miRTarBase - #MIRT706916 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol THAP6   
Synonyms -
Description THAP domain containing 6
Transcript NM_144721   
Expression
Putative miRNA Targets on THAP6
3'UTR of THAP6
(miRNA target sites are highlighted)
>THAP6|NM_144721|3'UTR
   1 AATAATTTCATGTTACGTTCCACCTAAAATTGTCATTGGTACAAATTTTTATAAAATCTCATTTACCATCACTAAATAAT
  81 ATCCATCATTTAAAGTGCTGCTTTGGATTCTCTGGAGCATTATGCATTATAGTTGTTATCCAAAGACTTTTTTGAAAATA
 161 TGCAGAAATTTGTGGTAATTATGTATTTGTGTCTTGTGACAATTATGTTTTATAGACCTACACTAGTGCCAGGTCACTAT
 241 TGTAAGATGTTAAAATCTCAAGAAAATTTCACAGAGCTAAAGAAATGATGTCAAATTAGTCACATTAAGCTATAGTAGAA
 321 GGAATTGGACACTTCTCCAGATATTTGGCTTCAAAGGAGTACCTTTACTTACATGTGCTTTATGGTAAGTACATTGAATT
 401 TTACTTTAAATGCATTTTACTACAAAGCACAATTCATTTGTAATGCATATCCATCTTGGATTCAATCCAAGGTGCTTTAG
 481 CTATCAGTAGTACCAAAGGATCTTTTTACAAGGCTTCCTGTGGTATTGACTCTGAGAATAACACATAGTGAAGATCTGTG
 561 GGCTTTTAAAATTGTTCACAGCCAATTTAAGAAGACCCCTCATGAAGTCTCAGTTTTCAGTACAGTACATCATTCCTCCT
 641 CACTAGGAGCACTTTGATGTAAACCAGAATAGCTTTAAAAAGACAAAAAGGATCGTAGATCTGATTTTTAAATGGTTGGT
 721 TGCTCTGACAGATCTGAACACTTTGCTTCATGACTATTTCGTCATAAAGGTATATGTTTAAAATCTGAATGGCAGTACTA
 801 GCTCTATACTTTTAATACTGCTTTGTATTTTATATGTAAAGTAGTATTGCTGACATTTTAAAAAAATACAAAATACAAAA
 881 GAAACCATTAGAAATTAATAACTGTGGCTCTTCCAGTTGAAATAGGAATTGGAGAGAAAGGATTAGAATATTTTAATTAG
 961 GGGAGTAGATTATTGTCCAAAGGCTTTTATTTAGAGAAACGGGTAATTAAAACAGCAGCTTTAGAATAGCTTCTTACTGA
1041 ATATGCAAAAGAATAATTCCTTGTTATTTCCTAATTGATCCAAGTCTCATAAATTTAGCTTTTGTCATAATTCCTTACCG
1121 AAAACAACTGAAATTGAGAGTCATAAATACTGTGGGTTAGAATAAAAACCATTTGCCAAAGCAACACTCTACTTAGAAGC
1201 ACATGTACATACATGGACCTCATTCAGAAGTCCATGTTGTAGCAGTTAGAATTTGAGTATCAGCCATTTCATTGTAGTAA
1281 CAAAAATTGAATTGCATTTTGTGCTCAGTTGTTTATTGTAATTTTATTTTTGTTACATTAATATTAGTTAAGATATGGTC
1361 ACTTGAATTTTTTGTATTTAAGAATTTTCTGTTTTAATGCATGTTATACTTTTATGTAGGATTCCAAACCTTCCCTCTAA
1441 ATGGGATTTAACCCACATCTGCGAGATCAGCGTTATGCTAAGAGGAAATCACTGAGGCCATATCTTTTTACAATCTGAAA
1521 AAAAAGTAGTAAAAAGGTAGTTAAAAAAAAAAAAGGCCGGGTGGTGGCTCATACCTGTAATCCTAGCACTTTGGGAGGCC
1601 AAGGCAGGCAGATCACTTGAGGTCAGGGGTTCAAAACCAGCCTGGCCAAGATGGTGAAACCCCATCTCTGCTAAAAATAC
1681 AAAAAAAAATTAGCCGGGCATGGTGGCACGTGCCTGTAATCCCAGCTACTTGGGAGACTGAGGCAGGAGAATTGCTTGAA
1761 CCCGGGAGGCGGAGATTGCAGTGAGCCAAGATCACGCCGTTGCACTCCAGCCTGAGCAACAGAGCAAGACTCCATCTCAA
1841 AAAAACAAAACTACTTTCATTAATTACCCATTATTTATTTTAGTTACTTAATTTTGAGTTCATAAATGGCCACCCTAATG
1921 GAAAGTTTGGGTATGATCTTAGGTTTTATGGAGATGTTTTCAATAGAGATTATTTTTCCCTCACCCTATTTGTGAATATA
2001 TAAATTAAAGTAAGACAATGGAGTAAGTAAGAGGGTAGATCCAAACACAGTATGTCTAAATTCTAGCACTCTACTGGCTG
