miRTarBase - #MIRT707072 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MED29   
Synonyms IXL, MED2
Description mediator complex subunit 29
Transcript NM_017592   
Expression
Putative miRNA Targets on MED29
3'UTR of MED29
(miRNA target sites are highlighted)
>MED29|NM_017592|3'UTR
   1 AGTGGGGGACAGGGAGTGGGGCAGGCAGTGGTTGGTGGGTGGTGTGCAAAGGGAATGAAGAGCGTCCTGGGCCTAAACAC
  81 AGCAGCCTCCTCTCTTCCTGCCTGAGCACCGCAGCGGGAGCCAGCAGGGGGCAGCAGAGGCCAACAGGGAGCTCGCAGGC
 161 CGGGCCCCTGCGTCCCTGCCCCTTCTTCCTGCTCCCCCTCCTAGCCTAGGGTAGACTTTGAACTGTGTGTGTTGATGACT
 241 TCTCTGTTCCACAGGCCCTCCCCCATTCTTGCCTGGGTGTGGAGCCCTGGCTGTCCCCTCTCCCTCAGTCCTTCCTGACT
 321 GTCTCCAGCTGGGAGGTGGTCTCTGTGTGCCACTCCTCTGTGTCTCTATTACAGTTGTGTCTCTCTCATCCTGTCTCTTT
 401 TTCCCTTGTTTCTCTGTTCCTGTTAATGTGTTTCTCCCCATGGTCCTATTTCTCTCACTCTGACCTCTCTCTCTTAGTCC
 481 CCTTTAGCTGTCTTCTATCCCCAGCTCCTAACTGGGACTCTGTGTCTATGCAGGGGGCCAGCACCCCTGGGTTATCTGGG
 561 GCTAAGGGAAGGGACTTCATTTCCAGGGGCCACAGCCAAGCCCAGAGTCCCCCAGCGGCTCGCATGTCAGCCCAGACCCC
 641 AGGGTCCTTGGCCTAGGAGAGGAGCAGTGGAGGGGCCCAGGCTCTGAGCTCCACAGGTCTGAGCAGGGAGCAACTCAGGC
 721 CCCCACCCAAGCCTGCGTCAGCGGAACTTGAGTGAGGGGCGTTGTGCAATTTGTGGCAAGGCTGGCCCAGCTGGATGCCT
 801 GGGTCCCAGTATTTTTAGCCCCAAAGGAGAAGTGAAAAGGCCCCAGCCGGGGTGAATCATCAGTCCTGGGGAAGAACCCA
 881 GGCGCCTGAGCCCCAGCTCCGGGAAGCAGGCACTGGGGAGGGGGCTTCAAGGAGGGAGTGCCCCCTCAGACTCCCTGCTT
 961 CCCTGGAAGCTTCAGGAAGCTCAGCCTCAGCCTTCAGGCCTGAGCAAGTGCAGGGCGGAGCTACCAGCCCAGGCTCAGAT
1041 GTTGGGGTGTGAAAGCCTCAAGTGACTCAGCCTGGTTGGAGAACTGCCCCACCCAGTATCTTCTGTGCCATGGTTCCCAC
1121 ATTCGCACTCCATGGCCTCCTGTCCTGGACCCCACGTCTGCAAGGAAACCCTAGGACCATGGATACCTCTGTGATTCACG
1201 CTGAGCCCAAGTCCCCACACTGGAAAACTGGGAAATGGCCAGCTGTGTGTCCCAGGAAATTCCTCCCCTTATTCTTCCTT
1281 GAAGTGCCCGAGCATGTAGGGCAAGAAGGAAGGCTGAAGCGCTGTCCCTAGGAGGAATTTCTCCTTCAGGGGAGCCTCAG
1361 TTTTGCCCATTTATCTAATTGAATCAGTTTTTTACCCAATCCCCCGATTTTGTAGGATAATCTCCCTTATCTAAAGTCAA
1441 CTGATTATGGACTTTAATCACATCTACAAAACACTTCCATGGCGACAGCTAGATGAGTGTTTGAATAACTGGGACTGTAG
1521 CCCGTCCAAGTTGACACATAAAACTGACCATCGGGCCGGGGGCGGTGGCTCACGCCTGTAATCCCAACACTTTGGGAGCC
1601 CGAGGCGGGCGGATCACAAGGTCAGGAGTTCGAGACCAGCCTGGCCAACACGGTGAAACCCCGACTCTACTAAAAATACA
1681 AAAAATTAGCCGGGTGTGGTGGCACACACCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGTTTGAACCTG
1761 GGAGGCAGAGGTTGCAGTGAGCCAAGATCACACTATTGCACTCCAGCCTGGGCGACAGGGCAAGACTCTGTCTCAAAAAA
1841 AATAAAAAACTGACCATCTAGTCCTTGTCATCTGGGCACCCTCACACATCTCCTTAACCACACTTAATCTCCAAATAAGT
1921 ACGATAACATAGTCATAGTCCCACCCAACATGATGCAGTTATCTTGCATACAACTGAAGACAACTAACCCTTTCCCCAAC
2001 AGAGCCCACCAGCAGTGGTGGAGATGTCGGTCCATGAGCGCACACACAAGACTGAGGGACTGTCGGCCCTCCCAGGTGGT
