4272 dbSNP
rs553800535 4273 dbSNP
rs1324781919 4278 dbSNP
rs1432244606 4282 dbSNP
rs1243088784 4286 dbSNP
rs149255100 4291 dbSNP
rs375039603 4293 dbSNP
rs888528454 4295 dbSNP
rs1025624918 4307 dbSNP
rs994108366 4311 dbSNP
rs568406062 4315 dbSNP
rs1248826828 4317 dbSNP
rs1359579460 4320 dbSNP
rs1273251630 4323 dbSNP
rs780307238 4324 dbSNP
rs1191027386 4334 dbSNP
rs1240294694 4336 dbSNP
rs1475074965 4336 dbSNP
rs200168631 4336 dbSNP
rs901449023 4337 dbSNP
rs1041505927 4342 dbSNP
rs1383432945 4343 dbSNP
rs1315685241 4344 dbSNP
rs1325346797 4349 dbSNP
rs944173429 4356 dbSNP
rs1212463291 4363 dbSNP
rs1295624591 4368 dbSNP
rs892629405 4371 dbSNP
rs1340988633 4372 dbSNP
rs541455457 4376 dbSNP
rs34517810 4377 dbSNP
rs1269014234 4378 dbSNP
rs1353042731 4379 dbSNP
rs75693990 4380 dbSNP
rs942875807 4383 dbSNP
rs925502221 4387 dbSNP
rs552661768 4390 dbSNP
rs947698483 4392 dbSNP
rs540945587 4394 dbSNP
rs150581317 4397 dbSNP
rs558340124 4403 dbSNP
rs961856694 4405 dbSNP
rs1014636687 4407 dbSNP
rs1156419836 4407 dbSNP
rs1364151070 4407 dbSNP
rs1383675209 4408 dbSNP
rs1315390968 4409 dbSNP
rs779148124 4409 dbSNP
rs1374101547 4412 dbSNP
rs1316845150 4416 dbSNP
rs984551870 4417 dbSNP
rs1414564055 4419 dbSNP
rs540030433 4420 dbSNP
rs548324390 4421 dbSNP
rs749651513 4428 dbSNP
rs1337896558 4430 dbSNP
rs945663424 4437 dbSNP
rs917177049 4440 dbSNP
rs1345845732 4458 dbSNP
rs462487 4459 dbSNP
rs1282407024 4463 dbSNP
rs1484685779 4467 dbSNP
rs1210075271 4479 dbSNP
rs1251027003 4494 dbSNP
rs958645033 4495 dbSNP
rs1034627668 4501 dbSNP
rs899827708 4507 dbSNP
rs535916402 4514 dbSNP
rs983953779 4521 dbSNP
rs1174909405 4526 dbSNP
rs1420425110 4532 dbSNP
rs1373081422 4540 dbSNP
rs78950012 4545 dbSNP
rs1299210356 4555 dbSNP
rs1479697308 4559 dbSNP
rs775925049 4562 dbSNP
rs546630402 4571 dbSNP
rs994137783 4575 dbSNP
rs528394205 4579 dbSNP
rs868194080 4584 dbSNP
rs901143040 4597 dbSNP
rs1019571969 4598 dbSNP
rs1301431663 4600 dbSNP
rs1007588780 4603 dbSNP
rs892514397 4605 dbSNP
rs753202880 4612 dbSNP
rs1482986659 4645 dbSNP
rs890029809 4646 dbSNP
rs1054385734 4648 dbSNP
rs936830725 4655 dbSNP
rs1398384192 4660 dbSNP
rs1468688032 4664 dbSNP
rs1439207719 4667 dbSNP
rs1392766341 4670 dbSNP
rs1453218595 4672 dbSNP
rs570644182 4685 dbSNP
rs1375218367 4686 dbSNP
rs17139535 4693 dbSNP
rs530594848 4701 dbSNP
rs563079610 4702 dbSNP
rs904051110 4703 dbSNP
rs1167761471 4704 dbSNP
rs141416112 4717 dbSNP
rs948370304 4723 dbSNP
rs1443437647 4727 dbSNP
rs1194715749 4731 dbSNP
rs916956400 4734 dbSNP