2081 CTTAGAATACACCAAACCTGGAAGACCTTTCCAAGAGTAAAATCCCAGTCTGCCACTATCAAAATTGCCACAGTCACTTT
2161 TACTACTTGTGTTCATAGTAGACTCAGCACTTCTTTTTCACTGGACCTAGTATAACTGAGAAATAAATAACTGTGTGCAA
2241 AATATTGGTATCATTAAGGACCCAGAGCTGCCCATTTTCTCTTTGTTCTAATAGGGAAGCAATTACTGATAGAAATGTGA
2321 GATTAAAAATAGGGTCCTCCCTGCTGCTCCAAACAAATGCCTAAACACAGTATGTATCTCAGTCCTCTGTTCCCAGAGAT
2401 TCCACCCTAGCCCAGGAAAGAACTGGCCTGTGTAAAGCAAAACCCAAGTCATCCCCCTCCAGAAATTTCTCTGGCAGCCA
2481 AGCCTGACCCTAAGGGTTCCACTTTGCTTTAAAAGCTAGGAGTGGCCTCTAGAGCCAGGAACACATTAATACAACAGTTC
2561 AACCTCAGCACCAAGTCAGGTACGAAGCGCTTGATACGTGGAATTTTTCTCTATATCAAGTTTAAATTTCTGGAAATAGA
2641 CTTTGGTTGCTAATGACAATTACAGTTATACCATAGTCTGTAATTTGAGAAAAGGTGAAATGTATTTAATATATATTTAG
2721 TTTTAATAAAAAGATAAAATTATTACAGAAATAATTGAGAGAGAGAAAATCTATTATAATTTATTTGAAAAATAAAACAT
2801 TTTATCCAGTAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:||   ||::|||||| 
Target 5' atcACGCC---GTTGCACTCCa 3'
1791 - 1809 144.00 -22.00
2
miRNA  3' guUUGUGGU-AACAG------UGUGAGGu 5'
            || |||| ||| |      ||||||: 
Target 5' taAAAACCATTTGCCAAAGCAACACTCTa 3'
1163 - 1191 142.00 -14.50
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||: :|| |||:||::||| 
Target 5' atAATTTCA-TGTTACGTTCCa 3'
2 - 22 135.00 -17.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14123857 10 COSMIC
COSN26998488 18 COSMIC
COSN31598761 19 COSMIC
COSN31526682 20 COSMIC
COSN31590385 33 COSMIC
COSN31591264 59 COSMIC
COSN30472419 85 COSMIC
COSN30150047 88 COSMIC
COSN31497002 114 COSMIC
COSN22117124 761 COSMIC
COSN2044761 811 COSMIC
COSN21598606 986 COSMIC
COSN21662726 1024 COSMIC
COSN9241561 1230 COSMIC
COSN23840030 1356 COSMIC
COSN25804385 1516 COSMIC
COSN27228674 1555 COSMIC
COSN32062055 1555 COSMIC
COSN14842537 1745 COSMIC
COSN23990167 1784 COSMIC
COSN21028955 2251 COSMIC
COSN9241562 2497 COSMIC
COSN23375602 2642 COSMIC
COSN27793859 2688 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775305862 2 dbSNP
rs762000773 4 dbSNP
rs1348068681 12 dbSNP
rs1287723593 13 dbSNP
rs200886095 18 dbSNP
rs760612371 27 dbSNP
rs766501836 29 dbSNP
rs899946108 30 dbSNP
rs201144684 35 dbSNP
rs760157982 36 dbSNP
rs1464265670 42 dbSNP
rs766411515 45 dbSNP
rs765671993 50 dbSNP
rs1165908718 53 dbSNP
rs1463145546 59 dbSNP
rs1409815363 73 dbSNP
rs111616901 80 dbSNP
rs1050227887 81 dbSNP
rs954568637 87 dbSNP
rs1470813401 94 dbSNP
rs890249828 102 dbSNP
rs1197203210 107 dbSNP
rs150162097 122 dbSNP
rs1468270137 127 dbSNP
rs556038935 130 dbSNP
rs185982918 135 dbSNP
rs1326507238 138 dbSNP
rs774476586 138 dbSNP
rs1282912402 140 dbSNP
rs1223805462 141 dbSNP
