miRTarBase - #MIRT702879 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HNRNPA1   
Synonyms ALS19, ALS20, HNRPA1, HNRPA1L3, IBMPFD3, UP 1, hnRNP A1, hnRNP-A1
Description heterogeneous nuclear ribonucleoprotein A1
Transcript NM_002136   
Other Transcripts NM_031157   
Expression
Putative miRNA Targets on HNRNPA1
3'UTR of HNRNPA1
(miRNA target sites are highlighted)
>HNRNPA1|NM_002136|3'UTR
   1 TTAGGAAACAAAGCTTAGCAGGAGAGGAGAGCCAGAGAAGTGACAGGGAAGCTACAGGTTACAACAGATTTGTGAACTCA
  81 GCCAAGCACAGTGGTGGCAGGGCCTAGCTGCTACAAAGAAGACATGTTTTAGACAAATACTCATGTGTATGGGCAAAAAA
 161 CTCGAGGACTGTATTTGTGACTAATTGTATAACAGGTTATTTTAGTTTCTGTTCTGTGGAAAGTGTAAAGCATTCCAACA
 241 AAGGGTTTTAATGTAGATTTTTTTTTTTGCACCCCATGCTGTTGATTGCTAAATGTAACAGTCTGATCGTGACGCTGAAT
 321 AAATGTCTTTTTTTTAATGTGCTGTGTAAAGTTAGTCTACTCTTAAGCCATCTTGGTAAATTTCCCCAACAGTGTGAAGT
 401 TAGAATTCCTTCAGGGTGATGCCAGGTTCTATTTGGAATTTATATACAACCTGCTTGGGTGGAGAAGCCATTGTCTTCGG
 481 AAACCTTGGTGTAGTTGAACTGATAGTTACTGTTGTGACCTGAAGTTCACCATTAAAAGGGATTACCCAAGCAAAATCAT
 561 GGAATGGTTATAAAAGTGATTGTTGGCACATCCTATGCAATATATCTAAATTGAATAATGGTACCAGATAAAATTATAGA
 641 TGGGAATGAAGCTTGTGTATCCATTATCATGTGTAATCAATAAACGATTTAATTCTCTTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||  |||     |||||:| 
Target 5' tgCACCCCA-----TGCTGTTg 3'
268 - 284 127.00 -11.50
2
miRNA  3' guguuugguAAUACACGACGau 5'
                   | ||||||||:  
Target 5' tctttttttTAATGTGCTGTgt 3'
326 - 347 121.00 -10.50
3
miRNA  3' guguuugguaauacaCGACGAu 5'
                         |||||| 
Target 5' tggtggcagggcctaGCTGCTa 3'
92 - 113 120.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31567743 2 COSMIC
COSN2378414 6 COSMIC
COSN26668072 7 COSMIC
COSN20077787 35 COSMIC
COSN19368807 52 COSMIC
COSN4891596 62 COSMIC
COSN5324147 62 COSMIC
COSN30597064 87 COSMIC
COSN16832030 122 COSMIC
COSN19689861 132 COSMIC
COSN7374205 145 COSMIC
COSN7374206 205 COSMIC
COSN1576756 237 COSMIC
COSN8586364 302 COSMIC
COSN9751732 382 COSMIC
COSN28642572 383 COSMIC
COSN9083787 470 COSMIC
COSN15661165 531 COSMIC
COSN28641992 550 COSMIC
COSN31563453 596 COSMIC
COSN9083788 598 COSMIC
COSN19408136 657 COSMIC
COSN26677164 852 COSMIC
COSN16098602 898 COSMIC
COSN32137374 1051 COSMIC
COSN31663621 1230 COSMIC
COSN14598016 1426 COSMIC
COSN18714720 1605 COSMIC
COSN9563866 1739 COSMIC
COSN7616944 1883 COSMIC
COSN29861951 1917 COSMIC
COSN26234338 2079 COSMIC
COSN2492750 2083 COSMIC
COSN5946563 2236 COSMIC
COSN15136880 2418 COSMIC
COSN6616414 2627 COSMIC
COSN24991795 2693 COSMIC
COSN26883119 2746 COSMIC
COSN1149593 2755 COSMIC
COSN29008192 2755 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1381345475 3 dbSNP
rs1402469304 4 dbSNP
rs764587450 5 dbSNP
rs1256125188 7 dbSNP
