miRTarBase - #MIRT706205 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ACOT9   
Synonyms ACATE2, CGI-16, MT-ACT48, MTACT48
Description acyl-CoA thioesterase 9
Transcript NM_001033583   
Other Transcripts NM_001037171   
Expression
Putative miRNA Targets on ACOT9
3'UTR of ACOT9
(miRNA target sites are highlighted)
>ACOT9|NM_001033583|3'UTR
   1 GAACACCACATTTGTTGAAAACTAGCACTCTACCCACAGTGACGTGGTATCTGATGAAGACCTGATCGAGTGTATTGATT
  81 TTAGTATTGCTTCGTGTCCTCCACACAGGAGGAGGATGTATTCAGCCTTTAGGATGATCAGAAAAGCAGAAAGAGAGAGT
 161 GGCCGGATGGGGCTGAGGGGAGAAAGAATTATTAAACAATAAATACTTTCAAGACAATTTTAATTGTGAACCTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGU---AACAG--------UGUGAGGu 5'
            |||||||   ||||:        :|||||: 
Target 5' -gAACACCACATTTGTTGAAAACTAGCACTCTa 3'
1 - 32 130.00 -17.10
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |||| :|     |:|||:: 
Target 5' taAACAATA----AATACTTTc 3'
193 - 210 98.00 -5.50
3
miRNA  3' guuuGUGGUAAC--AG--UGUGAGGu 5'
              :| :||||  ||  :: |||| 
Target 5' atttTAGTATTGCTTCGTGTCCTCCa 3'
78 - 103 90.00 -11.20
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1261899109 2 dbSNP
rs777876069 8 dbSNP
rs1319508479 9 dbSNP
rs1239495803 10 dbSNP
rs769926537 10 dbSNP
rs748354251 14 dbSNP
rs1381349492 26 dbSNP
rs781331000 32 dbSNP
rs1304442669 36 dbSNP
rs755193322 38 dbSNP
rs750182350 42 dbSNP
rs1370550387 43 dbSNP
rs1332386564 44 dbSNP
rs994982709 46 dbSNP
rs778599831 47 dbSNP
rs1270976589 54 dbSNP
rs1356036175 57 dbSNP
rs1447837439 58 dbSNP
rs1230824603 61 dbSNP
rs959762778 67 dbSNP
rs897938774 68 dbSNP
rs762780738 87 dbSNP
rs1202176895 89 dbSNP
rs1248312618 92 dbSNP
rs1036459930 93 dbSNP
rs944747965 94 dbSNP
rs890463261 113 dbSNP
rs1050822437 115 dbSNP
rs1452130245 117 dbSNP
rs112520577 123 dbSNP
rs1174885687 136 dbSNP
rs1021766749 148 dbSNP
rs1010412018 152 dbSNP
rs1305167157 160 dbSNP
rs915139783 164 dbSNP
rs989302780 165 dbSNP
rs113264734 169 dbSNP
rs1332071513 185 dbSNP
rs1379182014 186 dbSNP
rs1385355071 191 dbSNP
rs1300848328 200 dbSNP
rs935179010 210 dbSNP
rs891850997 211 dbSNP
rs189980983 217 dbSNP
rs1317184846 220 dbSNP
rs770023790 222 dbSNP
rs923753543 238 dbSNP
rs373915620 250 dbSNP
rs970851800 256 dbSNP
rs1023332354 261 dbSNP
rs990886960 263 dbSNP
rs1190337211 271 dbSNP
rs142239349 275 dbSNP
rs776726490 279 dbSNP
rs1028311157 283 dbSNP
rs748309317 284 dbSNP
rs776573491 285 dbSNP
rs1239660393 286 dbSNP
rs1196203721 287 dbSNP
rs1465609018 291 dbSNP
rs768843183 296 dbSNP
rs1015062739 301 dbSNP
rs760154363 301 dbSNP
rs1293175001 325 dbSNP
rs1368492810 327 dbSNP
rs1008994160 329 dbSNP
rs890529338 330 dbSNP
rs747044948 333 dbSNP