rs917567367 4742 dbSNP
rs1056100700 4743 dbSNP
rs1296208536 4745 dbSNP
rs1309121308 4751 dbSNP
rs1225136684 4753 dbSNP
rs1250614402 4755 dbSNP
rs937280806 4758 dbSNP
rs372352013 4761 dbSNP
rs1250711035 4762 dbSNP
rs1224085061 4764 dbSNP
rs907608788 4774 dbSNP
rs148288055 4775 dbSNP
rs1186534752 4782 dbSNP
rs1296540934 4783 dbSNP
rs540630140 4785 dbSNP
rs952545278 4796 dbSNP
rs1427333132 4806 dbSNP
rs573522156 4816 dbSNP
rs984520835 4832 dbSNP
rs1419098424 4843 dbSNP
rs918674109 4849 dbSNP
rs558165342 4850 dbSNP
rs763201156 4853 dbSNP
rs1163087211 4860 dbSNP
rs1355178590 4870 dbSNP
rs189236678 4876 dbSNP
rs185819473 4880 dbSNP
rs1359949205 4881 dbSNP
rs1380498645 4883 dbSNP
rs975065051 4912 dbSNP
rs1355876780 4917 dbSNP
rs1468407924 4918 dbSNP
rs1270899960 4921 dbSNP
rs1320806814 4929 dbSNP
rs1216065334 4932 dbSNP
rs1262023053 4933 dbSNP
rs965426680 4934 dbSNP
rs1019601352 4935 dbSNP
rs1177550236 4940 dbSNP
rs1476392345 4941 dbSNP
rs1006873385 4963 dbSNP
rs954459784 4970 dbSNP
rs1343559141 4971 dbSNP
rs1032567403 4978 dbSNP
rs557560490 4985 dbSNP
rs368745598 4986 dbSNP
rs1019288629 4989 dbSNP
rs1179460445 4993 dbSNP
rs192835110 4994 dbSNP
rs1042574833 4997 dbSNP
rs956711038 4999 dbSNP
rs1031073280 5008 dbSNP
rs1000978633 5021 dbSNP
rs1314651058 5022 dbSNP
rs904014035 5023 dbSNP
rs895551006 5028 dbSNP
rs1281678839 5039 dbSNP
rs1459671911 5046 dbSNP
rs1209345338 5050 dbSNP
rs1057221022 5052 dbSNP
rs553370004 5053 dbSNP
rs1179191099 5055 dbSNP
rs1406012555 5059 dbSNP
rs1418593484 5060 dbSNP
rs1204004066 5062 dbSNP
rs1396964019 5076 dbSNP
rs1310974970 5078 dbSNP
rs1358388352 5083 dbSNP
rs143310004 5083 dbSNP
rs927213244 5084 dbSNP
rs1370647635 5089 dbSNP
rs1316108816 5095 dbSNP
rs142846728 5096 dbSNP
rs1232804155 5097 dbSNP
rs776434740 5108 dbSNP
rs551757477 5110 dbSNP
rs1057129029 5113 dbSNP
rs1438785326 5122 dbSNP
rs138435920 5124 dbSNP
rs907578093 5125 dbSNP
rs768170334 5127 dbSNP
rs1314406840 5130 dbSNP
rs17139533 5137 dbSNP
rs1452609629 5139 dbSNP
rs76924779 5141 dbSNP
rs1424298730 5142 dbSNP
rs771822711 5143 dbSNP
rs1337817989 5145 dbSNP
rs1172340236 5149 dbSNP
rs1352535417 5153 dbSNP
rs796511770 5157 dbSNP
rs1326140197 5158 dbSNP
rs985877100 5162 dbSNP
rs1457097981 5167 dbSNP
rs1438026412 5175 dbSNP
rs1343773744 5180 dbSNP
rs1340757500 5182 dbSNP
rs954037402 5191 dbSNP
rs1401748696 5198 dbSNP
rs1033005794 5199 dbSNP
rs1182373525 5204 dbSNP
rs911790560 5206 dbSNP
rs1001162354 5211 dbSNP
rs1467201507 5212 dbSNP
rs1198176041 5215 dbSNP
rs1242760418 5221 dbSNP