2081 GTCAACACAACATCACACACAGGTGGGGGGGCCTGATAGCCCAGCACCCATGATACAGGGCCTACCAATGCTTAAAACCA
2161 CACCCAGGGAGCCCACAGAGGCACTCAGTGGGTGGTGGGGTGATGGATACACATCTATCAGGCACAGGGCGGAGGTGGGC
2241 ACCACTGAGTTGCACTCAGCAAACACATTGGGTATCTTGTGCCCAAGGCCTGTATTTGTGGAGCTGATGTTCTAGTGAGA
2321 GACAGTAAATGTGACAAAAGTAAAATATATCAGATGGTGAGAAAACAGAAAAATGAGATCAGAAGTGGAGATGTTGGGGC
2401 CAGGCACAGTGGCCCAGGCCTGTAATCCCATCACTTTGGGAGGTGCAGGCAGGCAGATGGCTTGAGCCCAGGAATTCAAG
2481 ACCAGTCCGAGCAACATAGCAAAAGCCCTTATCTGCAAAAAATTCAAAAATTAGCCAGGTGTGGTGGTGCGTGCCCAGGT
2561 TCCCAGGTACTCGGAGGCTGAGAGGTGGGAGGATGCCTTGAGCTTGAGAGGTTGAAGCTGCAGTGAGCTGTGATCGCACC
2641 ACTGCACTCCAGCTTGGTTCATGGAGACCCTGTTTTTTTAAAAAAAGAAGTGGAGGTGTTTACACCAGCAAAATACTCAT
2721 TTTTTAAGTGTAATTAAGTTGAAGATCAAAAAATGGAAATGTATAATTAAATCATACTTAGCAAATCTAACACATGAAAT
2801 GTAACATCTGCATATGGAGAATCGTGTTACTTTATTGAAAAACATTAAAAGTTTGAGAACTTAAGTTGGATTGTGGTTTC
2881 GTGAGCATTCATTATGGTTTATATATGTTCCATGTATTTATTATTAAATAGATGACAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||||:|||   :|||||| 
Target 5' atcACACTATT---GCACTCCa 3'
1787 - 1805 148.00 -19.80
2
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              || |||  ||:|||||| 
Target 5' ttccCA-CAT--TCGCACTCCa 3'
1114 - 1132 141.00 -18.00
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||||| |   :|||||| 
Target 5' atcGCACCACT---GCACTCCa 3'
2633 - 2651 140.00 -17.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30498208 20 COSMIC
COSN31495823 70 COSMIC
COSN20907487 105 COSMIC
COSN28663227 163 COSMIC
COSN32055581 384 COSMIC
COSN28797994 706 COSMIC
COSN24306904 761 COSMIC
COSN30161471 781 COSMIC
COSN22062184 867 COSMIC
COSN31524262 879 COSMIC
COSN1768044 961 COSMIC
COSN14626299 1095 COSMIC
COSN14851675 1164 COSMIC
COSN27779329 1251 COSMIC
COSN14538146 1769 COSMIC
COSN29902826 1953 COSMIC
COSN7126725 2349 COSMIC
COSN23468906 2726 COSMIC
rs3746082 173 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs369622548 2 dbSNP
rs748904581 5 dbSNP
rs374354967 9 dbSNP
rs1179160898 11 dbSNP
rs1024821214 12 dbSNP
rs747629777 13 dbSNP
rs554446343 15 dbSNP
rs777308461 19 dbSNP
rs1314382204 28 dbSNP
rs1415828851 28 dbSNP
rs746311399 33 dbSNP
rs1369796750 36 dbSNP
rs1400014373 37 dbSNP
rs534716854 49 dbSNP
rs1057745 52 dbSNP
rs954324568 54 dbSNP
rs1369470468 58 dbSNP
rs763153219 59 dbSNP
rs774467337 60 dbSNP
rs761908500 64 dbSNP
rs542173361 65 dbSNP
rs750361960 67 dbSNP
rs1252993412 71 dbSNP
rs756019190 72 dbSNP
rs1199076425 74 dbSNP
rs927359635 76 dbSNP
rs1450427452 77 dbSNP
rs766143200 79 dbSNP
rs1197471730 84 dbSNP
rs1246782194 85 dbSNP
rs947036068 86 dbSNP
rs1478760716 88 dbSNP
rs1478382484 90 dbSNP