rs1467973612 13 dbSNP
rs1483928902 13 dbSNP
rs185440272 14 dbSNP
rs1242130123 17 dbSNP
rs1465643777 19 dbSNP
rs762411249 26 dbSNP
rs1026348474 30 dbSNP
rs1449345614 32 dbSNP
rs768062002 34 dbSNP
rs1379491777 36 dbSNP
rs781170901 37 dbSNP
rs1172221404 40 dbSNP
rs1176834178 46 dbSNP
rs750522774 47 dbSNP
rs756191880 48 dbSNP
rs1322241695 50 dbSNP
rs376830001 51 dbSNP
rs754089897 52 dbSNP
rs1299949444 56 dbSNP
rs1199883000 59 dbSNP
rs1374203368 62 dbSNP
rs544977777 63 dbSNP
rs371452672 66 dbSNP
rs1340701088 67 dbSNP
rs867828035 68 dbSNP
rs926866372 79 dbSNP
rs938238604 81 dbSNP
rs532880784 90 dbSNP
rs1394231723 99 dbSNP
rs761275864 99 dbSNP
rs1166242775 100 dbSNP
rs1475088161 102 dbSNP
rs1386129464 104 dbSNP
rs1185602604 111 dbSNP
rs1442986328 114 dbSNP
rs1357607340 118 dbSNP
rs1234236423 123 dbSNP
rs548076577 134 dbSNP
rs780632286 143 dbSNP
rs1042526084 152 dbSNP
rs1271416699 153 dbSNP
rs1194762099 156 dbSNP
rs575983828 158 dbSNP
rs1207288690 160 dbSNP
rs1252548157 166 dbSNP
rs903541582 166 dbSNP
rs1483129922 167 dbSNP
rs936308845 173 dbSNP
rs1381579229 184 dbSNP
rs1180845280 185 dbSNP
rs755142260 188 dbSNP
rs1313501614 190 dbSNP
rs1328057150 195 dbSNP
rs778691498 196 dbSNP
rs1409476097 202 dbSNP
rs775703600 208 dbSNP
rs1415620882 213 dbSNP
rs1262128101 214 dbSNP
rs1329376871 216 dbSNP
rs1210998987 228 dbSNP
rs889725441 241 dbSNP
rs537037310 246 dbSNP
rs1403395659 248 dbSNP
rs1485730415 263 dbSNP
rs1192341055 282 dbSNP
rs1008109174 302 dbSNP
rs758335427 309 dbSNP
rs1431513889 311 dbSNP
rs777753412 318 dbSNP
rs1019452635 319 dbSNP
rs1459064605 326 dbSNP
rs1157177525 366 dbSNP
rs1386269149 372 dbSNP
rs1452773874 373 dbSNP
rs896972665 374 dbSNP
rs1369560866 376 dbSNP
rs1219604320 379 dbSNP
rs1384601070 383 dbSNP
rs993636555 386 dbSNP
rs1026800612 395 dbSNP
rs1403508288 396 dbSNP
rs1225287850 403 dbSNP
rs1172532198 413 dbSNP
rs952078362 415 dbSNP
rs1278715152 449 dbSNP
rs1437158078 454 dbSNP
rs1347320360 458 dbSNP
rs1305100986 474 dbSNP
rs1403121543 477 dbSNP
rs1429108948 481 dbSNP
rs1306289489 488 dbSNP
rs1033619097 489 dbSNP
rs533212482 489 dbSNP
rs879367409 489 dbSNP
rs918129644 489 dbSNP
rs992810065 489 dbSNP
rs967260398 496 dbSNP
rs1357553196 497 dbSNP
rs1481083639 500 dbSNP
rs1271607881 501 dbSNP
rs1196656914 510 dbSNP
rs1490032670 512 dbSNP
rs1242363528 520 dbSNP
rs3953255 531 dbSNP
rs1217560775 532 dbSNP
rs977896953 535 dbSNP
rs1283939819 540 dbSNP
rs558097327 541 dbSNP
rs3953256 545 dbSNP
rs1216816996 546 dbSNP
rs576751121 548 dbSNP
rs1281231786 552 dbSNP
rs1221784038 559 dbSNP
rs1345018035 559 dbSNP
rs1135894 567 dbSNP
rs1289487734 568 dbSNP
rs1433230906 571 dbSNP
rs1343640128 576 dbSNP
rs936381093 595 dbSNP