rs1017287447 144 dbSNP
rs1375451660 161 dbSNP
rs1272945116 162 dbSNP
rs1439971520 164 dbSNP
rs1482564224 171 dbSNP
rs1371455290 182 dbSNP
rs759475831 182 dbSNP
rs957799569 190 dbSNP
rs17000606 196 dbSNP
rs1014878935 207 dbSNP
rs1158519027 208 dbSNP
rs1472303327 208 dbSNP
rs1410814967 210 dbSNP
rs1157268291 213 dbSNP
rs897725616 214 dbSNP
rs1431693648 216 dbSNP
rs17000608 218 dbSNP
rs1027292720 219 dbSNP
rs1195162560 223 dbSNP
rs1463285224 227 dbSNP
rs1358296222 234 dbSNP
rs969132786 250 dbSNP
rs879332466 258 dbSNP
rs1215901394 266 dbSNP
rs1318186015 275 dbSNP
rs577925410 276 dbSNP
rs753731178 288 dbSNP
rs977698899 293 dbSNP
rs1309766787 294 dbSNP
rs1348388736 295 dbSNP
rs72866280 300 dbSNP
rs938819263 313 dbSNP
rs1285852813 317 dbSNP
rs1360137777 318 dbSNP
rs1055997347 320 dbSNP
rs894540757 326 dbSNP
rs1288447969 339 dbSNP
rs942107062 341 dbSNP
rs1038073308 344 dbSNP
rs988701808 350 dbSNP
rs1332816187 362 dbSNP
rs1434617974 363 dbSNP
rs897829954 372 dbSNP
rs1396159015 373 dbSNP
rs914182666 374 dbSNP
rs1447984326 377 dbSNP
rs192023273 379 dbSNP
rs1278379361 386 dbSNP
rs1310796223 391 dbSNP
rs1208005819 394 dbSNP
rs17000609 395 dbSNP
rs1235225940 410 dbSNP
rs1030242123 413 dbSNP
rs1485978343 422 dbSNP
rs890399854 423 dbSNP
rs957813546 425 dbSNP
rs1306689656 433 dbSNP
rs1248490564 443 dbSNP
rs1295203936 445 dbSNP
rs1215348482 452 dbSNP
rs1364231619 458 dbSNP
rs932743581 467 dbSNP
rs1051163287 473 dbSNP
rs542396038 475 dbSNP
rs149472230 478 dbSNP
rs1424281685 486 dbSNP
rs957748520 491 dbSNP
rs545441178 496 dbSNP
rs377726376 497 dbSNP
rs966393591 506 dbSNP
rs1411133066 507 dbSNP
rs546344183 510 dbSNP
rs1475214740 533 dbSNP
rs1259597353 538 dbSNP
rs1428982305 542 dbSNP
rs1202927932 549 dbSNP
rs564457891 559 dbSNP
rs982213601 560 dbSNP
rs1036579350 561 dbSNP
rs1436829621 562 dbSNP
rs897752916 574 dbSNP
rs995127030 580 dbSNP
rs1309516009 581 dbSNP
rs928884577 585 dbSNP
rs533458037 589 dbSNP
rs991627933 601 dbSNP
rs531963591 612 dbSNP
rs1356174230 620 dbSNP
rs1295698243 629 dbSNP
rs942056093 629 dbSNP
rs1001861123 632 dbSNP
rs1034796549 636 dbSNP
rs550640374 637 dbSNP
rs12647888 644 dbSNP
rs1342118598 646 dbSNP
rs1203549233 667 dbSNP
rs1463793870 671 dbSNP
rs988345754 682 dbSNP
rs1037790059 684 dbSNP
rs1461567043 691 dbSNP
rs1179632343 693 dbSNP
rs1418453706 695 dbSNP
rs1292136724 696 dbSNP
rs564146701 702 dbSNP
rs1178730138 704 dbSNP
rs576051324 707 dbSNP
rs1271580355 715 dbSNP
rs1213267686 719 dbSNP
rs1335605255 724 dbSNP
rs2126854 726 dbSNP
rs890351588 728 dbSNP