rs1224433562 340 dbSNP
rs1320251054 343 dbSNP
rs185290220 352 dbSNP
rs893778662 353 dbSNP
rs758797456 354 dbSNP
rs1053648203 355 dbSNP
rs935209839 362 dbSNP
rs923782582 364 dbSNP
rs746258463 369 dbSNP
rs949201048 375 dbSNP
rs1477699242 376 dbSNP
rs931867791 379 dbSNP
rs916296127 380 dbSNP
rs920516313 383 dbSNP
rs1164125548 385 dbSNP
rs1350710482 387 dbSNP
rs1459683850 388 dbSNP
rs1296545162 392 dbSNP
rs1391564250 394 dbSNP
rs1293975912 396 dbSNP
rs990532190 410 dbSNP
rs1348099853 414 dbSNP
rs952498592 415 dbSNP
rs1440150973 416 dbSNP
rs940551067 422 dbSNP
rs1026629686 423 dbSNP
rs973655335 424 dbSNP
rs959973308 426 dbSNP
rs1488177879 428 dbSNP
rs1217721414 434 dbSNP
rs1244366405 446 dbSNP
rs1034051703 449 dbSNP
rs979771527 457 dbSNP
rs962255988 493 dbSNP
rs1193380440 502 dbSNP
rs1487779926 508 dbSNP
rs1157144101 510 dbSNP
rs747188790 515 dbSNP
rs1009477634 516 dbSNP
rs890568230 518 dbSNP
rs1029504960 522 dbSNP
rs1021903527 528 dbSNP
rs780157156 532 dbSNP
rs1380789034 533 dbSNP
rs956259121 539 dbSNP
rs893801157 543 dbSNP
rs1241357568 545 dbSNP
rs779365368 545 dbSNP
rs866333166 557 dbSNP
rs1286846210 558 dbSNP
rs868463128 558 dbSNP
rs1238543239 579 dbSNP
rs139470002 579 dbSNP
rs141484914 579 dbSNP
rs556204870 579 dbSNP
rs66555100 579 dbSNP
rs755833842 579 dbSNP
rs763337670 579 dbSNP
rs767066926 579 dbSNP
rs1440496413 581 dbSNP
rs754570146 584 dbSNP
rs1422887368 585 dbSNP
rs1413690090 593 dbSNP
rs1176726348 596 dbSNP
rs1408127704 612 dbSNP
rs751005775 625 dbSNP
rs1376967375 627 dbSNP
rs1331717045 634 dbSNP
rs999431544 646 dbSNP
rs1343382075 648 dbSNP
rs1218946713 651 dbSNP
rs1303466682 661 dbSNP
rs902434459 662 dbSNP
rs758443001 664 dbSNP
rs766375164 688 dbSNP
rs1196852513 691 dbSNP
rs949226846 692 dbSNP
rs916390586 693 dbSNP
rs1385194962 701 dbSNP
rs1245145770 703 dbSNP
rs1477579655 707 dbSNP
rs1049678603 708 dbSNP
rs1365397529 710 dbSNP
rs1431386004 711 dbSNP
rs995487306 718 dbSNP
rs762825775 734 dbSNP
rs1302533599 736 dbSNP
rs1169838026 766 dbSNP
rs1420021031 772 dbSNP
rs746406674 777 dbSNP
rs931039667 780 dbSNP
rs773002431 793 dbSNP
rs919601628 802 dbSNP
rs779346013 808 dbSNP
rs764940598 809 dbSNP
rs1275757254 819 dbSNP
rs1347749764 829 dbSNP
rs761587916 833 dbSNP
rs139361686 841 dbSNP
rs1257966672 843 dbSNP
rs1318716054 846 dbSNP
rs768738998 856 dbSNP
rs940501224 865 dbSNP
rs10156971 866 dbSNP
rs1451205327 870 dbSNP
rs1199825846 875 dbSNP
rs955064034 877 dbSNP
rs1057277542 883 dbSNP
rs938409615 897 dbSNP
rs927031308 900 dbSNP
rs1476110678 904 dbSNP
rs866471588 918 dbSNP
rs1389590073 922 dbSNP
rs200361137 922 dbSNP
rs1405641082 924 dbSNP
rs979740519 927 dbSNP
rs772720583 942 dbSNP
