miRTarBase - #MIRT706962 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FANCC   
Synonyms FA3, FAC, FACC
Description Fanconi anemia complementation group C
Transcript NM_000136   
Expression
Putative miRNA Targets on FANCC
3'UTR of FANCC
(miRNA target sites are highlighted)
>FANCC|NM_000136|3'UTR
   1 AAGGCACGCAGGCCGTGTGGGTGCCCGGCGTGAGGGATCAGGCTCGCCAGGGCCACAGGACAGGTGATGACCTGTGGCCA
  81 CGCATTTGTGGAGTAAGTGCCCTCGCTGGGCTGTGAGAATGAGCTGTACACATCTTGGGACAATCTGCTAGTATCTATTT
 161 TACAAAATGCAGAGCCAGGTCCCTCAGCCCAGACTCAGTCAGACATGTTCACTAATGACTCAAGTGAGCCTTCGGTACTC
 241 CTGGTGCCCGCCCGGCCAGACCGTCAGCTTGATAATTACTAAAGCAAAGGCCTGGGTGGGAGAACAGGTTTCTAGTTTTT
 321 ACCCAAGTCAAGCTGCACATCTATTATTTAAAAATTCAAAGTCTTAGAACCAAGAATTTGGTCATGAACCATTAAAGAAT
 401 TTAGAGAGAACTTAGCTCTTTTTAGACTCTTTTTAGGAGTCAGGGATCTGGGATAAAGCCACACTGTCTTGCTGTATGGA
 481 GAAATTCTTCAAGGGGAGTCAGGGTCCCTCAGGCTTCCCTTGTGTCTCCCTGGACCTGCCTGACAGGCCACAGGAGCAGA
 561 CAGCACACCCAAGCCCGGGCCTCCGGCACACTCTTTCCACTCTGTATTTGCTAAATGATGCTAACTGCTACCAAAAGGCC
 641 CTTGGGACATCAGAGGAGCCGGCAGGCGAAGGTAGAGGATGTGTTCCAGAAACATTAGAAGGCAGGATTAATTCAGTTAG
 721 TTAGTTCTCTTGTTAAATGGAAATGGGAATTGGAAATTCCTGATAAAGAATTGGCCTGGCTGGGTGCAGTGGCTCACACC
 801 TGTGATCCCAGCACTTTGGGAGGCCAAGGCAGGGGGATTACTTCAGCCCAGGAGTTCCAGACTGCCTGGCTAACATGGCA
 881 ATACCCTATCTCTACTAAAAATACAAAAATTATCGGGGTGCAATGGCATGCATCTGTAATCCCAGCTATTCAAGAGGCTG
 961 AGGCATGAGGATCTCTTGAACCCGGGAGGTGGGAGTTGTAGTGAGCCGAGATCATGACACTGCACTCCAGCCTGGGCAAC
1041 AGAGCGAGACCATCTCTTAAAAAAAGGCATTGTTAGTGTAATCTCAAGGTTAACATTTATTTCATGTCAGTACAGGGTGC
1121 TTTTTCCTTTCAGGGACATTCTGGAATTGTATTGGTTGTACATTCTTTTGTGTCTATTCTGTTTGTCAAGTGAGTCAAGA
1201 CTTGCTTTTGTCCATTTTGATTTGTGTGTATTAGTCTGAGTCTTGGCTCCGTTTTGAGGTATGAGCAAAGTTTTGCTGGA
1281 TTAGAAGTTAACCTTTAGGGAAATTCCTTATTTTGGTATGTGGCAATGCTAATAGATCCACTGAAGATCTGGAAAATTCC
1361 AGGAACTTTTCACCTGAGCCTTTCTTCTGAGAAATGCTGCAGTCAGAAGGGTGTGCTGGTAAAGTATTTTGGTGGCAGCT
1441 GCCATCATGGTCATTGCCTTCATATAACATGCTTCGTGCTCATGGTCATTGCCTTCATATAACATGCTTCGTGCCATCAT
1521 GATCCTTGCCTTCATATAACAAACATGCTTCGTCAGAGGTGTTGGGGTTGAAAAAGGAGCTGCATGCTTCACTGGAGTTG
1601 AGGGCCTCTCTCCTGTTCTGACTTTAAGCCAGAACTTGTGGCTGGGCCATGGAAGCTGTGACTCCTCTGTGGACATGGTG
1681 GCAGCAGGGAACCCCTAGAGAGAGGGGCCACTGGGACCAGGCCTCCTGTTGTGGAGGGACTCCTGGGACAGTCCTCCACC
1761 CTGTCCTGTGGTCCTGTGTACAGGGTTGGCCTCTTCCTCCTCCCCTGCCAGGCCTCTGCCCATGCCCCTTCCTTCCTTCT
1841 CCTGGGACTGGTGAAGCTAGGCATCTGGAAGACTTCTTCCTAGCCTGGAAGCCCTGACCTCGGCCCATCTGCAGAATCTC
1921 CCAGTTCCTTCACAGCTGCCGAGTCCTCTCACGGGTGCGGTGGAGGCGGCCTTGCCGGTGGTGCTTTCTGGGCAGCCAGG
2001 GGTTCCTGGGTGGGAGGACTGTCCCTCTGGGGACGTGGCACTGAAGTGCCTGCTGGCTTCATGTGGCCCTTTGCCCTTTC
2081 CCAGCCTGAGAGATGCTCAAAGGTGGGGAGCTGGGGGAGCCACCCCTCGGCCATTCCCTCCACCTCCAAGACAGGTGGCG
2161 GCCGGGCAGGCACTCTTAAGCCCACCTCCCCCTCTTGTTGCCTTCGATTTCGGCAAAGCCTGGGCAGGTGCCACCGGGAA
2241 GGAATGGCATCCGAGATGCTGGGCGGGGACGCGGCGTGGCCGAGGGGGCCTTGACGGCGTTGGCGGGGCCTGGGCACAGG