rs753661254 93 dbSNP
rs1422526021 99 dbSNP
rs760345657 101 dbSNP
rs751154516 102 dbSNP
rs1226197501 105 dbSNP
rs519575 111 dbSNP
rs924318044 112 dbSNP
rs1444053147 116 dbSNP
rs868081923 117 dbSNP
rs1243470842 120 dbSNP
rs1405869054 129 dbSNP
rs539302734 133 dbSNP
rs1167412671 142 dbSNP
rs1456925852 147 dbSNP
rs1385319454 148 dbSNP
rs1057015590 150 dbSNP
rs112968195 156 dbSNP
rs948654371 162 dbSNP
rs745993783 163 dbSNP
rs1386540642 164 dbSNP
rs888462099 165 dbSNP
rs891295381 168 dbSNP
rs1206230816 172 dbSNP
rs3746082 173 dbSNP
rs1039460148 177 dbSNP
rs1225089016 179 dbSNP
rs1029809640 190 dbSNP
rs1342676327 192 dbSNP
rs575873545 197 dbSNP
rs189531828 198 dbSNP
rs1296891922 199 dbSNP
rs995157189 212 dbSNP
rs1318643860 213 dbSNP
rs1434518900 217 dbSNP
rs1389444912 225 dbSNP
rs1360280605 229 dbSNP
rs1026667929 244 dbSNP
rs1424913533 245 dbSNP
rs886745851 247 dbSNP
rs1004141420 254 dbSNP
rs1435307213 257 dbSNP
rs1246682546 261 dbSNP
rs1464085491 264 dbSNP
rs1263580189 265 dbSNP
rs191798085 266 dbSNP
rs1007133022 269 dbSNP
rs1310008041 277 dbSNP
rs1022471100 280 dbSNP
rs968417870 285 dbSNP
rs978811588 286 dbSNP
rs1295382486 290 dbSNP
rs547322192 291 dbSNP
rs771912122 292 dbSNP
rs970588937 305 dbSNP
rs1227557647 307 dbSNP
rs924286333 309 dbSNP
rs1187556299 315 dbSNP
rs1446114964 328 dbSNP
rs1243167154 334 dbSNP
rs535950557 342 dbSNP
rs1335314865 345 dbSNP
rs184069073 346 dbSNP
rs1388680185 348 dbSNP
rs1445962082 351 dbSNP
rs772938085 355 dbSNP
rs750988894 356 dbSNP
rs1187704616 359 dbSNP
rs1482082763 359 dbSNP
rs1236493293 363 dbSNP
rs558800186 363 dbSNP
rs75308932 365 dbSNP
rs1486563930 369 dbSNP
rs958762347 375 dbSNP
rs1272205436 376 dbSNP
rs1387609004 377 dbSNP
rs1342719557 386 dbSNP
rs990617039 390 dbSNP
rs536650645 391 dbSNP
rs1320175007 396 dbSNP
rs1285053947 401 dbSNP
rs1416836882 408 dbSNP
rs914592955 413 dbSNP
rs945997711 417 dbSNP
rs1383846625 420 dbSNP
rs1356736404 421 dbSNP
rs1171941106 427 dbSNP
rs1421598272 435 dbSNP
rs549371121 437 dbSNP
rs977739914 438 dbSNP
rs1044337744 447 dbSNP
rs1475946382 449 dbSNP
rs1249370921 450 dbSNP
rs909766088 452 dbSNP
rs912796814 455 dbSNP
rs1310747814 456 dbSNP
rs1339803431 458 dbSNP
rs77494704 460 dbSNP
rs1037469635 465 dbSNP
rs1273880325 465 dbSNP
rs941382754 465 dbSNP
rs1348794142 466 dbSNP
rs1288140669 475 dbSNP
rs188018885 476 dbSNP
rs1410778130 478 dbSNP
rs1326843013 482 dbSNP
rs897137377 493 dbSNP
rs1263352855 498 dbSNP
rs1348799371 513 dbSNP
rs1462421863 521 dbSNP
rs1198227839 523 dbSNP
rs998264536 524 dbSNP
rs1254875343 527 dbSNP
rs1180969402 533 dbSNP
rs1419501938 534 dbSNP