rs4016669 596 dbSNP
rs1470468145 600 dbSNP
rs1432120302 602 dbSNP
rs1049425287 609 dbSNP
rs910857147 618 dbSNP
rs1419661956 622 dbSNP
rs1187760820 624 dbSNP
rs943970990 629 dbSNP
rs1241105304 640 dbSNP
rs1041357434 645 dbSNP
rs1271889353 649 dbSNP
rs10652 656 dbSNP
rs897011334 659 dbSNP
rs1202998470 663 dbSNP
rs113736551 670 dbSNP
rs1048199361 699 dbSNP
rs1453867125 700 dbSNP
rs4118339 701 dbSNP
rs1408825211 702 dbSNP
rs1335104986 704 dbSNP
rs1469799757 707 dbSNP
rs4016670 710 dbSNP
rs1006225712 711 dbSNP
rs1418392944 713 dbSNP
rs1183869703 715 dbSNP
rs1033673108 716 dbSNP
rs559999647 717 dbSNP
rs1241109952 725 dbSNP
rs959362016 729 dbSNP
rs1182733890 730 dbSNP
rs1480925920 732 dbSNP
rs1188065812 735 dbSNP
rs559132230 738 dbSNP
rs1390664594 742 dbSNP
rs1013859530 744 dbSNP
rs1025634247 753 dbSNP
rs1448810972 754 dbSNP
rs1247045320 756 dbSNP
rs1385258044 760 dbSNP
rs181507184 768 dbSNP
rs1166768627 779 dbSNP
rs4118338 783 dbSNP
rs4118337 788 dbSNP
rs1374704715 794 dbSNP
rs966957554 804 dbSNP
rs866056457 809 dbSNP
rs1377391142 811 dbSNP
rs1460048449 813 dbSNP
rs1353452509 818 dbSNP
rs1163658228 822 dbSNP
rs1426222058 824 dbSNP
rs542005675 825 dbSNP
rs925402477 832 dbSNP
rs1333822659 838 dbSNP
rs1357656521 845 dbSNP
rs766892723 848 dbSNP
rs1346136241 852 dbSNP
rs985199033 853 dbSNP
rs1175462078 855 dbSNP
rs1365043670 859 dbSNP
rs4016671 863 dbSNP
rs1226907367 869 dbSNP
rs910930600 874 dbSNP
rs1361884634 875 dbSNP
rs745432514 885 dbSNP
rs1317850375 888 dbSNP
rs1219439322 889 dbSNP
rs4016672 890 dbSNP
rs918514512 893 dbSNP
rs929888299 894 dbSNP
rs563781412 899 dbSNP
rs1048220401 900 dbSNP
rs1303240127 901 dbSNP
rs867852317 903 dbSNP
rs1363362768 909 dbSNP
rs140633160 917 dbSNP
rs1453976719 918 dbSNP
rs1217613427 919 dbSNP
rs1156662675 921 dbSNP
rs1418493277 927 dbSNP
rs1429841573 931 dbSNP
rs546193833 934 dbSNP
rs868281539 935 dbSNP
rs371332286 941 dbSNP
rs1490850237 943 dbSNP
rs55706371 945 dbSNP
rs1267069336 956 dbSNP
rs1248462515 967 dbSNP
rs1291933106 973 dbSNP
rs1464359756 974 dbSNP
rs1209523791 979 dbSNP
rs1186666516 982 dbSNP
rs1262922895 985 dbSNP
rs1237259619 986 dbSNP
rs1329080042 993 dbSNP
rs1284440574 994 dbSNP
rs1396951544 995 dbSNP
rs1478363461 997 dbSNP
rs1322273887 999 dbSNP
rs113463590 1002 dbSNP
rs528796027 1003 dbSNP
rs895177637 1007 dbSNP
rs1402685700 1010 dbSNP
rs1452704298 1015 dbSNP
rs1321620311 1018 dbSNP
rs1233912480 1032 dbSNP
rs1178446526 1036 dbSNP
rs184630270 1038 dbSNP
rs1024950463 1041 dbSNP
rs568707896 1049 dbSNP
rs1264038342 1051 dbSNP
rs1203786384 1052 dbSNP
rs1464689507 1061 dbSNP
rs999748174 1064 dbSNP
rs1372385741 1072 dbSNP
rs1436495138 1074 dbSNP
rs1322029890 1075 dbSNP