rs1029123607 948 dbSNP
rs1489439600 949 dbSNP
rs996672016 950 dbSNP
rs1261525192 983 dbSNP
rs958105983 985 dbSNP
rs1229734730 987 dbSNP
rs1282549895 994 dbSNP
rs914812636 996 dbSNP
rs192551754 1020 dbSNP
rs1294200088 1022 dbSNP
rs999462723 1030 dbSNP
rs956399618 1031 dbSNP
rs779558666 1040 dbSNP
rs1008816858 1076 dbSNP
rs1046754239 1089 dbSNP
rs1028380468 1101 dbSNP
rs1472836918 1106 dbSNP
rs995456174 1108 dbSNP
rs1013482389 1111 dbSNP
rs1297924212 1112 dbSNP
rs894976015 1129 dbSNP
rs1054933442 1130 dbSNP
rs1332767988 1142 dbSNP
rs1340009466 1145 dbSNP
rs1246728130 1164 dbSNP
rs1317432275 1166 dbSNP
rs751145514 1173 dbSNP
rs1239185832 1174 dbSNP
rs766022487 1176 dbSNP
rs919673386 1178 dbSNP
rs1036722920 1179 dbSNP
rs939653966 1182 dbSNP
rs762097441 1186 dbSNP
rs927000742 1200 dbSNP
rs1296094116 1215 dbSNP
rs1381479921 1224 dbSNP
rs1402467043 1225 dbSNP
rs1174028526 1226 dbSNP
rs757754413 1229 dbSNP
rs762509204 1238 dbSNP
rs1427996083 1243 dbSNP
rs947015151 1245 dbSNP
rs1402034745 1249 dbSNP
rs912207957 1252 dbSNP
rs1338722214 1262 dbSNP
rs1374734440 1264 dbSNP
rs988130222 1284 dbSNP
rs1307970149 1285 dbSNP
rs199945471 1295 dbSNP
rs914278317 1318 dbSNP
rs1230707501 1321 dbSNP
rs1255373844 1322 dbSNP
rs187224716 1327 dbSNP
rs183676865 1328 dbSNP
rs1422154036 1334 dbSNP
rs141585129 1339 dbSNP
rs1178933544 1342 dbSNP
rs2665372 1347 dbSNP
rs375496094 1348 dbSNP
rs1032373694 1351 dbSNP
rs758334208 1352 dbSNP
rs761654356 1353 dbSNP
rs1179170913 1354 dbSNP
rs776551245 1363 dbSNP
rs1398284282 1368 dbSNP
rs1465156031 1373 dbSNP
rs1298973150 1375 dbSNP
rs1258820565 1390 dbSNP
rs1220598196 1394 dbSNP
rs1384885111 1395 dbSNP
rs1319874547 1396 dbSNP
rs1024938793 1400 dbSNP
rs1013930331 1406 dbSNP
rs1226405281 1429 dbSNP
rs912826454 1430 dbSNP
rs895056740 1437 dbSNP
rs750423383 1446 dbSNP
rs191339327 1452 dbSNP
rs147252371 1453 dbSNP
rs898277438 1455 dbSNP
rs1480965066 1456 dbSNP
rs2907514 1461 dbSNP
rs1404662747 1480 dbSNP
rs1331394120 1481 dbSNP
rs1422032940 1484 dbSNP
rs186925804 1485 dbSNP
rs1356333624 1492 dbSNP
rs939711666 1493 dbSNP
rs1167854282 1496 dbSNP
rs1366030250 1513 dbSNP
rs1406486164 1515 dbSNP
rs1473291679 1516 dbSNP
rs1370593382 1517 dbSNP
rs1185628081 1529 dbSNP
rs1444211012 1546 dbSNP
rs890803229 1558 dbSNP
rs1239060794 1559 dbSNP
rs1319367091 1561 dbSNP
rs1243700204 1579 dbSNP
rs1292032810 1580 dbSNP
rs1490619197 1581 dbSNP
rs1318488421 1593 dbSNP
rs1456548393 1609 dbSNP
rs1270730445 1619 dbSNP
rs1195165137 1621 dbSNP
rs1383423375 1622 dbSNP
rs1285761189 1623 dbSNP
rs1242408091 1624 dbSNP
rs1381573791 1625 dbSNP
rs1163196224 1644 dbSNP
rs1290556147 1644 dbSNP
rs1296060217 1644 dbSNP