2321 GGCAGCCGCAGGGAGGCAGGGATGGCAAGGCGTGAAGCCACCCTGGAAGGAACTGGACCAAGGTCTTCAGAGGTGCGACA
2401 GGGTCTGGAATCTGACCTTACTCTAGCAGGAGTTTTTGTAGACTCTCCCTGATAGTTTAGTTTTTGATAAAGCATGCTGG
2481 TAAAACCACTACCCTCAGAGAGAGCCAAAAATACAGAAGAGGCGGAGAGCGCCCCTCCAACCAGGCTGTTATTCCCCTGG
2561 ACTCCGTGACATCTGTGGAATTTTTTAGCTCTTTAAAATCTGTAATTTGTTGTCTATTTTTTCATTCTAAATAAAACTTC
2641 AGTTTGCACCTAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG---UGUGAGGu 5'
            :| |:|| || |   :|||||| 
Target 5' ccGAGATCA-TGACACTGCACTCCa 3'
1006 - 1029 135.00 -15.50
2
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               :||   | |||||||: 
Target 5' cccggGCCTCCGGCACACTCTt 3'
574 - 595 133.00 -17.30
3
miRNA  3' guUUGUGGUAAC--A-GUGUGAGGu 5'
            ||:  :||||  | :|||:||: 
Target 5' ggAATTGTATTGGTTGTACATTCTt 3'
1143 - 1167 122.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
137286 5 ClinVar
377849 7 ClinVar
1202954 8 ClinVar
389719 10 ClinVar
387109 14 ClinVar
255272 42 ClinVar
913627 96 ClinVar
367608 98 ClinVar
367607 116 ClinVar
367606 143 ClinVar
913626 213 ClinVar
367605 249 ClinVar
913625 250 ClinVar
367604 254 ClinVar
912515 267 ClinVar
367603 338 ClinVar
367602 359 ClinVar
912514 431 ClinVar
210975 450 ClinVar
912513 476 ClinVar
912512 483 ClinVar
367601 516 ClinVar
367600 576 ClinVar
915217 577 ClinVar
915216 587 ClinVar
367599 593 ClinVar
367598 606 ClinVar
915215 660 ClinVar
367597 667 ClinVar
367596 727 ClinVar
367595 825 ClinVar
367594 884 ClinVar
367593 983 ClinVar
913983 984 ClinVar
913982 1028 ClinVar
367592 1045 ClinVar
913981 1059 ClinVar
913980 1096 ClinVar
913979 1197 ClinVar
367591 1262 ClinVar
367590 1276 ClinVar
367589 1288 ClinVar
367588 1332 ClinVar
367587 1339 ClinVar
367586 1359 ClinVar
913588 1379 ClinVar
913587 1468 ClinVar
367585 1483 ClinVar
367584 1495 ClinVar
912471 1515 ClinVar
367583 1516 ClinVar
912470 1649 ClinVar
912469 1662 ClinVar
912468 1675 ClinVar
367582 1727 ClinVar
912467 1727 ClinVar
367581 1871 ClinVar
367580 1879 ClinVar
367578 1895 ClinVar
367579 1895 ClinVar
915183 1901 ClinVar
367577 1968 ClinVar
915182 1976 ClinVar
367576 2052 ClinVar
367575 2085 ClinVar
367574 2128 ClinVar
913942 2164 ClinVar
913943 2164 ClinVar
913941 2246 ClinVar
367573 2271 ClinVar
367572 2296 ClinVar
367571 2305 ClinVar
913556 2308 ClinVar
913555 2402 ClinVar
913554 2524 ClinVar
367570 2528 ClinVar
367569 2552 ClinVar
913553 2564 ClinVar
COSN19626537 5 COSMIC
COSN31612799 7 COSMIC
COSN31569058 9 COSMIC
COSN31589591 13 COSMIC
COSN30525541 14 COSMIC
COSN30190395 19 COSMIC
COSN30118255 27 COSMIC
COSN30511496 45 COSMIC
COSN30161616 53 COSMIC
COSN30154191 74 COSMIC
COSN5708455 430 COSMIC
COSN21804034 1284 COSMIC
COSN32055640 1301 COSMIC
COSN9288154 1334 COSMIC