rs1039829663 539 dbSNP
rs756550100 543 dbSNP
rs1488076761 548 dbSNP
rs889962756 548 dbSNP
rs1253717958 574 dbSNP
rs550242156 575 dbSNP
rs1183186698 576 dbSNP
rs1414592929 582 dbSNP
rs780669620 587 dbSNP
rs1006976106 590 dbSNP
rs1022565269 591 dbSNP
rs899986814 606 dbSNP
rs1319177770 608 dbSNP
rs571699265 610 dbSNP
rs1048585111 614 dbSNP
rs760513225 615 dbSNP
rs886781023 617 dbSNP
rs1386719475 618 dbSNP
rs1372304741 620 dbSNP
rs1326039445 622 dbSNP
rs1158958220 623 dbSNP
rs1407100386 628 dbSNP
rs1442519152 634 dbSNP
rs539173864 636 dbSNP
rs1385784058 637 dbSNP
rs554079293 643 dbSNP
rs572367491 644 dbSNP
rs968677720 661 dbSNP
rs1046344851 662 dbSNP
rs1432544695 671 dbSNP
rs1031791679 675 dbSNP
rs1195389694 684 dbSNP
rs1463637448 695 dbSNP
rs1247487097 696 dbSNP
rs377375855 699 dbSNP
rs955723686 702 dbSNP
rs10423565 706 dbSNP
rs1002062494 707 dbSNP
rs1254652851 712 dbSNP
rs916962903 714 dbSNP
rs1348602067 720 dbSNP
rs1349011714 720 dbSNP
rs1306338497 721 dbSNP
rs554869009 722 dbSNP
rs575615520 725 dbSNP
rs543090383 733 dbSNP
rs1382446675 737 dbSNP
rs1283761255 738 dbSNP
rs564989586 743 dbSNP
rs73547945 744 dbSNP
rs1254851224 747 dbSNP
rs1175514667 753 dbSNP
rs1447512378 755 dbSNP
rs1389648020 760 dbSNP
rs1011671989 762 dbSNP
rs1430555196 770 dbSNP
rs1254385656 775 dbSNP
rs1022122308 777 dbSNP
rs967436961 782 dbSNP
rs1346951416 791 dbSNP
rs541186746 803 dbSNP
rs1486238747 807 dbSNP
rs1282901382 812 dbSNP
rs909704635 822 dbSNP
rs1341999479 834 dbSNP
rs180880164 847 dbSNP
rs912838242 849 dbSNP
rs972673916 850 dbSNP
rs1413773340 853 dbSNP
rs918617547 858 dbSNP
rs1314423963 869 dbSNP
rs372637353 871 dbSNP
rs1430439308 878 dbSNP
rs113670835 884 dbSNP
rs548490304 885 dbSNP
rs1476461525 889 dbSNP
rs1366787538 890 dbSNP
rs889846565 895 dbSNP
rs921440669 897 dbSNP
rs931442455 900 dbSNP
rs1377101204 901 dbSNP
rs1462536095 902 dbSNP
rs1048181624 912 dbSNP
rs1217557701 916 dbSNP
rs908282601 917 dbSNP
rs939733047 931 dbSNP
rs1340935294 959 dbSNP
rs542656865 973 dbSNP
rs1232315350 975 dbSNP
rs906177016 980 dbSNP
rs1355646662 982 dbSNP
rs1002137511 989 dbSNP
rs942885919 994 dbSNP
rs531731113 1000 dbSNP
rs1334928600 1009 dbSNP
rs1044306301 1013 dbSNP
rs1411590826 1014 dbSNP
rs1164225289 1015 dbSNP
rs893681082 1017 dbSNP
rs1011146102 1018 dbSNP
rs1303471069 1023 dbSNP
rs1021739158 1024 dbSNP
rs1157175137 1035 dbSNP
rs1472496017 1041 dbSNP
rs1347183571 1046 dbSNP
rs1384670812 1047 dbSNP
rs967846255 1056 dbSNP
rs1300125891 1057 dbSNP
rs1000218792 1070 dbSNP
rs549913578 1075 dbSNP
rs1019585121 1087 dbSNP
rs1274719646 1088 dbSNP
rs1226176288 1092 dbSNP