rs780110414 1078 dbSNP
rs767938981 1079 dbSNP
rs1342404229 1090 dbSNP
rs1032546016 1091 dbSNP
rs111768814 1092 dbSNP
rs1018025386 1094 dbSNP
rs1468216884 1096 dbSNP
rs965129359 1097 dbSNP
rs548016860 1098 dbSNP
rs1254740768 1105 dbSNP
rs1191363386 1115 dbSNP
rs1449056543 1116 dbSNP
rs1244206412 1121 dbSNP
rs768152588 1125 dbSNP
rs983998653 1128 dbSNP
rs1278457299 1129 dbSNP
rs1198191508 1132 dbSNP
rs1340800571 1134 dbSNP
rs1249093817 1136 dbSNP
rs1245108958 1138 dbSNP
rs1471263554 1141 dbSNP
rs1316904858 1143 dbSNP
rs1450102834 1147 dbSNP
rs1339832749 1151 dbSNP
rs909741861 1154 dbSNP
rs937160313 1155 dbSNP
rs138310298 1156 dbSNP
rs1166791380 1157 dbSNP
rs536721561 1159 dbSNP
rs1429416401 1165 dbSNP
rs1386031425 1170 dbSNP
rs895238207 1172 dbSNP
rs945161045 1185 dbSNP
rs1237438056 1188 dbSNP
rs1167561906 1189 dbSNP
rs773914335 1191 dbSNP
rs1042509223 1200 dbSNP
rs1405338769 1204 dbSNP
rs1322269482 1208 dbSNP
rs903354924 1215 dbSNP
rs1008365949 1219 dbSNP
rs1247892639 1222 dbSNP
rs1411261005 1223 dbSNP
rs1203734273 1229 dbSNP
rs902504837 1235 dbSNP
rs1293440912 1242 dbSNP
rs767053244 1243 dbSNP
rs1355438750 1247 dbSNP
rs1000225571 1254 dbSNP
rs1349499500 1261 dbSNP
rs189523819 1264 dbSNP
rs1306276410 1265 dbSNP
rs1274838864 1280 dbSNP
rs768428131 1287 dbSNP
rs1366464162 1289 dbSNP
rs894007567 1293 dbSNP
rs1403795829 1294 dbSNP
rs1356937160 1303 dbSNP
rs1413581525 1309 dbSNP
rs1159509738 1319 dbSNP
rs997492302 1323 dbSNP
rs1410308572 1332 dbSNP
rs1007078649 1334 dbSNP
rs1490355795 1337 dbSNP
rs1018431689 1338 dbSNP
rs1026998836 1339 dbSNP
rs952798314 1343 dbSNP
rs976497287 1350 dbSNP
rs1004303054 1354 dbSNP
rs1025769835 1364 dbSNP
rs1225200795 1370 dbSNP
rs1348462072 1371 dbSNP
rs1183007622 1375 dbSNP
rs1251276171 1376 dbSNP
rs1471754090 1381 dbSNP
rs113017899 1382 dbSNP
rs1190482191 1386 dbSNP
rs548441388 1386 dbSNP
rs570075446 1389 dbSNP
rs534640891 1390 dbSNP
rs1319391211 1393 dbSNP
rs1402758956 1400 dbSNP
rs970775994 1401 dbSNP
rs552844808 1403 dbSNP
rs574573847 1410 dbSNP
rs1430876969 1415 dbSNP
rs1188937170 1416 dbSNP
rs1162034975 1417 dbSNP
rs1399273953 1421 dbSNP
rs937235360 1427 dbSNP
rs926437983 1428 dbSNP
rs570118696 1429 dbSNP
rs747201540 1430 dbSNP
rs991283287 1437 dbSNP
rs1369504019 1442 dbSNP
rs771323977 1444 dbSNP
rs796651892 1451 dbSNP
rs776821116 1453 dbSNP
rs1348887903 1456 dbSNP
rs1363512802 1459 dbSNP
rs180704694 1460 dbSNP
rs949533383 1467 dbSNP
rs1340914659 1471 dbSNP
rs556843142 1478 dbSNP
rs1408866421 1479 dbSNP
rs1046473902 1481 dbSNP
rs1282301934 1482 dbSNP
rs944998112 1484 dbSNP
rs1419818829 1485 dbSNP
rs866927948 1494 dbSNP
rs1187951418 1502 dbSNP
rs564982932 1504 dbSNP
rs911678703 1507 dbSNP