COSN7578530 1627 COSMIC
COSN31963073 1678 COSMIC
COSN22991745 1880 COSMIC
COSN31963072 2299 COSMIC
COSN2334589 2546 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1431652458 4 dbSNP
rs117175949 5 dbSNP
rs1322193324 6 dbSNP
rs372511678 7 dbSNP
rs753428914 8 dbSNP
rs370270817 9 dbSNP
rs1015228314 10 dbSNP
rs1448504558 12 dbSNP
rs760413505 14 dbSNP
rs775336408 15 dbSNP
rs767209716 16 dbSNP
rs759413874 17 dbSNP
rs888378164 20 dbSNP
rs774109877 24 dbSNP
rs770935196 26 dbSNP
rs761796772 27 dbSNP
rs531605962 29 dbSNP
rs375908568 30 dbSNP
rs747229495 36 dbSNP
rs34831009 37 dbSNP
rs76092534 37 dbSNP
rs76575945 38 dbSNP
rs34760720 39 dbSNP
rs7029888 42 dbSNP
rs763914550 45 dbSNP
rs369503655 46 dbSNP
rs757786105 47 dbSNP
rs1333269409 52 dbSNP
rs928066874 55 dbSNP
rs1183975738 61 dbSNP
rs1296949388 62 dbSNP
rs934624909 67 dbSNP
rs369235858 70 dbSNP
rs1232657325 71 dbSNP
rs926261922 74 dbSNP
rs56383909 77 dbSNP
rs1208952967 78 dbSNP
rs760573194 81 dbSNP
rs529828813 82 dbSNP
rs779450392 83 dbSNP
rs1447091640 84 dbSNP
rs1221025915 88 dbSNP
rs1169962749 90 dbSNP
rs1319870526 91 dbSNP
rs976861230 92 dbSNP
rs55687573 96 dbSNP
rs1015262677 97 dbSNP
rs1057515705 98 dbSNP
rs1363681376 99 dbSNP
rs1372425380 99 dbSNP
rs1286205508 100 dbSNP
rs1298436451 101 dbSNP
rs540891064 104 dbSNP
rs920493853 105 dbSNP
rs771289098 111 dbSNP
rs7048910 116 dbSNP
rs1026925048 117 dbSNP
rs1358254882 123 dbSNP
rs964425118 125 dbSNP
rs1247289800 128 dbSNP
rs558379284 140 dbSNP
rs189154697 143 dbSNP
rs1167606056 151 dbSNP
rs1162318465 153 dbSNP
rs576156516 157 dbSNP
rs966825805 158 dbSNP
rs1021154994 185 dbSNP
rs1437903197 192 dbSNP
rs1321288017 196 dbSNP
rs1378605049 203 dbSNP
rs1011025953 206 dbSNP
rs1315064836 211 dbSNP
rs184733418 213 dbSNP
rs1055290601 216 dbSNP
rs1002382072 217 dbSNP
rs1233616261 221 dbSNP
rs895913054 223 dbSNP
rs906537093 228 dbSNP
rs1326992056 229 dbSNP
rs1180430895 233 dbSNP
rs1053605766 234 dbSNP
rs1482665494 238 dbSNP
rs369774588 247 dbSNP
rs1252015599 248 dbSNP
rs1046795121 249 dbSNP
rs1057515704 249 dbSNP
rs193261247 250 dbSNP
rs1410294914 253 dbSNP
rs773331481 254 dbSNP
rs1160527807 262 dbSNP
rs932912514 263 dbSNP
rs769817519 267 dbSNP
rs921494626 272 dbSNP
rs1380079457 278 dbSNP
rs1409515705 286 dbSNP
rs1287475497 300 dbSNP
rs1348452056 303 dbSNP
rs1266049794 307 dbSNP
rs930451402 313 dbSNP
rs965508356 329 dbSNP
rs1207342777 333 dbSNP
rs1257246565 337 dbSNP
rs1057515703 338 dbSNP
rs920400068 338 dbSNP
rs572523801 347 dbSNP
rs1250031913 350 dbSNP
rs4647551 359 dbSNP
rs1289146072 368 dbSNP
rs538871646 381 dbSNP
rs1425012936 382 dbSNP
rs1431952687 384 dbSNP
rs911566667 390 dbSNP
rs143389232 394 dbSNP
rs987533287 400 dbSNP
rs1429323707 401 dbSNP
rs1306447947 403 dbSNP
rs1372673670 404 dbSNP
rs1365651769 409 dbSNP
rs1411375826 414 dbSNP