rs1316851937 737 dbSNP
rs1308269190 738 dbSNP
rs1393554961 742 dbSNP
rs1369230017 745 dbSNP
rs1007435792 752 dbSNP
rs1245176092 757 dbSNP
rs567732905 757 dbSNP
rs181753896 761 dbSNP
rs893633949 762 dbSNP
rs1156335294 766 dbSNP
rs1450449730 768 dbSNP
rs1364322182 786 dbSNP
rs1161197201 799 dbSNP
rs1010734858 801 dbSNP
rs1252124411 802 dbSNP
rs1020685194 804 dbSNP
rs779635267 806 dbSNP
rs1469101141 807 dbSNP
rs866153764 808 dbSNP
rs966891202 811 dbSNP
rs1255050850 813 dbSNP
rs751238948 837 dbSNP
rs148761977 849 dbSNP
rs1485578831 860 dbSNP
rs200045203 860 dbSNP
rs960239119 861 dbSNP
rs1322534515 863 dbSNP
rs1303154292 864 dbSNP
rs1235429120 867 dbSNP
rs535811010 870 dbSNP
rs1315716027 882 dbSNP
rs578052213 888 dbSNP
rs940068984 891 dbSNP
rs1432810355 894 dbSNP
rs1321651459 899 dbSNP
rs1364851869 900 dbSNP
rs1455377272 903 dbSNP
rs543473451 903 dbSNP
rs1286434862 910 dbSNP
rs374289016 911 dbSNP
rs1262485638 914 dbSNP
rs1218815882 916 dbSNP
rs1484994762 917 dbSNP
rs538645950 924 dbSNP
rs1212057239 952 dbSNP
rs1227828123 958 dbSNP
rs974001864 962 dbSNP
rs919334001 964 dbSNP
rs930490155 984 dbSNP
rs929402247 986 dbSNP
rs1248473672 994 dbSNP
rs540944702 995 dbSNP
rs1297141289 1001 dbSNP
rs556978558 1002 dbSNP
rs1374790719 1020 dbSNP
rs1190987439 1022 dbSNP
rs1239109224 1032 dbSNP
rs780882147 1037 dbSNP
rs113398135 1061 dbSNP
rs1162166660 1083 dbSNP
rs1166420519 1089 dbSNP
rs911902406 1105 dbSNP
rs114433521 1108 dbSNP
rs1001893656 1111 dbSNP
rs1458504195 1120 dbSNP
rs560863921 1121 dbSNP
rs893748580 1125 dbSNP
rs1388414133 1134 dbSNP
rs1009698221 1138 dbSNP
rs1010727318 1143 dbSNP
rs1339668591 1144 dbSNP
rs1021126977 1150 dbSNP
rs770463155 1153 dbSNP
rs1042626974 1157 dbSNP
rs1293871157 1169 dbSNP
rs1416518208 1170 dbSNP
rs902236887 1182 dbSNP
rs1003706784 1185 dbSNP
rs1034650191 1186 dbSNP
rs142475918 1188 dbSNP
rs1397500166 1189 dbSNP
rs540422042 1196 dbSNP
rs1282512383 1197 dbSNP
rs1460002396 1201 dbSNP
rs778276075 1209 dbSNP
rs1165686788 1210 dbSNP
rs1023202393 1213 dbSNP
rs1229314862 1232 dbSNP
rs749672335 1235 dbSNP
rs771339665 1236 dbSNP
rs1438744718 1240 dbSNP
rs973564619 1243 dbSNP
rs1239696648 1244 dbSNP
rs1203187907 1260 dbSNP
rs912517804 1263 dbSNP
rs1273288141 1267 dbSNP
rs1229492930 1274 dbSNP
rs961485098 1275 dbSNP
rs1278822942 1278 dbSNP
rs1442729208 1281 dbSNP
rs564824140 1285 dbSNP
rs1186683163 1295 dbSNP
rs973266890 1296 dbSNP
rs1393968853 1297 dbSNP
rs1165756463 1302 dbSNP
rs1026903974 1312 dbSNP
rs1406502916 1319 dbSNP
rs1158498330 1332 dbSNP
rs1470742430 1333 dbSNP