rs1349777499 1093 dbSNP
rs965315593 1096 dbSNP
rs186998325 1099 dbSNP
rs921514801 1100 dbSNP
rs572963382 1104 dbSNP
rs891469635 1106 dbSNP
rs540334828 1112 dbSNP
rs1157289589 1117 dbSNP
rs1269990681 1118 dbSNP
rs1489690003 1119 dbSNP
rs1409191917 1123 dbSNP
rs112063338 1126 dbSNP
rs1266916028 1128 dbSNP
rs1429405850 1129 dbSNP
rs908311301 1132 dbSNP
rs1395055187 1147 dbSNP
rs1194783516 1148 dbSNP
rs1170491710 1156 dbSNP
rs538770121 1157 dbSNP
rs1388413826 1159 dbSNP
rs141977326 1163 dbSNP
rs1446000146 1164 dbSNP
rs1164164687 1167 dbSNP
rs1284713196 1171 dbSNP
rs927624052 1173 dbSNP
rs1342569938 1177 dbSNP
rs1302641394 1180 dbSNP
rs1351582905 1190 dbSNP
rs10424634 1199 dbSNP
rs536481877 1200 dbSNP
rs1430308412 1201 dbSNP
rs554832049 1202 dbSNP
rs1320501622 1205 dbSNP
rs962567260 1207 dbSNP
rs1375211733 1208 dbSNP
rs746630463 1209 dbSNP
rs758888748 1210 dbSNP
rs946593189 1211 dbSNP
rs973069156 1212 dbSNP
rs576710426 1233 dbSNP
rs190831861 1245 dbSNP
rs1474894407 1266 dbSNP
rs902313845 1267 dbSNP
rs1228260938 1278 dbSNP
rs1293103556 1287 dbSNP
rs1217467282 1288 dbSNP
rs764661669 1290 dbSNP
rs1219818349 1291 dbSNP
rs1211513179 1300 dbSNP
rs1019617691 1310 dbSNP
rs1295538228 1314 dbSNP
rs1214103727 1320 dbSNP
rs1362726677 1321 dbSNP
rs751913057 1322 dbSNP
rs1446090751 1336 dbSNP
rs1355234431 1350 dbSNP
rs10425594 1353 dbSNP
rs1486283397 1354 dbSNP
rs1190778059 1357 dbSNP
rs996795828 1370 dbSNP
rs1170318898 1371 dbSNP
rs1028562221 1386 dbSNP
rs953058473 1389 dbSNP
rs1448904044 1402 dbSNP
rs1043808190 1406 dbSNP
rs558283825 1407 dbSNP
rs1256558051 1418 dbSNP
rs904024365 1419 dbSNP
rs181702122 1420 dbSNP
rs1249597632 1429 dbSNP
rs1345585144 1432 dbSNP
rs1053134213 1438 dbSNP
rs368769406 1449 dbSNP
rs1275129078 1456 dbSNP
rs961535849 1458 dbSNP
rs1226838784 1464 dbSNP
rs559526170 1465 dbSNP
rs1294318869 1466 dbSNP
rs1417051498 1467 dbSNP
rs1348989522 1468 dbSNP
rs981862207 1477 dbSNP
rs1452703272 1484 dbSNP
rs1354616191 1485 dbSNP
rs1171833992 1491 dbSNP
rs1459575813 1493 dbSNP
rs1013832337 1498 dbSNP
rs1285507055 1510 dbSNP
rs1381889339 1511 dbSNP
rs574677327 1512 dbSNP
rs577433283 1517 dbSNP
rs905525978 1524 dbSNP
rs115879239 1525 dbSNP
rs1234700603 1532 dbSNP
rs1317929299 1536 dbSNP
rs563530448 1537 dbSNP
rs1211010105 1538 dbSNP
rs1211848782 1538 dbSNP
rs1266444362 1541 dbSNP
rs1464659559 1552 dbSNP
rs1235351420 1553 dbSNP
rs187123534 1554 dbSNP
rs1306652506 1555 dbSNP
rs962867460 1557 dbSNP
rs114540541 1558 dbSNP
rs1376105680 1558 dbSNP
rs902346985 1559 dbSNP
rs944553477 1560 dbSNP
rs565155744 1564 dbSNP
rs190147103 1565 dbSNP