rs548572682 416 dbSNP
rs1437855725 419 dbSNP
rs966523926 422 dbSNP
rs1027079257 426 dbSNP
rs1388496840 428 dbSNP
rs748660707 429 dbSNP
rs1471328503 431 dbSNP
rs550009657 431 dbSNP
rs573637178 433 dbSNP
rs555196606 435 dbSNP
rs1483841776 436 dbSNP
rs1157417562 447 dbSNP
rs149227790 450 dbSNP
rs1487784441 459 dbSNP
rs543174450 464 dbSNP
rs1395732556 469 dbSNP
rs1413158205 473 dbSNP
rs1448899006 474 dbSNP
rs756786451 476 dbSNP
rs1392193046 479 dbSNP
rs548064261 483 dbSNP
rs138260241 484 dbSNP
rs999334077 490 dbSNP
rs904579654 493 dbSNP
rs1485518391 500 dbSNP
rs1371672808 501 dbSNP
rs1294774365 503 dbSNP
rs1433641283 503 dbSNP
rs1343853190 504 dbSNP
rs1246049597 507 dbSNP
rs1210358334 512 dbSNP
rs1214856510 513 dbSNP
rs1289590175 514 dbSNP
rs1004604171 516 dbSNP
rs1057515702 516 dbSNP
rs559405001 522 dbSNP
rs1048524903 523 dbSNP
rs1043471420 524 dbSNP
rs931364299 525 dbSNP
rs1186674682 529 dbSNP
rs899004363 535 dbSNP
rs1038850542 538 dbSNP
rs921550878 553 dbSNP
rs1310630955 554 dbSNP
rs1041276927 561 dbSNP
rs547529035 569 dbSNP
rs943332045 572 dbSNP
rs1057515701 576 dbSNP
rs1303539766 577 dbSNP
rs908689850 578 dbSNP
rs758039948 581 dbSNP
rs987176686 584 dbSNP
rs4647552 585 dbSNP
rs190544450 587 dbSNP
rs1376542640 591 dbSNP
rs969036292 592 dbSNP
rs561885351 593 dbSNP
rs202002506 594 dbSNP
rs1270065294 599 dbSNP
rs56271854 606 dbSNP
rs956557360 620 dbSNP
rs1235892172 622 dbSNP
rs1473902493 631 dbSNP
rs957750212 638 dbSNP
rs1464261646 647 dbSNP
rs1452427818 656 dbSNP
rs114612660 660 dbSNP
rs560893486 661 dbSNP
rs150462386 667 dbSNP
rs756756014 668 dbSNP
rs1043137022 672 dbSNP
rs976747246 673 dbSNP
rs753765376 684 dbSNP
rs996840650 692 dbSNP
rs1357005851 693 dbSNP
rs1465271720 696 dbSNP
rs4647553 708 dbSNP
rs572664166 709 dbSNP
rs1255262960 718 dbSNP
rs1294273619 720 dbSNP
rs1227059479 727 dbSNP
rs56250966 727 dbSNP
rs1198473377 729 dbSNP
rs887127195 736 dbSNP
rs1199879682 740 dbSNP
rs1276676367 748 dbSNP
rs1041307863 758 dbSNP
rs944306522 759 dbSNP
rs1257911475 762 dbSNP
rs908769148 765 dbSNP
rs1234232511 768 dbSNP
rs1472120021 768 dbSNP
rs1047677594 771 dbSNP
rs554177200 776 dbSNP
rs1026945471 780 dbSNP
rs931462868 782 dbSNP
rs919705909 789 dbSNP
rs1436168092 792 dbSNP
rs1341619024 799 dbSNP
rs1313152037 802 dbSNP
rs980515995 804 dbSNP
rs1231312825 810 dbSNP
rs763956310 819 dbSNP
rs1057515700 825 dbSNP
rs917576719 829 dbSNP
rs1312493072 836 dbSNP
rs991797942 837 dbSNP
rs1273132044 838 dbSNP
rs1394597119 847 dbSNP
rs1403906520 853 dbSNP
rs1235158802 854 dbSNP
rs899912241 866 dbSNP
rs956856849 874 dbSNP
rs1030880241 879 dbSNP
rs1038927110 884 dbSNP
rs1057515699 884 dbSNP
rs943180279 885 dbSNP
rs979684000 888 dbSNP
rs890408612 891 dbSNP
rs1198131169 893 dbSNP
rs1244439602 894 dbSNP
rs1428687627 895 dbSNP