rs1247261763 1510 dbSNP
rs944437160 1512 dbSNP
rs1183960388 1514 dbSNP
rs1462612191 1525 dbSNP
rs1254127395 1529 dbSNP
rs1208134876 1530 dbSNP
rs1341397955 1534 dbSNP
rs1273761368 1536 dbSNP
rs1216614059 1544 dbSNP
rs1205914465 1546 dbSNP
rs952204406 1548 dbSNP
rs1389041673 1549 dbSNP
rs1385662019 1552 dbSNP
rs1474110261 1552 dbSNP
rs1482176884 1554 dbSNP
rs1164978480 1555 dbSNP
rs1213370379 1555 dbSNP
rs1447919511 1556 dbSNP
rs1354653721 1558 dbSNP
rs1004951335 1559 dbSNP
rs1391321272 1559 dbSNP
rs1041261786 1561 dbSNP
rs1404618141 1562 dbSNP
rs1253788157 1566 dbSNP
rs1446175838 1566 dbSNP
rs898900085 1566 dbSNP
rs1181246813 1568 dbSNP
rs994626160 1569 dbSNP
rs1023463625 1573 dbSNP
rs1297079751 1577 dbSNP
rs1480914735 1577 dbSNP
rs1233580379 1580 dbSNP
rs1207310074 1586 dbSNP
rs1423541227 1590 dbSNP
rs1274143109 1596 dbSNP
rs1247202678 1597 dbSNP
rs1323931602 1603 dbSNP
rs575713387 1605 dbSNP
rs1375245845 1611 dbSNP
rs765823708 1613 dbSNP
rs1374678380 1615 dbSNP
rs149141494 1619 dbSNP
rs1007109930 1620 dbSNP
rs1407384698 1624 dbSNP
rs528553227 1643 dbSNP
rs1303426844 1645 dbSNP
rs901335521 1654 dbSNP
rs997126084 1656 dbSNP
rs1025377103 1657 dbSNP
rs564478719 1665 dbSNP
rs528483188 1666 dbSNP
rs1410000749 1668 dbSNP
rs1184466016 1674 dbSNP
rs1016514963 1676 dbSNP
rs958623192 1677 dbSNP
rs1004653677 1679 dbSNP
rs1223563258 1686 dbSNP
rs1489579718 1687 dbSNP
rs1264121785 1693 dbSNP
rs1221207527 1697 dbSNP
rs1290717797 1706 dbSNP
rs991356922 1720 dbSNP
rs540957582 1750 dbSNP
rs1015544086 1751 dbSNP
rs1388221145 1753 dbSNP
rs1388047779 1758 dbSNP
rs1292744627 1761 dbSNP
rs146354980 1762 dbSNP
rs1003572208 1763 dbSNP
rs1472210552 1770 dbSNP
rs1411399776 1773 dbSNP
rs1200223932 1776 dbSNP
rs1331988768 1776 dbSNP
rs1435129382 1777 dbSNP
rs971236789 1778 dbSNP
rs1033488368 1793 dbSNP
rs1367214840 1796 dbSNP
rs982635114 1803 dbSNP
rs1229099690 1834 dbSNP
rs1296956798 1835 dbSNP
rs1263225206 1836 dbSNP
rs1340199877 1839 dbSNP
rs924063923 1840 dbSNP
rs1329019250 1841 dbSNP
rs1235525548 1844 dbSNP
rs1367157127 1846 dbSNP
rs1318279611 1848 dbSNP
rs1456700140 1856 dbSNP
rs756881148 1870 dbSNP
rs767200321 1873 dbSNP
rs1053790375 1882 dbSNP
rs1467601948 1884 dbSNP
rs1483064864 1900 dbSNP
rs1198488452 1903 dbSNP
rs989417462 1915 dbSNP
rs1250368312 1916 dbSNP
rs1264356663 1918 dbSNP
rs1465719156 1924 dbSNP
rs1188561151 1927 dbSNP
rs915109955 1929 dbSNP
rs1464852656 1934 dbSNP
rs1244239019 1948 dbSNP
rs915214010 1951 dbSNP
rs966645844 1952 dbSNP
rs977793413 1953 dbSNP
rs1227778207 1963 dbSNP
rs1295132764 1968 dbSNP
rs1343848506 1968 dbSNP
rs969216369 1984 dbSNP
rs1434010428 1991 dbSNP
rs1383463584 1992 dbSNP
rs749934568 1993 dbSNP