rs1361866766 1569 dbSNP
rs1158047400 1570 dbSNP
rs963977106 1575 dbSNP
rs780223498 1581 dbSNP
rs150693672 1591 dbSNP
rs367859686 1591 dbSNP
rs1028300302 1595 dbSNP
rs888427397 1598 dbSNP
rs1006226629 1599 dbSNP
rs1484982229 1601 dbSNP
rs1015811064 1602 dbSNP
rs961886352 1607 dbSNP
rs565875349 1608 dbSNP
rs1301960995 1609 dbSNP
rs1387440163 1611 dbSNP
rs530227560 1612 dbSNP
rs1303430775 1619 dbSNP
rs1442684244 1624 dbSNP
rs1335550685 1632 dbSNP
rs1034788486 1633 dbSNP
rs1446410834 1641 dbSNP
rs1454160839 1645 dbSNP
rs1302741729 1647 dbSNP
rs1171758488 1650 dbSNP
rs1453651656 1653 dbSNP
rs1395781477 1656 dbSNP
rs959127208 1663 dbSNP
rs990539443 1664 dbSNP
rs1230605048 1667 dbSNP
rs182564445 1670 dbSNP
rs1487093932 1674 dbSNP
rs570295460 1676 dbSNP
rs1210817901 1680 dbSNP
rs918070276 1686 dbSNP
rs949656351 1688 dbSNP
rs35070003 1692 dbSNP
rs1280770861 1693 dbSNP
rs142132160 1694 dbSNP
rs570338786 1697 dbSNP
rs375000109 1699 dbSNP
rs944570940 1704 dbSNP
rs1209558388 1706 dbSNP
rs1001170581 1710 dbSNP
rs1040165643 1714 dbSNP
rs1434053273 1718 dbSNP
rs773167390 1728 dbSNP
rs921746180 1729 dbSNP
rs1460581145 1730 dbSNP
rs932753516 1734 dbSNP
rs1484029360 1742 dbSNP
rs1179744520 1744 dbSNP
rs1410971332 1746 dbSNP
rs1049803178 1750 dbSNP
rs534648284 1751 dbSNP
rs1173999376 1759 dbSNP
rs888450670 1762 dbSNP
rs1005550727 1774 dbSNP
rs1187626029 1775 dbSNP
rs1037715839 1787 dbSNP
rs1422669094 1792 dbSNP
rs994310674 1794 dbSNP
rs897385127 1796 dbSNP
rs1283151708 1797 dbSNP
rs553103627 1802 dbSNP
rs1336963122 1807 dbSNP
rs1170600341 1813 dbSNP
rs1035198194 1814 dbSNP
rs574591730 1815 dbSNP
rs1025457830 1826 dbSNP
rs1355839855 1831 dbSNP
rs1012005101 1832 dbSNP
rs1395877947 1835 dbSNP
rs1168517339 1842 dbSNP
rs1008104947 1844 dbSNP
rs1018105730 1844 dbSNP
rs542007613 1844 dbSNP
rs964407986 1855 dbSNP
rs979428133 1857 dbSNP
rs1437411942 1877 dbSNP
rs1276801920 1878 dbSNP
rs925262686 1879 dbSNP
rs1437701266 1888 dbSNP
rs968152218 1894 dbSNP
rs956834823 1902 dbSNP
rs1458692319 1905 dbSNP
rs374787634 1908 dbSNP
rs185752989 1910 dbSNP
rs146374303 1920 dbSNP
rs1275529207 1923 dbSNP
rs189683263 1924 dbSNP
rs139593249 1929 dbSNP
rs1329416017 1935 dbSNP
rs1250746506 1938 dbSNP
rs1451936739 1952 dbSNP
rs1325565899 1957 dbSNP
rs921778305 1959 dbSNP
rs1462104948 1964 dbSNP
rs532392224 1967 dbSNP
rs548922381 1972 dbSNP
rs182859715 1984 dbSNP
rs1364921281 1997 dbSNP
rs937018684 2000 dbSNP
rs909962546 2011 dbSNP
rs1250524183 2013 dbSNP
rs879864541 2014 dbSNP
rs1468602760 2022 dbSNP
rs1291801031 2023 dbSNP
rs898138636 2029 dbSNP
rs1349649542 2030 dbSNP
