miRTarBase - #MIRT713423 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC35E2B   
Synonyms SLC35E2
Description solute carrier family 35 member E2B
Transcript NM_001110781   
Expression
Putative miRNA Targets on SLC35E2B
3'UTR of SLC35E2B
(miRNA target sites are highlighted)
>SLC35E2B|NM_001110781|3'UTR
   1 GAGCAGGAAGCTGCCAGCTGCTGCTGTCCTCGTGACACTGCATCCCCCAGAAATGGGCAGGGACGCCCTCCTCCATGGCC
  81 CTGCTGGGGTGCAGGACATGGGGAGCTAAGTTGGCCATTGCCTGCGGCTTTCTCGGTTTGTCGGTGAAGACCAGCAGAAA
 161 CTCAAACTGGGGATTCCAGGTATCAGCTTCCTGGAGTAGAGACCAGACCAGTAGCTGACTGTGTCCGCCGAGCCCATCCC
 241 CGTGTAATGTGAAAACAGCCTCTGAGGCTCCCATGCTGGGGGTGCCCACTTCCTCTCTGGGCGACACCCCAGGGTCCACC
 321 GGGAGCCAGAGGTGGGTCCAGTGCCAACGAGAGCCGCTCCCTGCCACAGCCAAGAGAGCCCTCGGCTTCCCACACCAGCC
 401 ATCGAAGGCCCTGAGGCCCTGGACCGGCGGCAGACTGGCCCTGGGCATGAGGCCACAGAGCAGGGCCGAAGGGAGGGGAC
 481 AGAGGGCCCTGGAAGGAAGGGTCTCCTGCTGCCACGGTGGGCACTCAGAACTTCTCCCCACCTGACCCAGGGCTGTGGGC
 561 ATCCTCAGACTATCCCAGAGGCATCGCAAGCCTCAAGCTGCAGCATTGCACGGCACTCAAGGGCTATGACCACGGAGGCC
 641 GTTCAGTCGCTTCTGTTTAGAGGAAGGCCCCCTACCTCTTCCACACCCTGCCCTCCTATCCCTTCCACACCCTGGGCTGC
 721 GTGAGCTCCCCGCAACCCCAGGGCACCCTGCCCTCCTACCTGTGGGGGTTTCCAGCCCTGAGGTTGAGGACAAACCTCTC
 801 GTGTTTAACTTGGGAGGAGATGTGTACGTTCCTTTTCTTTTTTGGACTCTGAGTATGAGGCAGGCTGTTCTGAGGTCCCC
 881 GTGGGGTGAGCCTGTCTGTCCTCCCTCAGAGCCCACTGTTCCTATCATCATCTAGCACCTGTCCGGTTCCCCACGTGAGC
 961 CTTGGGCAGGACGCTGCAGTGTTGATGGTTTGGGTTACGTGGCGTTTACCTGGGCGCCGTCCTTACTGAAAAAGGAAACG
1041 TCCACACTGAATGTTTCTGGGGCGCGTGGTGTGTGTCAGGCGCCCACCCTGTCCCACTCTCCCCAAGGGACAGTAGTACG
1121 GCACACTGGGGCCACCAGCCAGCTCAACTCATCCTCCTGTGTCACGCACCCCCGAGGGCGCAGGAGGCCTGAGGAGTGGC
1201 TACTGGAGCCGTGTGTTAGGCAGAGGCTTCTGACCATGTCTGAGCTCTTTACCCCCAATCTCGCAGCTGGCGGATTCCCA
1281 TGCCCGGTGCAGCCTGTTGCCAGCCAGCCTTTGAGACCCAGAGCTCCAGGGCTTGTCAGAGGCAGCATGGGGCTCCAGTG
1361 GTCCCGAGTCTCATTTCCCTGCCTGCTCTTTAGGCCTTTGGCACCCATGGTCACTTCACTGGCTTTCCATTTGGCTTCTC
1441 ACCTGGGAAATACAAAAATAGCCCCTCCTGAAGATAAAATCATTCAGAAACAGAGCAATAATTCTGACTCATTAACTTCT
1521 ACCTACTCAAAAAAGTCTGCCATGATGATGGACCGAAGTGAGGCTTTTTAACCCACAAGTAACCTTTTTATTTTTTTGAG
1601 ACAGTCTTGCTCTGTCTGTCACCCAGGCTGGAGTACAGTGGCATGATCTTGGCTCACTGCAGCCTCGACTTCCTGGGCTC
1681 AAATGATCCTCCCACCTCAGCCTCCCATGTGGCTGGAACCACAGGCACGTGCCACCATGCCTGGCTATTTTTTTGTTGAG
1761 CTGGGCTCTCGCTTTGTTGCCCAGGCTGGTCTTGAACTCCTCGGCTCAAGCAATCCTTCCCACTCAGCCTCCTGTAGTGT