rs942968072 1993 dbSNP
rs911542929 1995 dbSNP
rs1039935496 2000 dbSNP
rs552561618 2003 dbSNP
rs1430653580 2005 dbSNP
rs1447072431 2007 dbSNP
rs998376084 2007 dbSNP
rs547014213 2009 dbSNP
rs1177613482 2012 dbSNP
rs1377806727 2015 dbSNP
rs1047649051 2017 dbSNP
rs886860992 2019 dbSNP
rs570478089 2023 dbSNP
rs1005224232 2025 dbSNP
rs139179873 2027 dbSNP
rs1441176122 2031 dbSNP
rs1254952314 2032 dbSNP
rs755681192 2034 dbSNP
rs1195801363 2040 dbSNP
rs1016588836 2055 dbSNP
rs921433846 2060 dbSNP
rs958361589 2067 dbSNP
rs1359955400 2068 dbSNP
rs1435703429 2073 dbSNP
rs1013274474 2075 dbSNP
rs1024212848 2078 dbSNP
rs1333611311 2080 dbSNP
rs1410463418 2082 dbSNP
rs1372676166 2088 dbSNP
rs186449759 2097 dbSNP
rs569306243 2099 dbSNP
rs1048545874 2103 dbSNP
rs1302099444 2105 dbSNP
rs1311802938 2110 dbSNP
rs1231388168 2115 dbSNP
rs888733046 2117 dbSNP
rs1472097476 2118 dbSNP
rs1368339184 2121 dbSNP
rs530640819 2123 dbSNP
rs940266064 2126 dbSNP
rs1473261825 2128 dbSNP
rs1248941930 2130 dbSNP
rs977301058 2132 dbSNP
rs1490411448 2133 dbSNP
rs1330319208 2140 dbSNP
rs1208513882 2151 dbSNP
rs778907261 2155 dbSNP
rs924402192 2167 dbSNP
rs1230119376 2169 dbSNP
rs1352460143 2173 dbSNP
rs551845937 2180 dbSNP
rs1286515197 2181 dbSNP
rs1409515552 2182 dbSNP
rs1350616216 2183 dbSNP
rs1325955531 2184 dbSNP
rs571559475 2187 dbSNP
rs570159545 2188 dbSNP
rs1037021490 2197 dbSNP
rs906516929 2198 dbSNP
rs1160601578 2199 dbSNP
rs1192384068 2204 dbSNP
rs1448464799 2214 dbSNP
rs538567027 2217 dbSNP
rs1267504631 2218 dbSNP
rs1180747967 2231 dbSNP
rs117046077 2235 dbSNP
rs1432226352 2239 dbSNP
rs1003603418 2244 dbSNP
rs12656 2246 dbSNP
rs1450862387 2250 dbSNP
rs1284668850 2252 dbSNP
rs191215922 2253 dbSNP
rs1326990459 2254 dbSNP
rs1266318368 2267 dbSNP
rs1227796395 2275 dbSNP
rs1457510994 2278 dbSNP
rs1276788017 2280 dbSNP
rs1434538583 2283 dbSNP
rs1158185944 2284 dbSNP
rs1330932541 2284 dbSNP
rs868276883 2299 dbSNP
rs1459423529 2301 dbSNP
rs942662341 2304 dbSNP
rs1426627089 2310 dbSNP
rs1170498872 2312 dbSNP
rs1011190426 2317 dbSNP
rs1477484845 2318 dbSNP
rs1040080321 2319 dbSNP
rs80251270 2325 dbSNP
rs754892078 2327 dbSNP
rs181906119 2332 dbSNP
rs1367078377 2335 dbSNP
rs1280793351 2338 dbSNP
rs1385297026 2341 dbSNP
rs1344504995 2351 dbSNP
rs73304521 2357 dbSNP
rs1047234010 2359 dbSNP
rs557119450 2362 dbSNP
rs1266653413 2363 dbSNP
rs1005297903 2364 dbSNP
rs1360447663 2370 dbSNP
rs1331618569 2373 dbSNP
rs1413558792 2378 dbSNP
rs1324009758 2381 dbSNP
rs1170276291 2382 dbSNP
rs568396188 2387 dbSNP
rs1389283375 2402 dbSNP
rs967053327 2404 dbSNP
rs778743480 2406 dbSNP
rs1484185027 2407 dbSNP
rs1018639459 2408 dbSNP
rs187122180 2409 dbSNP
rs974498093 2410 dbSNP