rs1182509652 1337 dbSNP
rs532901193 1344 dbSNP
rs190493868 1349 dbSNP
rs1048907819 1354 dbSNP
rs1253164810 1359 dbSNP
rs1174684108 1362 dbSNP
rs115010129 1363 dbSNP
rs937882095 1381 dbSNP
rs1224242683 1388 dbSNP
rs912017052 1392 dbSNP
rs1311586624 1400 dbSNP
rs1352451265 1401 dbSNP
rs1056141220 1402 dbSNP
rs759830906 1413 dbSNP
rs1370550433 1414 dbSNP
rs1294329074 1416 dbSNP
rs1438786291 1423 dbSNP
rs1343481353 1426 dbSNP
rs9307834 1427 dbSNP
rs915130695 1428 dbSNP
rs946643404 1429 dbSNP
rs1042184311 1431 dbSNP
rs1362956931 1437 dbSNP
rs1009233767 1438 dbSNP
rs529738790 1446 dbSNP
rs902351824 1463 dbSNP
rs1235611130 1464 dbSNP
rs1257560120 1468 dbSNP
rs939232794 1471 dbSNP
rs1056222130 1472 dbSNP
rs1345441196 1472 dbSNP
rs903590738 1473 dbSNP
rs1199871600 1476 dbSNP
rs775594130 1477 dbSNP
rs1278069410 1478 dbSNP
rs1489233196 1479 dbSNP
rs1483966024 1480 dbSNP
rs894918412 1481 dbSNP
rs182681635 1482 dbSNP
rs1016621122 1483 dbSNP
rs187889749 1488 dbSNP
rs1200531834 1492 dbSNP
rs1302298023 1499 dbSNP
rs1221137909 1500 dbSNP
rs1360066895 1501 dbSNP
rs747567533 1503 dbSNP
rs1378642797 1505 dbSNP
rs768186630 1506 dbSNP
rs1477887856 1507 dbSNP
rs1019860664 1511 dbSNP
rs775967188 1512 dbSNP
rs995507731 1513 dbSNP
rs1372970368 1516 dbSNP
rs1430910798 1517 dbSNP
rs1177851304 1518 dbSNP
rs972744574 1518 dbSNP
rs1418265994 1531 dbSNP
rs1394357843 1532 dbSNP
rs1388805394 1537 dbSNP
rs1255403329 1538 dbSNP
rs10643016 1543 dbSNP
rs1187103399 1543 dbSNP
rs1342445004 1543 dbSNP
rs35046039 1543 dbSNP
rs1292020918 1559 dbSNP
rs1026603819 1560 dbSNP
rs950948592 1561 dbSNP
rs987624830 1562 dbSNP
rs981730779 1563 dbSNP
rs1025868394 1566 dbSNP
rs1440400403 1575 dbSNP
rs1228977673 1576 dbSNP
rs1353622247 1579 dbSNP
rs1170946787 1581 dbSNP
rs1273359018 1583 dbSNP
rs747703617 1584 dbSNP
rs760995559 1585 dbSNP
rs1466771068 1590 dbSNP
rs1414998191 1596 dbSNP
rs1163523209 1598 dbSNP
rs528631060 1602 dbSNP
rs1475510288 1604 dbSNP
rs1018974697 1608 dbSNP
rs1258095477 1613 dbSNP
rs1175277765 1617 dbSNP
rs547219313 1620 dbSNP
rs1480177742 1623 dbSNP
rs1479368852 1625 dbSNP
rs1211307033 1632 dbSNP
rs191306828 1640 dbSNP
rs1199471647 1643 dbSNP
rs974692060 1645 dbSNP
rs1450637179 1647 dbSNP
rs1232681643 1654 dbSNP
rs984635678 1666 dbSNP
rs926411438 1670 dbSNP
rs1390094407 1672 dbSNP
rs1056824680 1681 dbSNP
rs937914775 1681 dbSNP
rs1448565027 1686 dbSNP
rs917834909 1687 dbSNP
rs538774767 1690 dbSNP
rs1450658122 1692 dbSNP
rs1156829738 1696 dbSNP
rs557054822 1697 dbSNP
rs568876926 1708 dbSNP
rs978406044 1711 dbSNP