1841 CGAGAATATAGGCGTGGGCTACTACACCTGCTTCAGCCGCTTCTATAAAACCGCTGACCTGTGTGTGGAGGACAGGCCAG
1921 GTGTGTGCTCACTGCGCTGCGAAGATGTTTTGTCACGTGACTTTCCCCGGATTTCCATTTCTTTTTTTCTGCTTTCCTCA
2001 AAAACTAATAGAAGACTGGGTGCGGTGGCTCACGCCTCTAATCGCAGCACTTTGGGAGGCAGCAGCTGGCGGATCACAAG
2081 GCCAGGAGTTCGAGACCAGCCTGGCCAACATGATGAAACCCTGTCTCTACCAAAAATACAAAAATTAGCTGGGTGCGATG
2161 GTGGGTGCCTGTAATCCCAGATACTCAGGAGGCTGAGGCAGGAGAATTGTTTGAACCCCGGAGATGGAGGTTGCAGTGAG
2241 CCAAGATCGTGCCATTGCACTCCAGCCTGGGCAACAGGGCAAGATTCCGTCTCAAAAACAAACACTATTAGAAAATGCCC
2321 TGGAGGTGGCGGGGAGTTGTTGATTTGTGAGGACAGATTGAAAGCAACTCCCAGGGTGGCCTTGTCCACCTCCCCGTCGA
2401 GAATGTGGCTGCCGGCCTCTTTGAAGATTGTGGTCTGGCATAAGGAGAGGTGCAGGCGCCTGGTTCTGAGCACCTTGGAA
2481 TTTCCAGCCGCACAGCATCTGGTGCCCTCCCCTCCACCCTCACAAGGAGCTGCCATCCTGTTTGGATTTTCTGTTTGTGG
2561 ACCAGAAACAAACGTTTTTCCAAAGGATTAGCAAATAGGGTAATTTCCTGTGTAACGCTGCTCTGGGGCCTCTTCCTCAT
2641 CCTGGCAGAAGGAGCCTGGAGCCCATGAGGCAGCCAGCACTGTGCCCTTGCTCAGTCGTGCTGTCCCCTCCCTCTCCCTC
2721 AGTCTCCTCTCCATGCCCAAGTCAGTTTCCAGCCGCTGGTCTTCATGGCATTCCCAGCACAGCCGGGCACCAAGAGGCAA
2801 AACCCAAGGCCTGGCTTGGCCGTGTTAACGATTGTACAGACATTTTTTAAAATAACTTTGTGTAATACTTTTCTGGAATA
2881 GTAAGTTCTTGTTGAACTGTCACAGGTGAGCTTCTAGGAACACACCAGGTGTGGTTACTTCCACTGGGTGTGTCCATGGT
2961 CGTGGTCTGTGCTTTTGTAAACGAACAGAACACTTGAACCACCTCCCGAATTGGGTCATCGGCTTCTTTACGTTGATACT
3041 TAAGAGATTTGCAGCTCTCTTTCAAGGAAACTTCCCCTACTGAAAGGCATAAAAAGGTTAAAAAAGAAAATCCGAGAGTC
3121 CCAATTCCCTGTATAACAGCATTAAAATAATCTGCCTGCCTGGAAAGATGAGAACACTGTTGCACAACCCAAAATGTGTC
3201 TTTAATTTGTGAAAAATTACCATGGTGAGTCAGACAGTCATTTTAAACAGCTGAACAGAGACTATCATCAGCAAATAGAG
3281 CTCAGCTTTGTAGCTGCCTTTAAAATCCTTGTCCCAAATCCGGTGAGCTCTGCTTGCTGCCGCCGCGCTCCTGGGTGATC
3361 ACTCAGACGGGTCAGTGGGAATAACAGGCCAACAAGACAGCTTTTTACATGTGTCCAAAGGATGGCCTTTCGAAGGCCTG
3441 GAAGTATTTCACTGTTGGAAGAAGTAAACAAGAATGACATTCCAGATGGAAATAGAATTCTCTCTCTTGCCTTTGACCAA
3521 CATGGTACTAAGGGGTTTCTTCTTTCCCAATGTATGTACGTGCCCTGCTGGGGGCCTTACTTTATAGAATGAGAGCATCC
3601 GAGCTTCCCTAATGAATCTGGCTAGTTCTGTGTCTGGCTGAGGATACAGGAGTGGGACATCCACTCTCGGATCCCTCAGA
3681 GCACAGAAACCTTCAGCTTTGCTGTCTCTGAAGTATTTCCTCCAGTTTCCCTGCGGGCCCCTATGTTTGAGTTTGATGGC
3761 TGCTGGATCCTCACTCAACGAAAACTCGGTTGGAAACTGTTCCGCCTGGCAGTCCTTTTTTGTTGTTTTCCATCTCATTT
3841 CCCTTCCATCTGAAAGTGGCATTCAGCTGACTTGCTCATTTAGACTGTTCACGGAGTCTGAATCTGCCAACGTGGTGTTG