rs1455161567 901 dbSNP
rs1173735507 904 dbSNP
rs1342537802 912 dbSNP
rs1052130713 914 dbSNP
rs945289900 915 dbSNP
rs760485290 920 dbSNP
rs1397721883 923 dbSNP
rs1386674307 924 dbSNP
rs1169902702 926 dbSNP
rs1450037201 933 dbSNP
rs1022149785 939 dbSNP
rs996871661 946 dbSNP
rs1367772175 948 dbSNP
rs989098196 951 dbSNP
rs1296970585 953 dbSNP
rs1340297690 954 dbSNP
rs936463547 963 dbSNP
rs1252828507 969 dbSNP
rs1339874082 970 dbSNP
rs1256577919 975 dbSNP
rs56059656 983 dbSNP
rs3780559 984 dbSNP
rs865887946 987 dbSNP
rs1469771475 992 dbSNP
rs971315647 995 dbSNP
rs1025115331 996 dbSNP
rs983439044 1000 dbSNP
rs887364685 1007 dbSNP
rs554500052 1008 dbSNP
rs1027024042 1014 dbSNP
rs1457678472 1017 dbSNP
rs931513834 1020 dbSNP
rs556229977 1028 dbSNP
rs1462488950 1036 dbSNP
rs537983135 1045 dbSNP
rs964149259 1046 dbSNP
rs1384101746 1049 dbSNP
rs1044866059 1059 dbSNP
rs1340117195 1064 dbSNP
rs1243715425 1066 dbSNP
rs34302466 1066 dbSNP
rs1271113229 1069 dbSNP
rs1018763185 1070 dbSNP
rs55897369 1071 dbSNP
rs1172260736 1072 dbSNP
rs991828959 1076 dbSNP
rs1206402158 1081 dbSNP
rs1261928674 1087 dbSNP
rs111688138 1096 dbSNP
rs1186249909 1096 dbSNP
rs1420546496 1100 dbSNP
rs1475807635 1104 dbSNP
rs1159120455 1106 dbSNP
rs548932040 1112 dbSNP
rs767480649 1114 dbSNP
rs979353361 1116 dbSNP
rs533951517 1119 dbSNP
rs1009473688 1124 dbSNP
rs763249643 1132 dbSNP
rs968312972 1133 dbSNP
rs1028794462 1134 dbSNP
rs974524095 1135 dbSNP
rs34108689 1136 dbSNP
rs964098605 1137 dbSNP
rs565920274 1141 dbSNP
rs1287595424 1143 dbSNP
rs1053408438 1152 dbSNP
rs1217225456 1155 dbSNP
rs1260871946 1155 dbSNP
rs936326372 1158 dbSNP
rs550217630 1160 dbSNP
rs1161449056 1165 dbSNP
rs1459358333 1176 dbSNP
rs1368873253 1178 dbSNP
rs1019622577 1181 dbSNP
rs184467569 1185 dbSNP
rs752310661 1189 dbSNP
rs1045232800 1190 dbSNP
rs532326711 1194 dbSNP
rs1026341216 1197 dbSNP
rs1472398092 1201 dbSNP
rs564970245 1205 dbSNP
rs1159912221 1219 dbSNP
rs949123682 1220 dbSNP
rs56737425 1222 dbSNP
rs56280046 1224 dbSNP
rs951650611 1228 dbSNP
rs896246718 1230 dbSNP
rs1307186913 1244 dbSNP
rs1371086315 1245 dbSNP
rs1289228541 1250 dbSNP
rs765023311 1251 dbSNP
rs45520432 1262 dbSNP
rs374807520 1263 dbSNP
rs1228117459 1265 dbSNP
rs923616404 1268 dbSNP
rs1057515698 1276 dbSNP
rs1231586499 1277 dbSNP
rs1326657996 1278 dbSNP
rs1043755172 1284 dbSNP
rs1178329162 1286 dbSNP
rs4647554 1288 dbSNP
rs921812360 1294 dbSNP
rs1175615938 1298 dbSNP
rs1018253643 1306 dbSNP
rs1429423441 1310 dbSNP
rs1330052184 1318 dbSNP
rs1352595609 1323 dbSNP
rs1320976952 1327 dbSNP
rs191983554 1332 dbSNP
rs1391299876 1337 dbSNP
rs1158161591 1338 dbSNP
rs144155068 1339 dbSNP
rs1413905319 1343 dbSNP
rs1030618045 1344 dbSNP
rs1470624416 1347 dbSNP
rs769157295 1353 dbSNP
rs1009336483 1359 dbSNP
rs1057515697 1359 dbSNP