rs1442413242 5229 dbSNP
rs1244659810 5230 dbSNP
rs988751069 5240 dbSNP
rs547938375 5245 dbSNP
rs1485442303 5246 dbSNP
rs1021160754 5253 dbSNP
rs1258712539 5258 dbSNP
rs750790240 5272 dbSNP
rs1165230954 5273 dbSNP
rs1396131755 5275 dbSNP
rs895583904 5277 dbSNP
rs1056851444 5278 dbSNP
rs1001613598 5286 dbSNP
rs956678870 5293 dbSNP
rs745586957 5297 dbSNP
rs1268887845 5299 dbSNP
rs78426361 5299 dbSNP
rs968083897 5301 dbSNP
rs778094454 5302 dbSNP
rs1333036654 5309 dbSNP
rs547434955 5311 dbSNP
rs1285090450 5314 dbSNP
rs559175282 5321 dbSNP
rs1035258279 5330 dbSNP
rs73361394 5333 dbSNP
rs886106573 5341 dbSNP
rs1349754365 5345 dbSNP
rs1162213083 5352 dbSNP
rs1419756773 5362 dbSNP
rs531992135 5374 dbSNP
rs1386523239 5375 dbSNP
rs1385084026 5387 dbSNP
rs1306162047 5393 dbSNP
rs776339987 5399 dbSNP
rs1415724040 5400 dbSNP
rs463054 5401 dbSNP
rs1360388309 5404 dbSNP
rs1415919074 5413 dbSNP
rs1311591151 5414 dbSNP
rs912645668 5415 dbSNP
rs760674130 5416 dbSNP
rs1300156122 5424 dbSNP
rs1460687481 5430 dbSNP
rs930321001 5433 dbSNP
rs1423121639 5436 dbSNP
rs1165396225 5437 dbSNP
rs900221746 5440 dbSNP
rs1476026784 5444 dbSNP
rs1415671177 5450 dbSNP
rs1421582882 5451 dbSNP
rs1244396306 5453 dbSNP
rs775535170 5454 dbSNP
rs985520097 5465 dbSNP
rs1437952716 5466 dbSNP
rs1252006069 5467 dbSNP
rs1193528362 5476 dbSNP
rs772084834 5480 dbSNP
rs1273355264 5481 dbSNP
rs1234363397 5482 dbSNP
rs1039213853 5486 dbSNP
rs1292033251 5487 dbSNP
rs546540079 5489 dbSNP
rs1336830615 5491 dbSNP
rs1331004004 5492 dbSNP
rs932723384 5493 dbSNP
rs188744270 5501 dbSNP
rs1283814767 5505 dbSNP
rs1187974614 5513 dbSNP
rs1487960908 5516 dbSNP
rs925339328 5518 dbSNP
rs1259415950 5520 dbSNP
rs1440434655 5530 dbSNP
rs1486160471 5535 dbSNP
rs1363954850 5541 dbSNP
rs751606791 5543 dbSNP
rs1156370500 5547 dbSNP
rs561702077 5555 dbSNP
rs542430074 5563 dbSNP
rs75585369 5580 dbSNP
rs1292530305 5589 dbSNP
rs1395766417 5590 dbSNP
rs934602825 5593 dbSNP
rs925862270 5594 dbSNP
rs992337161 5596 dbSNP
rs200564319 5603 dbSNP
rs11301112 5604 dbSNP
rs1234960913 5604 dbSNP
rs113520456 5606 dbSNP
rs960828420 5606 dbSNP
rs1342621414 5608 dbSNP
rs1199611407 5610 dbSNP
rs1250959261 5612 dbSNP
rs184552584 5618 dbSNP
rs1383186842 5630 dbSNP
rs535050180 5634 dbSNP
rs1034261454 5635 dbSNP
rs1345272658 5638 dbSNP
rs1376360376 5642 dbSNP
rs140647659 5643 dbSNP
rs1168913114 5646 dbSNP
rs1391529140 5648 dbSNP
rs905597493 5649 dbSNP
rs1366918253 5656 dbSNP
rs1293559261 5658 dbSNP
rs1461174434 5659 dbSNP
rs1370925619 5660 dbSNP