3921 GAGGCTCCACCTTGAAAAGGGCCACAGTCAGGGCAACTTTCCCCATACAGGAAAACTTGAAAATTACATCAACAGTCTAC
4001 GTCACAGCCAAATTATATTTCCTTTATACCAAACAAAACTATGGAGAACTAAAAGTACATCACACAAAACGTTTATAGTG
4081 TTTTGCATGTGACCTATTTCAGTATTTATATAACTAGATTAGTGCTTTCTAGCAAACGGTTCTGTTAATTAGCGAGTCAC
4161 TGTTGATTCTGCTGTGGTGGTAAGTTGATACCGTGTAACTAATCCCGTGGATGCCTCCTCGTTATTTTTGTCCAAACGAA
4241 GCAGCCGTGGTAGTAGCTGTCTATGATTCTTGCTCAGCAAAGTAAAATAAATGTTAAATATGGAAAAAAAAAAAAAAAAA
4321 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||:|::  |  ||||||| 
Target 5' aggAAGCTGCCAGCTGCTGCTg 3'
5 - 26 151.00 -13.00
2
miRNA  3' guGUUUGG--UA----AUAC--ACGACGau 5'
            ||||:|  :|    | ||  ||||||  
Target 5' ccCAAATCCGGTGAGCTCTGCTTGCTGCcg 3'
3313 - 3342 130.00 -11.20
3
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ::|||||:  ||| ||| 
Target 5' agttGGCCATTGCCTGCGGCTt 3'
109 - 130 130.00 -12.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30657161 28 COSMIC
COSN8645443 169 COSMIC
COSN8645442 170 COSMIC
COSN6507792 201 COSMIC
COSN22619490 384 COSMIC
COSN20073743 422 COSMIC
COSN27726545 1063 COSMIC
COSN24099435 1423 COSMIC
COSN24550774 1482 COSMIC
COSN17970044 1683 COSMIC
COSN5198162 1853 COSMIC
COSN17076254 2040 COSMIC
COSN32063646 2319 COSMIC
COSN24144072 2600 COSMIC
COSN23950526 2602 COSMIC
COSN17075930 2613 COSMIC
COSN24143292 2643 COSMIC
COSN17506119 2849 COSMIC
COSN20094155 3041 COSMIC
COSN24484050 3123 COSMIC
COSN21467094 3164 COSMIC
COSN6507775 3735 COSMIC
COSN15757342 4300 COSMIC
rs72634819 721 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1455948845 1 dbSNP
rs951794846 5 dbSNP
rs919556962 6 dbSNP
rs1055490205 10 dbSNP
rs937000631 11 dbSNP
rs547496333 18 dbSNP
rs925759375 20 dbSNP
rs118019725 22 dbSNP
rs1350283909 24 dbSNP
rs1241596653 28 dbSNP
rs535898665 29 dbSNP
rs971543841 31 dbSNP
rs769010476 32 dbSNP
rs1394738566 41 dbSNP
rs914047291 46 dbSNP
rs1467021041 48 dbSNP
rs1012970727 50 dbSNP
rs1235150949 52 dbSNP
rs1310331337 55 dbSNP
rs1171929565 57 dbSNP
rs1441612688 59 dbSNP
rs1300539212 62 dbSNP
rs958807056 63 dbSNP
rs549600907 64 dbSNP
rs371326653 65 dbSNP
rs1318121398 68 dbSNP
rs1433982628 69 dbSNP
rs1258038241 70 dbSNP
rs1200759396 72 dbSNP
rs1000238116 75 dbSNP
rs534528839 76 dbSNP
rs1241758256 77 dbSNP
rs1337755241 78 dbSNP