rs993963720 2031 dbSNP
rs1046763202 2035 dbSNP
rs890958988 2036 dbSNP
rs941380446 2037 dbSNP
rs1037051421 2040 dbSNP
rs1018159484 2041 dbSNP
rs559374196 2043 dbSNP
rs1001171467 2044 dbSNP
rs1032382705 2048 dbSNP
rs956913818 2050 dbSNP
rs897128685 2053 dbSNP
rs530143528 2055 dbSNP
rs560723880 2065 dbSNP
rs1056691471 2066 dbSNP
rs1478050055 2083 dbSNP
rs1248141224 2091 dbSNP
rs895355143 2093 dbSNP
rs1446282866 2096 dbSNP
rs1025024573 2104 dbSNP
rs1326015829 2105 dbSNP
rs970904570 2105 dbSNP
rs1012408521 2106 dbSNP
rs1369792160 2108 dbSNP
rs1022493061 2111 dbSNP
rs1436035469 2116 dbSNP
rs562858628 2121 dbSNP
rs548346133 2128 dbSNP
rs1298358071 2130 dbSNP
rs1327403068 2131 dbSNP
rs1427943704 2140 dbSNP
rs570129280 2142 dbSNP
rs745856287 2149 dbSNP
rs1367477259 2166 dbSNP
rs1375412098 2167 dbSNP
rs1226326222 2174 dbSNP
rs576932334 2187 dbSNP
rs1414597273 2193 dbSNP
rs1426654695 2196 dbSNP
rs531170552 2203 dbSNP
rs117687643 2207 dbSNP
rs1263662596 2218 dbSNP
rs1195528132 2223 dbSNP
rs999659563 2225 dbSNP
rs1256783506 2231 dbSNP
rs1046814678 2232 dbSNP
rs1314027361 2235 dbSNP
rs1270899037 2236 dbSNP
rs890845400 2239 dbSNP
rs1030680557 2243 dbSNP
rs1188831555 2244 dbSNP
rs943776539 2245 dbSNP
rs1447102946 2250 dbSNP
rs1355205841 2254 dbSNP
rs965650446 2258 dbSNP
rs1039535994 2261 dbSNP
rs975975618 2268 dbSNP
rs571171438 2269 dbSNP
rs534554391 2272 dbSNP
rs921851707 2280 dbSNP
rs1457484363 2287 dbSNP
rs1167645452 2292 dbSNP
rs953250100 2293 dbSNP
rs1000824330 2295 dbSNP
rs1389044121 2304 dbSNP
rs1404945076 2307 dbSNP
rs1172348020 2316 dbSNP
rs1416891244 2322 dbSNP
rs1160901784 2323 dbSNP
rs879272048 2326 dbSNP
rs909013913 2332 dbSNP
rs941466815 2335 dbSNP
rs1458249473 2341 dbSNP
rs1260298163 2347 dbSNP
rs1231677266 2348 dbSNP
rs1432968755 2354 dbSNP
rs1334611158 2363 dbSNP
rs1294232276 2365 dbSNP
rs973193326 2367 dbSNP
rs1025078490 2376 dbSNP
rs188758948 2388 dbSNP
rs759134817 2389 dbSNP
rs193293164 2395 dbSNP
rs1333032163 2397 dbSNP
rs535564040 2398 dbSNP
rs1393485022 2406 dbSNP
rs1282165448 2420 dbSNP
rs1355421380 2431 dbSNP
rs1405759854 2433 dbSNP
rs557045200 2435 dbSNP
rs1056767458 2449 dbSNP
rs980835587 2453 dbSNP
rs201125461 2455 dbSNP
rs775357203 2455 dbSNP
rs144312899 2462 dbSNP
rs546018292 2470 dbSNP
rs1043918714 2473 dbSNP
rs903991559 2489 dbSNP
rs774934513 2490 dbSNP
rs112947797 2498 dbSNP
rs901558660 2526 dbSNP
rs973682205 2537 dbSNP
rs997133309 2543 dbSNP
rs1028897739 2545 dbSNP
rs557764387 2548 dbSNP
rs912210625 2551 dbSNP
rs953311671 2552 dbSNP
rs943829377 2568 dbSNP
rs1459299656 2571 dbSNP
rs985082366 2573 dbSNP