rs1443113307 5661 dbSNP
rs1305556330 5662 dbSNP
rs1172071011 5663 dbSNP
rs1329334888 5675 dbSNP
rs1232440927 5676 dbSNP
rs1251710754 5680 dbSNP
rs1428970058 5688 dbSNP
rs1428312373 5689 dbSNP
rs1197218931 5690 dbSNP
rs1170244290 5692 dbSNP
rs1193472262 5692 dbSNP
rs1194893405 5692 dbSNP
rs1196391600 5692 dbSNP
rs1256982091 5692 dbSNP
rs1264635683 5692 dbSNP
rs1291931278 5692 dbSNP
rs1341179404 5692 dbSNP
rs1342173908 5692 dbSNP
rs1366955421 5692 dbSNP
rs1375165017 5692 dbSNP
rs1386184300 5692 dbSNP
rs1395424216 5692 dbSNP
rs1433180996 5692 dbSNP
rs1450664278 5692 dbSNP
rs1463201050 5692 dbSNP
rs1464356464 5692 dbSNP
rs1468541969 5692 dbSNP
rs1491555073 5692 dbSNP
rs765741377 5692 dbSNP
rs1162916112 5693 dbSNP
rs1289376259 5693 dbSNP
rs1349389465 5693 dbSNP
rs1362315995 5693 dbSNP
rs1419032199 5693 dbSNP
rs1454337327 5693 dbSNP
rs1476334965 5693 dbSNP
rs1490809192 5693 dbSNP
rs1491500598 5693 dbSNP
rs558503298 5694 dbSNP
rs146885836 5696 dbSNP
rs1229699922 5697 dbSNP
rs1026676075 5698 dbSNP
rs1023694062 5705 dbSNP
rs367765192 5709 dbSNP
rs1487633915 5719 dbSNP
rs1216488206 5721 dbSNP
rs991333380 5727 dbSNP
rs960899491 5731 dbSNP
rs1413256963 5735 dbSNP
rs562888043 5745 dbSNP
rs1005011323 5746 dbSNP
rs943876704 5748 dbSNP
rs886659730 5749 dbSNP
rs536055276 5753 dbSNP
rs1297451853 5754 dbSNP
rs890997691 5756 dbSNP
rs1449875723 5761 dbSNP
rs1300731363 5765 dbSNP
rs1050016644 5766 dbSNP
rs191805287 5768 dbSNP
rs1310871058 5773 dbSNP
rs750653413 5778 dbSNP
rs1350839015 5786 dbSNP
rs1240083552 5789 dbSNP
rs925339668 5790 dbSNP
rs1038768483 5802 dbSNP
rs796719487 5803 dbSNP
rs547161838 5805 dbSNP
rs1179136411 5806 dbSNP
rs1323657742 5809 dbSNP
rs1052900418 5816 dbSNP
rs914162090 5817 dbSNP
rs992452740 5821 dbSNP
rs960940896 5822 dbSNP
rs1416089639 5823 dbSNP
rs934488084 5828 dbSNP
rs1033881715 5835 dbSNP
rs1358332966 5841 dbSNP
rs1390373710 5850 dbSNP
rs981331178 5851 dbSNP
rs925829691 5852 dbSNP
rs1445310423 5873 dbSNP
rs978691416 5875 dbSNP
rs1370430508 5878 dbSNP
rs1393687659 5892 dbSNP
rs1278409808 5906 dbSNP
rs542709656 5931 dbSNP
rs1465775286 5937 dbSNP
rs916595499 5943 dbSNP
rs1256323139 5956 dbSNP
rs1405123418 5957 dbSNP
rs765012178 5961 dbSNP
rs564875358 5962 dbSNP
rs961037725 5967 dbSNP
rs187315480 5969 dbSNP
rs1181000453 5975 dbSNP
rs1035076590 5977 dbSNP
rs1478992615 5980 dbSNP
rs983557008 5983 dbSNP
rs764689542 5987 dbSNP
rs1424235659 5989 dbSNP
rs995140886 5993 dbSNP
rs1172376189 5995 dbSNP
rs950905287 5996 dbSNP
rs1252734301 6003 dbSNP