rs912110154 81 dbSNP
rs1467920439 83 dbSNP
rs529520031 86 dbSNP
rs1236464312 87 dbSNP
rs953471410 88 dbSNP
rs1393472347 93 dbSNP
rs1315279411 95 dbSNP
rs145415853 104 dbSNP
rs1415780150 107 dbSNP
rs1162469826 109 dbSNP
rs1027743732 117 dbSNP
rs1009453692 120 dbSNP
rs1311573521 121 dbSNP
rs1421640956 122 dbSNP
rs1361284513 124 dbSNP
rs188348131 125 dbSNP
rs147285260 126 dbSNP
rs1040208932 127 dbSNP
rs533338391 132 dbSNP
rs1014795432 134 dbSNP
rs564174168 135 dbSNP
rs74047818 142 dbSNP
rs1056109475 143 dbSNP
rs372215533 146 dbSNP
rs1469261288 147 dbSNP
rs756791000 151 dbSNP
rs1001216536 152 dbSNP
rs1488551079 153 dbSNP
rs572255432 159 dbSNP
rs1049283449 167 dbSNP
rs930328250 169 dbSNP
rs1265653260 170 dbSNP
rs1234341499 172 dbSNP
rs1237869863 181 dbSNP
rs555098187 188 dbSNP
rs1042830260 193 dbSNP
rs945769254 196 dbSNP
rs140118478 198 dbSNP
rs72634820 201 dbSNP
rs556398891 208 dbSNP
rs944871843 219 dbSNP
rs368924316 220 dbSNP
rs1458664625 221 dbSNP
rs1399017380 222 dbSNP
rs917479462 226 dbSNP
rs34272997 227 dbSNP
rs1453244557 229 dbSNP
rs147514173 230 dbSNP
rs1195512543 233 dbSNP
rs1478112794 234 dbSNP
rs920564919 240 dbSNP
rs1033138718 241 dbSNP
rs553850300 242 dbSNP
rs962145805 246 dbSNP
rs4074020 247 dbSNP
rs200640613 255 dbSNP
rs370445102 259 dbSNP
rs1332157293 261 dbSNP
rs1271678398 270 dbSNP
rs1262784469 272 dbSNP
rs1220776248 279 dbSNP
rs960109080 280 dbSNP
rs1034272437 282 dbSNP
rs1270112958 289 dbSNP
rs1001833018 293 dbSNP
rs904201226 299 dbSNP
rs1326609394 302 dbSNP
rs749882386 303 dbSNP
rs183639607 305 dbSNP
rs1257277455 307 dbSNP
rs1042730860 308 dbSNP
rs1048809718 310 dbSNP
rs1234436685 311 dbSNP
rs1346494570 316 dbSNP
rs930358795 320 dbSNP
rs767163610 321 dbSNP
rs1326812476 323 dbSNP
rs568170096 325 dbSNP
rs1466863871 326 dbSNP
rs891583013 329 dbSNP
rs1036008963 331 dbSNP
rs549275729 334 dbSNP
rs949710628 335 dbSNP
rs536070476 341 dbSNP
rs1347691731 347 dbSNP
rs191125202 348 dbSNP
rs991700471 349 dbSNP
rs1369130212 351 dbSNP
rs890598035 354 dbSNP
rs1394549696 355 dbSNP
rs937530503 356 dbSNP
rs1050715242 367 dbSNP
rs1442714716 372 dbSNP
rs1353744438 374 dbSNP
rs926079665 379 dbSNP
rs932256095 383 dbSNP
rs978882370 384 dbSNP
rs920839262 387 dbSNP
rs1452017300 388 dbSNP
rs973440904 396 dbSNP
rs550435108 399 dbSNP