rs1348141240 1363 dbSNP
rs55901384 1379 dbSNP
rs912687064 1387 dbSNP
rs578111829 1399 dbSNP
rs747579960 1400 dbSNP
rs1205687812 1402 dbSNP
rs1265314519 1405 dbSNP
rs1467532568 1406 dbSNP
rs1053642258 1409 dbSNP
rs1253766791 1411 dbSNP
rs1449065114 1414 dbSNP
rs1185039113 1418 dbSNP
rs1421954676 1424 dbSNP
rs1411397086 1431 dbSNP
rs1170891864 1450 dbSNP
rs1393551920 1452 dbSNP
rs1453859538 1453 dbSNP
rs4647555 1457 dbSNP
rs1371147577 1465 dbSNP
rs780382671 1468 dbSNP
rs1044699461 1475 dbSNP
rs949189999 1476 dbSNP
rs200838550 1480 dbSNP
rs552548603 1483 dbSNP
rs796930684 1485 dbSNP
rs1216147426 1488 dbSNP
rs41281198 1495 dbSNP
rs930117509 1496 dbSNP
rs1475866619 1500 dbSNP
rs1299268604 1507 dbSNP
rs920064609 1510 dbSNP
rs974341205 1511 dbSNP
rs964251127 1514 dbSNP
rs1272593759 1515 dbSNP
rs55962383 1515 dbSNP
rs541816451 1516 dbSNP
rs1399559090 1522 dbSNP
rs986810834 1525 dbSNP
rs1315620932 1534 dbSNP
rs1346594713 1536 dbSNP
rs1431088954 1540 dbSNP
rs1293036245 1546 dbSNP
rs1353995648 1546 dbSNP
rs1234707434 1551 dbSNP
rs368208316 1552 dbSNP
rs1319879902 1555 dbSNP
rs778458747 1559 dbSNP
rs999293458 1563 dbSNP
rs1447782695 1566 dbSNP
rs1209733864 1567 dbSNP
rs1255712408 1579 dbSNP
rs1484540284 1585 dbSNP
rs1390628936 1586 dbSNP
rs902235542 1587 dbSNP
rs1469626981 1594 dbSNP
rs1320948062 1600 dbSNP
rs56138409 1612 dbSNP
rs1400894132 1613 dbSNP
rs1311853262 1615 dbSNP
rs756738484 1635 dbSNP
rs1416947114 1636 dbSNP
rs1313874386 1640 dbSNP
rs1335681458 1644 dbSNP
rs1424668586 1646 dbSNP
rs560444013 1649 dbSNP
rs4647556 1662 dbSNP
rs566794719 1663 dbSNP
rs554020926 1664 dbSNP
rs944567425 1665 dbSNP
rs911714210 1667 dbSNP
rs1212755475 1668 dbSNP
rs1258038727 1674 dbSNP
rs183099416 1675 dbSNP
rs1179623678 1677 dbSNP
rs1395763371 1679 dbSNP
rs1234559764 1682 dbSNP
rs572926650 1682 dbSNP
rs1470152502 1684 dbSNP
rs142666620 1687 dbSNP
rs1392804244 1688 dbSNP
rs531542660 1689 dbSNP
rs1023763752 1698 dbSNP
rs1436272381 1701 dbSNP
rs1174640173 1702 dbSNP
rs1396287855 1703 dbSNP
rs1390061895 1706 dbSNP
rs1331405979 1710 dbSNP
rs1336885373 1718 dbSNP
rs1013234705 1723 dbSNP
rs896255610 1725 dbSNP
rs4647557 1727 dbSNP
rs1250322905 1735 dbSNP
rs929688949 1742 dbSNP
rs1441497419 1745 dbSNP
rs1275980264 1763 dbSNP
rs898668047 1765 dbSNP
rs1458161856 1770 dbSNP
rs1192460575 1778 dbSNP
rs1038514039 1784 dbSNP
rs962696533 1785 dbSNP
rs942979148 1796 dbSNP
rs1012489099 1797 dbSNP
rs1193837044 1798 dbSNP
rs911460029 1802 dbSNP
rs1460735374 1809 dbSNP
rs987235071 1812 dbSNP
rs1397836206 1820 dbSNP
rs1323951582 1829 dbSNP
rs1461434724 1829 dbSNP
rs1201810763 1831 dbSNP
rs1000061994 1838 dbSNP
rs902268011 1840 dbSNP
rs1441772609 1844 dbSNP
rs1295059943 1846 dbSNP
rs1043857329 1856 dbSNP
rs1010566409 1858 dbSNP
rs1226145855 1861 dbSNP