rs1459484161 1717 dbSNP
rs923918527 1743 dbSNP
rs1251310664 1748 dbSNP
rs750222382 1751 dbSNP
rs1488846762 1763 dbSNP
rs1056339690 1764 dbSNP
rs182632856 1765 dbSNP
rs947801487 1769 dbSNP
rs1310493871 1772 dbSNP
rs866596902 1779 dbSNP
rs1038011226 1786 dbSNP
rs1302217446 1790 dbSNP
rs554518567 1796 dbSNP
rs773062167 1797 dbSNP
rs1048428784 1799 dbSNP
rs367784116 1800 dbSNP
rs1008991641 1808 dbSNP
rs1393577866 1810 dbSNP
rs1019089705 1820 dbSNP
rs1294730432 1822 dbSNP
rs936388366 1823 dbSNP
rs964725623 1835 dbSNP
rs1363537097 1838 dbSNP
rs1485832350 1841 dbSNP
rs1287291627 1859 dbSNP
rs1219320001 1866 dbSNP
rs1346159360 1870 dbSNP
rs1279209466 1871 dbSNP
rs187710623 1877 dbSNP
rs1265475191 1882 dbSNP
rs192520230 1888 dbSNP
rs1381095952 1912 dbSNP
rs754700779 1926 dbSNP
rs1299958627 1931 dbSNP
rs1020313542 1932 dbSNP
rs1374603537 1935 dbSNP
rs1172899799 1937 dbSNP
rs1250358481 1964 dbSNP
rs978140180 1966 dbSNP
rs897385482 1970 dbSNP
rs1477526984 1981 dbSNP
rs1188535352 1985 dbSNP
rs1260284957 2006 dbSNP
rs1196428481 2008 dbSNP
rs923840121 2018 dbSNP
rs960667852 2019 dbSNP
rs994593212 2020 dbSNP
rs1346689847 2021 dbSNP
rs1026957799 2024 dbSNP
rs991966518 2034 dbSNP
rs916427284 2035 dbSNP
rs1317961400 2036 dbSNP
rs1280075213 2040 dbSNP
rs780829027 2042 dbSNP
rs1275998281 2048 dbSNP
rs1412883866 2054 dbSNP
rs752321076 2055 dbSNP
rs1334573997 2057 dbSNP
rs1397505788 2064 dbSNP
rs1347786976 2073 dbSNP
rs1038125705 2074 dbSNP
rs919711584 2076 dbSNP
rs770898496 2088 dbSNP
rs1465201582 2090 dbSNP
rs929619802 2091 dbSNP
rs558749299 2118 dbSNP
rs1046741273 2119 dbSNP
rs576992992 2126 dbSNP
rs1435515529 2127 dbSNP
rs886667415 2131 dbSNP
rs1009106250 2135 dbSNP
rs1034432912 2140 dbSNP
rs959227883 2143 dbSNP
rs991994292 2149 dbSNP
rs917852207 2150 dbSNP
rs79442474 2166 dbSNP
rs900670858 2167 dbSNP
rs1197599774 2170 dbSNP
rs1457896623 2171 dbSNP
rs996339833 2173 dbSNP
rs147530782 2184 dbSNP
rs1334091944 2186 dbSNP
rs968188352 2190 dbSNP
rs1284689476 2198 dbSNP
rs543568351 2210 dbSNP
rs541850016 2216 dbSNP
rs1327158457 2217 dbSNP
rs1446346987 2224 dbSNP
rs924908814 2228 dbSNP
rs1401250694 2231 dbSNP
rs1459887159 2232 dbSNP
rs561421719 2232 dbSNP
rs960572481 2234 dbSNP
rs1269600316 2238 dbSNP
rs756675310 2246 dbSNP
rs1362447954 2257 dbSNP
rs1330311066 2263 dbSNP
rs944226433 2265 dbSNP
rs796391903 2267 dbSNP
rs1239552515 2270 dbSNP
rs1211337292 2272 dbSNP
rs12791 2273 dbSNP
rs1215555208 2286 dbSNP
rs1259258715 2295 dbSNP
rs372246866 2303 dbSNP
rs528822303 2310 dbSNP
rs1348396919 2319 dbSNP