rs1359634352 1644 dbSNP
rs1386023730 1644 dbSNP
rs1422122699 1644 dbSNP
rs764406046 1644 dbSNP
rs1376411448 1652 dbSNP
rs1394887272 1656 dbSNP
rs1050774413 1658 dbSNP
rs1448273074 1659 dbSNP
rs1237481177 1673 dbSNP
rs933606066 1683 dbSNP
rs1316692869 1684 dbSNP
rs1217208976 1714 dbSNP
rs1328721497 1732 dbSNP
rs1244282811 1736 dbSNP
rs974167460 1738 dbSNP
rs143910851 1749 dbSNP
rs1243998147 1753 dbSNP
rs975343541 1755 dbSNP
rs1446720119 1756 dbSNP
rs1157046817 1761 dbSNP
rs936852929 1762 dbSNP
rs1401060889 1764 dbSNP
rs1015562584 1765 dbSNP
rs925429246 1782 dbSNP
rs775645954 1793 dbSNP
rs1424502383 1796 dbSNP
rs759676971 1802 dbSNP
rs772345781 1802 dbSNP
rs10694335 1803 dbSNP
rs1025431437 1804 dbSNP
rs1444213534 1804 dbSNP
rs747295719 1806 dbSNP
rs1224622395 1815 dbSNP
rs1437836629 1822 dbSNP
rs1203561436 1823 dbSNP
rs1310905051 1823 dbSNP
rs765577481 1823 dbSNP
rs769100179 1823 dbSNP
rs771538347 1823 dbSNP
rs959576579 1823 dbSNP
rs1422776716 1825 dbSNP
rs1189311300 1830 dbSNP
rs1232408591 1831 dbSNP
rs1407736443 1834 dbSNP
rs867764716 1840 dbSNP
rs867260424 1841 dbSNP
rs1354714996 1842 dbSNP
rs200544438 1842 dbSNP
rs995395030 1843 dbSNP
rs898334481 1846 dbSNP
rs1219955542 1847 dbSNP
rs12834700 1848 dbSNP
rs12832761 1849 dbSNP
rs983128432 1853 dbSNP
rs1015401502 1862 dbSNP
rs1003998405 1866 dbSNP
rs777953752 1889 dbSNP
rs1036029707 1896 dbSNP
rs1358477436 1897 dbSNP
rs1002693930 1901 dbSNP
rs1286200546 1906 dbSNP
rs890875772 1911 dbSNP
rs1051224490 1923 dbSNP
rs1370475063 1937 dbSNP
rs1479980770 1939 dbSNP
rs932320540 1950 dbSNP
rs1431269544 1957 dbSNP
rs1044164701 1958 dbSNP
rs1166761223 1973 dbSNP
rs947152438 1978 dbSNP
rs1411341497 1984 dbSNP
rs899464853 1988 dbSNP
rs1436621110 1994 dbSNP
rs1404657980 2006 dbSNP
rs1304286129 2016 dbSNP
rs892883537 2033 dbSNP
rs1333328947 2039 dbSNP
rs1216899093 2050 dbSNP
rs1269716596 2052 dbSNP
rs12863916 2054 dbSNP
rs1340150704 2058 dbSNP
rs951811484 2061 dbSNP
rs1216606750 2063 dbSNP
rs1287921643 2078 dbSNP
rs768364922 2083 dbSNP
rs1222906553 2084 dbSNP
rs1404660289 2096 dbSNP
rs1487297915 2097 dbSNP
rs1039277387 2098 dbSNP
rs934335184 2102 dbSNP
rs1160641789 2103 dbSNP
rs1476099037 2121 dbSNP
rs1418127115 2123 dbSNP
rs1161106574 2138 dbSNP
rs936887545 2141 dbSNP
rs925465146 2142 dbSNP
rs978223814 2143 dbSNP
rs912802943 2145 dbSNP
rs945505361 2147 dbSNP
rs76768453 2150 dbSNP
rs1407597626 2168 dbSNP
rs917990503 2173 dbSNP
rs992597407 2174 dbSNP
rs775651350 2188 dbSNP
rs62585922 2198 dbSNP
rs1479078724 2199 dbSNP
rs1327118138 2203 dbSNP
rs1034073608 2206 dbSNP
rs987485906 2208 dbSNP
rs1313233736 2211 dbSNP
rs973993480 2215 dbSNP