rs934019502 1865 dbSNP
rs1270694864 1866 dbSNP
rs4647558 1871 dbSNP
rs527267868 1877 dbSNP
rs192262179 1879 dbSNP
rs957416199 1880 dbSNP
rs1358807361 1882 dbSNP
rs1332520706 1887 dbSNP
rs1195769682 1890 dbSNP
rs56161090 1895 dbSNP
rs1475150607 1900 dbSNP
rs756111303 1901 dbSNP
rs144528669 1902 dbSNP
rs1448226110 1904 dbSNP
rs1392505525 1910 dbSNP
rs562852184 1928 dbSNP
rs979229533 1932 dbSNP
rs969737264 1935 dbSNP
rs1472711606 1936 dbSNP
rs918715697 1938 dbSNP
rs544354429 1940 dbSNP
rs573943626 1941 dbSNP
rs867253899 1948 dbSNP
rs1291300666 1950 dbSNP
rs555434011 1953 dbSNP
rs1244880452 1954 dbSNP
rs540408471 1956 dbSNP
rs896173385 1957 dbSNP
rs1025276004 1958 dbSNP
rs573172664 1959 dbSNP
rs372025586 1967 dbSNP
rs114827984 1968 dbSNP
rs752733985 1976 dbSNP
rs967276851 1976 dbSNP
rs1344246049 1977 dbSNP
rs1158458596 1980 dbSNP
rs1273546286 1981 dbSNP
rs1455512145 2000 dbSNP
rs1159324164 2001 dbSNP
rs1375086165 2002 dbSNP
rs1038588077 2012 dbSNP
rs1310916848 2012 dbSNP
rs1376778553 2016 dbSNP
rs1357275600 2023 dbSNP
rs942869166 2030 dbSNP
rs1396589842 2033 dbSNP
rs374437528 2034 dbSNP
rs889922557 2035 dbSNP
rs539833295 2052 dbSNP
rs571523032 2053 dbSNP
rs934196440 2054 dbSNP
rs1286212485 2056 dbSNP
rs913241671 2058 dbSNP
rs988761779 2072 dbSNP
rs1346705702 2073 dbSNP
rs936125215 2075 dbSNP
rs926023462 2077 dbSNP
rs4647559 2085 dbSNP
rs1008479379 2086 dbSNP
rs969263505 2088 dbSNP
rs916378062 2092 dbSNP
rs1307511366 2094 dbSNP
rs1431808309 2098 dbSNP
rs1249073454 2100 dbSNP
rs1427823641 2103 dbSNP
rs538033096 2107 dbSNP
rs1420898693 2109 dbSNP
rs759438265 2111 dbSNP
rs1179346445 2115 dbSNP
rs567507884 2128 dbSNP
rs549045161 2129 dbSNP
rs992092602 2138 dbSNP
rs750609708 2140 dbSNP
rs929195847 2141 dbSNP
rs1025348442 2147 dbSNP
rs898977486 2148 dbSNP
rs1297491537 2159 dbSNP
rs527422632 2160 dbSNP
rs941443831 2163 dbSNP
rs566582636 2164 dbSNP
rs4647560 2166 dbSNP
rs928276130 2185 dbSNP
rs978731190 2190 dbSNP
rs1007026131 2192 dbSNP
rs1179322040 2196 dbSNP
rs1183925665 2198 dbSNP
rs889963119 2205 dbSNP
rs149721185 2206 dbSNP
rs1195694955 2208 dbSNP
rs1426168202 2209 dbSNP
rs761888600 2210 dbSNP
rs998480512 2211 dbSNP
rs1352682008 2212 dbSNP
rs964433733 2218 dbSNP
rs1483788900 2221 dbSNP
rs1393149040 2233 dbSNP
rs892041864 2235 dbSNP
rs532768209 2236 dbSNP
rs1053070723 2244 dbSNP
rs1367873898 2246 dbSNP
rs1214347532 2248 dbSNP
rs1293952625 2251 dbSNP
rs1309758375 2252 dbSNP
rs935992806 2253 dbSNP
rs1199872135 2259 dbSNP
rs1291787874 2260 dbSNP
rs1017276047 2264 dbSNP
rs1008554650 2265 dbSNP
rs925930059 2268 dbSNP
rs4647561 2269 dbSNP
rs1044506159 2270 dbSNP
rs562841213 2271 dbSNP
rs544545310 2272 dbSNP
rs776571202 2274 dbSNP
rs916425232 2276 dbSNP
rs1478744087 2281 dbSNP
rs1298791779 2282 dbSNP
rs529432395 2288 dbSNP