rs747993578 2415 dbSNP
rs1340548047 2419 dbSNP
rs771272958 2430 dbSNP
rs1297305574 2437 dbSNP
rs539977045 2438 dbSNP
rs984717697 2439 dbSNP
rs191500648 2440 dbSNP
rs111253751 2447 dbSNP
rs1446584768 2457 dbSNP
rs957192125 2459 dbSNP
rs910037523 2460 dbSNP
rs940291622 2461 dbSNP
rs1037223914 2462 dbSNP
rs772017484 2463 dbSNP
rs1165140354 2464 dbSNP
rs906548218 2469 dbSNP
rs989590043 2475 dbSNP
rs1409536469 2481 dbSNP
rs573312088 2488 dbSNP
rs1022399063 2490 dbSNP
rs1425482487 2493 dbSNP
rs1055041670 2506 dbSNP
rs1349240523 2507 dbSNP
rs540649275 2509 dbSNP
rs895262572 2511 dbSNP
rs561909173 2512 dbSNP
rs574280273 2517 dbSNP
rs1371352124 2519 dbSNP
rs544539332 2525 dbSNP
rs552799834 2526 dbSNP
rs934293925 2529 dbSNP
rs983435667 2529 dbSNP
rs908738693 2533 dbSNP
rs1018837465 2535 dbSNP
rs1407681371 2540 dbSNP
rs1229257986 2541 dbSNP
rs1038472789 2549 dbSNP
rs1459217209 2558 dbSNP
rs777050841 2569 dbSNP
rs974445613 2570 dbSNP
rs1028639456 2571 dbSNP
rs1412881531 2575 dbSNP
rs143091756 2577 dbSNP
rs1045411076 2581 dbSNP
rs1471740296 2581 dbSNP
rs906856662 2582 dbSNP
rs183364059 2583 dbSNP
rs1264021309 2588 dbSNP
rs984526977 2592 dbSNP
rs1204075277 2596 dbSNP
rs1269496859 2597 dbSNP
rs1225991436 2599 dbSNP
rs1316004412 2605 dbSNP
rs1230958862 2611 dbSNP
rs1388128798 2614 dbSNP
rs1365300995 2616 dbSNP
rs1324970889 2617 dbSNP
rs910059997 2619 dbSNP
rs1484073020 2620 dbSNP
rs551880122 2622 dbSNP
rs1031576300 2625 dbSNP
rs1390670901 2625 dbSNP
rs1455673309 2629 dbSNP
rs111805463 2638 dbSNP
rs1363269651 2644 dbSNP
rs893027826 2645 dbSNP
rs563823392 2646 dbSNP
rs1011431602 2657 dbSNP
rs1193317642 2660 dbSNP
rs940154395 2661 dbSNP
rs1017408182 2669 dbSNP
rs1207356570 2672 dbSNP
rs964168068 2673 dbSNP
rs975894586 2677 dbSNP
rs1029702472 2681 dbSNP
rs528139096 2682 dbSNP
rs1302430719 2683 dbSNP
rs746099913 2687 dbSNP
rs77993769 2695 dbSNP
rs1367303527 2698 dbSNP
rs1449151715 2702 dbSNP
rs1381556842 2705 dbSNP
rs147199419 2706 dbSNP
rs6717 2710 dbSNP
rs1384418175 2712 dbSNP
rs972967653 2719 dbSNP
rs1467776051 2721 dbSNP
rs928256290 2724 dbSNP
rs769926860 2725 dbSNP
rs1392395058 2727 dbSNP
rs1187291600 2728 dbSNP
rs1299162072 2731 dbSNP
rs1055561434 2733 dbSNP
rs1256252087 2739 dbSNP
rs916573676 2741 dbSNP
rs200425263 2742 dbSNP
rs1201616566 2744 dbSNP
rs140728579 2744 dbSNP
rs201857164 2745 dbSNP
rs1043776989 2750 dbSNP
rs902350264 2755 dbSNP
rs948533591 2762 dbSNP
rs535748240 2769 dbSNP
rs1236718203 2772 dbSNP
rs550588303 2772 dbSNP
rs569078515 2775 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000546500.1 | 3UTR | GGUUACAACAGAUUUGUGAACUCAGCCAAGCACAGUGGUGGCAGGGCCUAGCUGCUACAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.656 8.4e-4 0.811 7.2e-6 20 Click to see details