rs1445607675 403 dbSNP
rs536344416 404 dbSNP
rs564139450 406 dbSNP
rs1211145685 407 dbSNP
rs907966443 409 dbSNP
rs1232683648 411 dbSNP
rs1202792603 420 dbSNP
rs547393342 425 dbSNP
rs1210323841 426 dbSNP
rs959916954 429 dbSNP
rs1311508225 431 dbSNP
rs1224568646 433 dbSNP
rs1034567328 434 dbSNP
rs1277560465 437 dbSNP
rs979945636 440 dbSNP
rs868837090 442 dbSNP
rs1339944198 443 dbSNP
rs1269414207 447 dbSNP
rs969062800 451 dbSNP
rs1021492122 457 dbSNP
rs1007448469 458 dbSNP
rs527741044 465 dbSNP
rs1225026676 466 dbSNP
rs888964945 467 dbSNP
rs1342026492 468 dbSNP
rs1175913393 471 dbSNP
rs1315084346 476 dbSNP
rs1476379902 477 dbSNP
rs1009890395 484 dbSNP
rs1258878677 485 dbSNP
rs1027875833 486 dbSNP
rs891425583 495 dbSNP
rs1216505837 498 dbSNP
rs1374937615 500 dbSNP
rs1282411278 501 dbSNP
rs1229868882 505 dbSNP
rs1311089528 509 dbSNP
rs1412161519 510 dbSNP
rs1019343738 515 dbSNP
rs1008365104 516 dbSNP
rs889532158 525 dbSNP
rs1051056998 526 dbSNP
rs569051438 532 dbSNP
rs545859954 552 dbSNP
rs1166437840 556 dbSNP
rs561864714 560 dbSNP
rs949762282 566 dbSNP
rs1419064657 567 dbSNP
rs1474665501 572 dbSNP
rs1164593109 574 dbSNP
rs1474515532 576 dbSNP
rs1264474138 578 dbSNP
rs767977637 580 dbSNP
rs541983630 583 dbSNP
rs899446581 585 dbSNP
rs1037924602 586 dbSNP
rs1474644607 587 dbSNP
rs1272327611 592 dbSNP
rs1231151169 594 dbSNP
rs940675073 602 dbSNP
rs907852334 608 dbSNP
rs576167810 611 dbSNP
rs1381202796 612 dbSNP
rs1359297508 617 dbSNP
rs946224064 622 dbSNP
rs979363423 622 dbSNP
rs1441197512 623 dbSNP
rs1393199118 625 dbSNP
rs938793253 627 dbSNP
rs1164747468 630 dbSNP
rs114043810 633 dbSNP
rs976793749 638 dbSNP
rs189120070 640 dbSNP
rs968570632 641 dbSNP
rs577211861 644 dbSNP
rs988666909 648 dbSNP
rs955721474 650 dbSNP
rs953439688 660 dbSNP
rs1027558881 673 dbSNP
rs1481478826 673 dbSNP
rs1293617090 676 dbSNP
rs995114015 682 dbSNP
rs1019270413 684 dbSNP
rs974658179 686 dbSNP
rs553760596 688 dbSNP
rs1007876922 691 dbSNP
rs953970349 692 dbSNP
rs1369868702 693 dbSNP
rs1028065126 694 dbSNP
rs996757504 699 dbSNP
rs1234154958 700 dbSNP
rs149396264 701 dbSNP
rs574558480 702 dbSNP
rs1461929032 704 dbSNP
rs1227263543 705 dbSNP
rs1353199437 710 dbSNP
rs1011399334 715 dbSNP
rs1005107414 718 dbSNP
rs1444518518 719 dbSNP
rs550737260 720 dbSNP