rs1459361547 2290 dbSNP
rs1037540085 2295 dbSNP
rs561975553 2296 dbSNP
rs918489083 2298 dbSNP
rs972616013 2299 dbSNP
rs962388189 2304 dbSNP
rs562465438 2305 dbSNP
rs1042363957 2308 dbSNP
rs1006647556 2309 dbSNP
rs1333347379 2320 dbSNP
rs761146355 2327 dbSNP
rs1446613041 2328 dbSNP
rs573219444 2328 dbSNP
rs1213962517 2341 dbSNP
rs1244088305 2344 dbSNP
rs1489120592 2348 dbSNP
rs776017300 2351 dbSNP
rs1029867752 2352 dbSNP
rs1164474060 2352 dbSNP
rs1413941836 2353 dbSNP
rs1399650845 2354 dbSNP
rs1156434067 2359 dbSNP
rs564611460 2363 dbSNP
rs1362083991 2374 dbSNP
rs1400925290 2374 dbSNP
rs998740190 2376 dbSNP
rs1312721197 2377 dbSNP
rs188879574 2379 dbSNP
rs1450874399 2383 dbSNP
rs1284820280 2390 dbSNP
rs892077404 2396 dbSNP
rs987164620 2397 dbSNP
rs1354689137 2402 dbSNP
rs954432403 2402 dbSNP
rs575752521 2404 dbSNP
rs1279402124 2407 dbSNP
rs1307827446 2408 dbSNP
rs368233355 2413 dbSNP
rs1189485595 2416 dbSNP
rs1238008728 2417 dbSNP
rs1469133622 2424 dbSNP
rs1174983042 2425 dbSNP
rs1218666741 2442 dbSNP
rs1053316067 2445 dbSNP
rs1173373986 2446 dbSNP
rs1000381511 2454 dbSNP
rs1416546134 2454 dbSNP
rs904536837 2458 dbSNP
rs1335699927 2460 dbSNP
rs993137989 2469 dbSNP
rs1044757468 2470 dbSNP
rs139570687 2481 dbSNP
rs1377899678 2483 dbSNP
rs1233898055 2490 dbSNP
rs1388430102 2491 dbSNP
rs1318905921 2493 dbSNP
rs917319530 2496 dbSNP
rs1455044187 2498 dbSNP
rs1012794955 2502 dbSNP
rs894293675 2503 dbSNP
rs1056324968 2514 dbSNP
rs1239513494 2515 dbSNP
rs1439886570 2520 dbSNP
rs1192567550 2523 dbSNP
rs538174626 2523 dbSNP
rs56199232 2524 dbSNP
rs1057515696 2528 dbSNP
rs1396403857 2530 dbSNP
rs879890596 2531 dbSNP
rs1333411938 2540 dbSNP
rs1194234524 2542 dbSNP
rs1448758366 2543 dbSNP
rs1401075996 2544 dbSNP
rs1440292981 2548 dbSNP
rs1246001128 2551 dbSNP
rs1333055170 2551 dbSNP
rs9673 2552 dbSNP
rs1338639511 2555 dbSNP
rs1042786067 2557 dbSNP
rs941223209 2558 dbSNP
rs867808901 2563 dbSNP
rs945363629 2564 dbSNP
rs1261467592 2565 dbSNP
rs1209677503 2566 dbSNP
rs915529807 2576 dbSNP
rs909582085 2580 dbSNP
rs968487532 2585 dbSNP
rs1264743883 2595 dbSNP
rs1453038830 2609 dbSNP
rs1199999844 2610 dbSNP
rs943566948 2613 dbSNP
rs1474650094 2615 dbSNP
rs1173396531 2616 dbSNP
rs1424992111 2617 dbSNP
rs1460926841 2619 dbSNP
rs1324051030 2620 dbSNP
rs1393134666 2623 dbSNP
rs985526779 2633 dbSNP
rs1387608503 2636 dbSNP
rs1323929099 2637 dbSNP
rs910709067 2641 dbSNP
rs1216589301 2647 dbSNP
rs953840897 2649 dbSNP
rs1279952216 2651 dbSNP
rs987574953 2653 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       ::|||||| 
Target 5' ----------cacUGCACUCCa 3'
1 - 12
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000289081.3 | 3UTR | CACUGCACUCCAGCCUGGGCAACAGAGCGAGACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*