GSE38226 Liver fibrosis -0.583 2.8e-3 -0.621 1.3e-3 21 Click to see details
GSE42095 Differentiated embryonic stem cells -0.51 6.5e-3 -0.408 2.7e-2 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.455 1.1e-2 0.404 2.3e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.448 2.4e-2 -0.520 9.4e-3 20 Click to see details
GSE32688 Pancreatic cancer -0.297 4.9e-2 0.053 3.9e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.368 1.1e-1 -0.302 1.6e-1 13 Click to see details
GSE27834 Pluripotent stem cells 0.27 1.6e-1 0.338 1.0e-1 16 Click to see details
GSE19783 ER- ER- breast cancer 0.114 1.6e-1 0.180 5.6e-2 79 Click to see details
GSE28544 Breast cancer 0.209 1.6e-1 0.323 6.2e-2 24 Click to see details
GSE19350 CNS germ cell tumors 0.295 1.8e-1 -0.070 4.1e-1 12 Click to see details
GSE21032 Prostate cancer 0.094 2.0e-1 0.071 2.6e-1 83 Click to see details
GSE19536 Breast cancer -0.063 2.7e-1 -0.011 4.6e-1 100 Click to see details
GSE21687 Ependynoma primary tumors -0.075 2.8e-1 -0.036 3.9e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.063 3.8e-1 0.119 2.9e-1 25 Click to see details
GSE21849 B cell lymphoma -0.057 3.8e-1 0.210 1.4e-1 29 Click to see details
GSE17306 Multiple myeloma 0.024 4.3e-1 -0.062 3.4e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.002 4.9e-1 -0.042 3.5e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.002 5.0e-1 0.003 4.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.002 5.0e-1 0.003 4.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.254 0.01 -0.238 0.01 84 Click to see details
CHOL 0.737 0.01 0.600 0.04 9 Click to see details
PAAD 0.944 0.03 0.400 0.3 4 Click to see details
CESC -0.994 0.03 -1.000 0.5 3 Click to see details
BLCA 0.369 0.07 0.414 0.04 18 Click to see details
HNSC 0.193 0.11 0.226 0.08 42 Click to see details
THCA 0.147 0.13 0.223 0.04 59 Click to see details
KIRC 0.111 0.18 0.003 0.49 68 Click to see details
STAD 0.149 0.21 0.126 0.25 32 Click to see details
COAD 0.32 0.22 0.238 0.29 8 Click to see details
PCPG -0.747 0.23 -1.000 0.5 3 Click to see details
LIHC -0.103 0.24 -0.017 0.45 49 Click to see details
PRAD 0.077 0.3 0.112 0.22 50 Click to see details
KIRP 0.071 0.35 0.130 0.24 32 Click to see details
LUSC 0.055 0.37 0.114 0.25 38 Click to see details
ESCA -0.071 0.42 -0.009 0.49 11 Click to see details
KICH 0.029 0.45 0.051 0.4 25 Click to see details
UCEC -0.019 0.47 0.175 0.24 19 Click to see details
LUAD 0.004 0.5 0.028 0.47 12 Click to see details
LUAD 0.004 0.5 0.028 0.47 12 Click to see details
LUAD 0.004 0.5 0.028 0.47 12 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*