rs531270215 6006 dbSNP
rs1326072520 6013 dbSNP
rs1351083870 6023 dbSNP
rs1435008551 6028 dbSNP
rs1274728805 6030 dbSNP
rs1015208736 6041 dbSNP
rs1196621296 6046 dbSNP
rs1220786241 6047 dbSNP
rs1276685607 6055 dbSNP
rs1214523759 6059 dbSNP
rs1461005314 6059 dbSNP
rs1261661975 6061 dbSNP
rs1292183677 6063 dbSNP
rs1008131039 6067 dbSNP
rs1205906355 6079 dbSNP
rs1324697476 6087 dbSNP
rs1245984345 6088 dbSNP
rs1027845919 6094 dbSNP
rs1195645998 6095 dbSNP
rs1421199962 6097 dbSNP
rs1477313359 6100 dbSNP
rs1279555243 6103 dbSNP
rs1237478492 6104 dbSNP
rs573360541 6115 dbSNP
rs1165167697 6119 dbSNP
rs891021736 6127 dbSNP
rs1049604120 6128 dbSNP
rs374201922 6137 dbSNP
rs563966016 6138 dbSNP
rs903946229 6155 dbSNP
rs1402395681 6158 dbSNP
rs964402288 6167 dbSNP
rs945442942 6168 dbSNP
rs913938334 6170 dbSNP
rs1056468148 6181 dbSNP
rs1286140038 6182 dbSNP
rs1354335558 6183 dbSNP
rs1017727795 6187 dbSNP
rs1227751450 6189 dbSNP
rs182279626 6192 dbSNP
rs58772526 6198 dbSNP
rs1052867541 6208 dbSNP
rs559865403 6213 dbSNP
rs1218661811 6217 dbSNP
rs1260822336 6222 dbSNP
rs753757382 6233 dbSNP
rs980975022 6235 dbSNP
rs763919289 6236 dbSNP
rs1162198428 6242 dbSNP
rs760738457 6249 dbSNP
rs1451472128 6262 dbSNP
rs973830675 6271 dbSNP
rs948686954 6278 dbSNP
rs915834673 6280 dbSNP
rs1055503071 6287 dbSNP
rs961104180 6304 dbSNP
rs775139594 6312 dbSNP
rs541189473 6324 dbSNP
rs928030308 6325 dbSNP
rs1336420133 6344 dbSNP
rs1338989229 6347 dbSNP
rs1447571148 6358 dbSNP
rs983524356 6361 dbSNP
rs1280255241 6377 dbSNP
rs1365632659 6381 dbSNP
rs950872719 6383 dbSNP
rs920797112 6396 dbSNP
rs1015241591 6427 dbSNP
rs1283748335 6431 dbSNP
rs1352732532 6432 dbSNP
rs973677508 6442 dbSNP
rs1258005695 6449 dbSNP
rs751090834 6449 dbSNP
rs1444248178 6460 dbSNP
rs965291391 6461 dbSNP
rs1238272303 6475 dbSNP
rs1440953581 6477 dbSNP
rs1017862834 6483 dbSNP
rs955334657 6489 dbSNP
rs457453 6494 dbSNP
rs1174751438 6503 dbSNP
rs1400480708 6509 dbSNP
rs375964451 6513 dbSNP
rs1031405975 6525 dbSNP
rs1283978615 6538 dbSNP
rs1203928281 6546 dbSNP
rs1379251052 6556 dbSNP
rs759207175 6560 dbSNP
rs1261989162 6569 dbSNP
rs904347326 6579 dbSNP
rs1376155284 6584 dbSNP
rs1233842362 6593 dbSNP
rs1257591073 6596 dbSNP
rs1342549474 6601 dbSNP
rs189992727 6619 dbSNP
rs150259437 6621 dbSNP
rs1458720434 6623 dbSNP
rs1312511837 6625 dbSNP
rs1454222438 6628 dbSNP
rs1340864830 6640 dbSNP
rs460416 6642 dbSNP
rs1380466156 6643 dbSNP
rs1056499673 6644 dbSNP
rs894356900 6655 dbSNP
rs1386979978 6662 dbSNP
rs1477882709 6674 dbSNP