rs1358938351 2224 dbSNP
rs1248325394 2234 dbSNP
rs1197192083 2235 dbSNP
rs1490112951 2237 dbSNP
rs1263657236 2241 dbSNP
rs962611854 2259 dbSNP
rs1293718762 2296 dbSNP
rs144737480 2305 dbSNP
rs1204541422 2307 dbSNP
rs1262267972 2309 dbSNP
rs1004029615 2317 dbSNP
rs974221181 2350 dbSNP
rs1242167584 2355 dbSNP
rs962730729 2365 dbSNP
rs1165082376 2372 dbSNP
rs745891994 2374 dbSNP
rs1452006560 2396 dbSNP
rs757958062 2404 dbSNP
rs1219292413 2412 dbSNP
rs1029426004 2422 dbSNP
rs779395208 2424 dbSNP
rs1346525628 2435 dbSNP
rs899498613 2442 dbSNP
rs1382091325 2445 dbSNP
rs1453734285 2452 dbSNP
rs1317408018 2455 dbSNP
rs13441234 2458 dbSNP
rs1237970397 2464 dbSNP
rs183823075 2484 dbSNP
rs1300415861 2485 dbSNP
rs1201665099 2491 dbSNP
rs1001109593 2504 dbSNP
rs1461368611 2506 dbSNP
rs1185067901 2509 dbSNP
rs1235909177 2509 dbSNP
rs1417737435 2521 dbSNP
rs1364721244 2523 dbSNP
rs904112244 2552 dbSNP
rs982773216 2558 dbSNP
rs1405509172 2564 dbSNP
rs1042557565 2569 dbSNP
rs749744061 2570 dbSNP
rs778244954 2579 dbSNP
rs918050082 2588 dbSNP
rs1062104 2589 dbSNP
rs938059551 2598 dbSNP
rs1035591404 2608 dbSNP
rs1174118069 2610 dbSNP
rs1002828390 2611 dbSNP
rs192495046 2620 dbSNP
rs974065573 2625 dbSNP
rs1282495763 2629 dbSNP
rs1323632868 2630 dbSNP
rs753687786 2637 dbSNP
rs962642171 2645 dbSNP
rs905684779 2651 dbSNP
rs1249285960 2654 dbSNP
rs763730939 2663 dbSNP
rs1195993862 2665 dbSNP
rs982666516 2666 dbSNP
rs955249974 2673 dbSNP
rs560389727 2685 dbSNP
rs1251780076 2709 dbSNP
rs569544328 2721 dbSNP
rs1197903839 2750 dbSNP
rs996620072 2778 dbSNP
rs1484804466 2795 dbSNP
rs1241100595 2799 dbSNP
rs1480820830 2810 dbSNP
rs1210395124 2815 dbSNP
rs1443604064 2817 dbSNP
rs1178615059 2834 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BCBL-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1015448. RNA binding protein: AGO2. Condition:BCBL-1 mRNA ...

- Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuguGGUAACAGUGUGAGGu 5'
                ||| |   :|||||| 
Target 5' ------CCACU---GCACUCCa 3'
1 - 13
2
miRNA  3' guuugugguaacagUGUGAGGu 5'
                        | ||||| 
Target 5' ugggugacagaacgAGACUCCa 3'
17 - 38
Article - Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al.
- PLoS pathogens, 2012
KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.
LinkOut: [PMID: 22927820]
CLIP-seq Support 1 for dataset GSM1015448
Method / RBP HITS-CLIP / AGO2
Cell line / Condition BCBL-1 / BCBL-1 mRNA
Location of target site ENST00000379303.5 | 3UTR | CCACUGCACUCCAGCCUGGGUGACAGAACGAGACUCCAUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22927820 / GSE41357
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*