rs1158291413 2574 dbSNP
rs764559676 2575 dbSNP
rs936462574 2577 dbSNP
rs1414455533 2581 dbSNP
rs1053729446 2582 dbSNP
rs962146250 2582 dbSNP
rs1268384853 2585 dbSNP
rs972880322 2590 dbSNP
rs1455844109 2596 dbSNP
rs1193125012 2604 dbSNP
rs918667056 2607 dbSNP
rs376148851 2620 dbSNP
rs1356418863 2623 dbSNP
rs1278773682 2628 dbSNP
rs1231501398 2631 dbSNP
rs752056686 2636 dbSNP
rs541042108 2637 dbSNP
rs757595542 2638 dbSNP
rs1044334705 2644 dbSNP
rs1288024838 2647 dbSNP
rs904024719 2653 dbSNP
rs1400573950 2661 dbSNP
rs767928688 2662 dbSNP
rs1332080976 2666 dbSNP
rs1339858274 2668 dbSNP
rs1052171786 2669 dbSNP
rs1290053933 2670 dbSNP
rs1378275475 2672 dbSNP
rs1002325639 2673 dbSNP
rs1194897619 2680 dbSNP
rs1261510580 2680 dbSNP
rs1426903124 2680 dbSNP
rs901589949 2680 dbSNP
rs750685835 2681 dbSNP
rs534809630 2685 dbSNP
rs1210789897 2687 dbSNP
rs1343677412 2688 dbSNP
rs995383489 2691 dbSNP
rs1234983764 2697 dbSNP
rs1305363030 2699 dbSNP
rs1277150460 2706 dbSNP
rs1227418910 2711 dbSNP
rs1256026157 2714 dbSNP
rs1483927493 2720 dbSNP
rs1342131541 2722 dbSNP
rs1311064034 2726 dbSNP
rs373366483 2730 dbSNP
rs1403020431 2731 dbSNP
rs1304612090 2732 dbSNP
rs1460501004 2737 dbSNP
rs1254665673 2740 dbSNP
rs950991133 2741 dbSNP
rs1171634417 2748 dbSNP
rs1183259558 2748 dbSNP
rs1416054284 2755 dbSNP
rs1254432979 2764 dbSNP
rs1471704417 2765 dbSNP
rs1158695912 2770 dbSNP
rs1443445575 2786 dbSNP
rs780420007 2788 dbSNP
rs1479361809 2790 dbSNP
rs73547948 2790 dbSNP
rs1257100358 2805 dbSNP
rs1218857141 2815 dbSNP
rs10414216 2823 dbSNP
rs146048872 2825 dbSNP
rs975192579 2826 dbSNP
rs1341033723 2827 dbSNP
rs1309563855 2831 dbSNP
rs755059730 2834 dbSNP
rs1389805972 2836 dbSNP
rs28750116 2837 dbSNP
rs1348428229 2846 dbSNP
rs1332299552 2851 dbSNP
rs1467321872 2858 dbSNP
rs1392762945 2859 dbSNP
rs571398573 2861 dbSNP
rs1473314490 2862 dbSNP
rs1301509070 2869 dbSNP
rs1313643279 2871 dbSNP
rs1180275598 2879 dbSNP
rs10412877 2881 dbSNP
rs34947393 2882 dbSNP
rs531010294 2884 dbSNP
rs867977522 2902 dbSNP
rs781026562 2906 dbSNP
rs1209070538 2907 dbSNP
rs1347720988 2910 dbSNP
rs1356768812 2915 dbSNP
rs913719710 2917 dbSNP
rs1236706677 2929 dbSNP
rs1376265995 2936 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       ::|||||| 
Target 5' ------------cUGCACUCCa 3'
1 - 10
2
miRNA  3' guUUGUGGUAACAGUGUGAggu 5'
            ||||  |  |  || ||   
Target 5' gcAACA-GAGCGAGACCCUguc 3'
17 - 37
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000315588.5 | 3UTR | CUGCACUCCAGCCUGGGCAACAGAGCGAGACCCUGUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*