rs1308302921 2320 dbSNP
rs1240520712 2335 dbSNP
rs774399508 2340 dbSNP
rs1377945868 2341 dbSNP
rs969193588 2346 dbSNP
rs546865359 2347 dbSNP
rs1349348922 2349 dbSNP
rs1324228320 2350 dbSNP
rs1026991128 2351 dbSNP
rs888488797 2356 dbSNP
rs1001529071 2360 dbSNP
rs1184670943 2361 dbSNP
rs1034464086 2367 dbSNP
rs919642308 2373 dbSNP
rs960095200 2374 dbSNP
rs1191330502 2379 dbSNP
rs929760230 2381 dbSNP
rs6816985 2388 dbSNP
rs912237654 2399 dbSNP
rs967030061 2402 dbSNP
rs978071655 2407 dbSNP
rs184892003 2408 dbSNP
rs1288484071 2415 dbSNP
rs550620222 2420 dbSNP
rs1367121152 2426 dbSNP
rs9041 2427 dbSNP
rs1438628285 2454 dbSNP
rs900785516 2456 dbSNP
rs1298115597 2458 dbSNP
rs1420742394 2462 dbSNP
rs1362826057 2466 dbSNP
rs1172112492 2469 dbSNP
rs1412365161 2479 dbSNP
rs1413588208 2496 dbSNP
rs932137143 2508 dbSNP
rs1425356309 2515 dbSNP
rs1043912009 2517 dbSNP
rs1474133837 2519 dbSNP
rs767511651 2524 dbSNP
rs1262471100 2535 dbSNP
rs985071820 2536 dbSNP
rs910988587 2543 dbSNP
rs536241532 2548 dbSNP
rs943773930 2549 dbSNP
rs1255175780 2555 dbSNP
rs903909810 2561 dbSNP
rs554988652 2563 dbSNP
rs1031539930 2567 dbSNP
rs1279579890 2574 dbSNP
rs1222790888 2583 dbSNP
rs187645126 2584 dbSNP
rs1013617638 2585 dbSNP
rs1211485582 2589 dbSNP
rs1023545527 2590 dbSNP
rs1048711922 2592 dbSNP
rs969308299 2593 dbSNP
rs1301466208 2597 dbSNP
rs974291187 2598 dbSNP
rs1026821697 2599 dbSNP
rs1280217981 2599 dbSNP
rs951170975 2614 dbSNP
rs1177786298 2620 dbSNP
rs1407761621 2642 dbSNP
rs1484948854 2642 dbSNP
rs1422317498 2645 dbSNP
rs1170725460 2649 dbSNP
rs1478763789 2660 dbSNP
rs982544363 2661 dbSNP
rs1181122153 2671 dbSNP
rs1207422491 2672 dbSNP
rs888689191 2681 dbSNP
rs1212489130 2684 dbSNP
rs912350398 2695 dbSNP
rs1456575320 2701 dbSNP
rs943688035 2702 dbSNP
rs1257542343 2706 dbSNP
rs534124580 2721 dbSNP
rs1001561571 2723 dbSNP
rs541396064 2727 dbSNP
rs1311194464 2728 dbSNP
rs1228178502 2730 dbSNP
rs1175689368 2747 dbSNP
rs1055782442 2757 dbSNP
rs1304907537 2757 dbSNP
rs895903624 2757 dbSNP
rs1331454990 2762 dbSNP
rs1405607055 2764 dbSNP
rs1466717631 2766 dbSNP
rs76080489 2766 dbSNP
rs1163946528 2767 dbSNP
rs558601214 2774 dbSNP
rs1424224501 2775 dbSNP
rs922157208 2776 dbSNP
rs568382891 2779 dbSNP
rs1176771986 2800 dbSNP
rs1463417626 2810 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |||||| 
Target 5' ---------------CACUCCa 3'
1 - 7
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000311638.3 | 3UTR | CACUCCAGCCUGAGCAACAGAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*