rs72634819 721 dbSNP
rs1408647141 723 dbSNP
rs1397164194 729 dbSNP
rs114530211 732 dbSNP
rs1421058444 734 dbSNP
rs927401426 736 dbSNP
rs1044450542 737 dbSNP
rs1479657975 738 dbSNP
rs1460628833 740 dbSNP
rs1211045231 744 dbSNP
rs1043310738 745 dbSNP
rs947228920 746 dbSNP
rs946208814 755 dbSNP
rs913368289 757 dbSNP
rs1335917164 758 dbSNP
rs185448343 762 dbSNP
rs1391173676 768 dbSNP
rs1231747296 769 dbSNP
rs1315323886 772 dbSNP
rs1435457778 774 dbSNP
rs539699867 778 dbSNP
rs1374952728 784 dbSNP
rs944078592 788 dbSNP
rs1179587930 796 dbSNP
rs1469724619 800 dbSNP
rs1273615629 801 dbSNP
rs1212880603 808 dbSNP
rs1180899737 811 dbSNP
rs911289259 820 dbSNP
rs1259583730 821 dbSNP
rs985891800 826 dbSNP
rs952734356 827 dbSNP
rs1351029617 828 dbSNP
rs1016058645 831 dbSNP
rs920548692 832 dbSNP
rs1288062387 834 dbSNP
rs570821648 836 dbSNP
rs1348980905 842 dbSNP
rs766672115 851 dbSNP
rs1415953140 854 dbSNP
rs973307567 864 dbSNP
rs1374155660 869 dbSNP
rs1383987861 870 dbSNP
rs1278978272 880 dbSNP
rs1158182513 881 dbSNP
rs961862704 883 dbSNP
rs1440680089 888 dbSNP
rs1419785127 892 dbSNP
rs746478401 896 dbSNP
rs1014683796 899 dbSNP
rs1165301042 903 dbSNP
rs1474840818 903 dbSNP
rs1255307995 907 dbSNP
rs1194772302 909 dbSNP
rs1447056709 912 dbSNP
rs1109645 917 dbSNP
rs1327132099 918 dbSNP
rs1234279547 921 dbSNP
rs1334829840 923 dbSNP
rs772944788 927 dbSNP
rs527656278 938 dbSNP
rs1440699019 943 dbSNP
rs1392726793 944 dbSNP
rs1326403907 949 dbSNP
rs1013978052 950 dbSNP
rs1411596010 951 dbSNP
rs546546470 954 dbSNP
rs1400867246 955 dbSNP
rs1372016589 957 dbSNP
rs1190315352 964 dbSNP
rs1406634631 968 dbSNP
rs959805850 969 dbSNP
rs1331502742 972 dbSNP
rs1214765621 973 dbSNP
rs1468298033 984 dbSNP
rs561972607 994 dbSNP
rs1034090743 997 dbSNP
rs548651899 998 dbSNP
rs1455170584 999 dbSNP
rs1269675315 1000 dbSNP
rs1001643230 1001 dbSNP
rs1373534875 1003 dbSNP
rs1304412148 1004 dbSNP
rs1439946462 1009 dbSNP
rs1347932837 1015 dbSNP
rs1253598355 1016 dbSNP
rs1410470185 1018 dbSNP
rs528398493 1019 dbSNP
rs1109644 1025 dbSNP
rs904148926 1037 dbSNP
rs546029999 1039 dbSNP
rs1043709135 1040 dbSNP
rs1010459040 1046 dbSNP
rs1245360153 1047 dbSNP
rs1206978129 1053 dbSNP
rs1218231060 1054 dbSNP
rs1272901615 1062 dbSNP
rs1203169159 1064 dbSNP
rs1350105614 1073 dbSNP
rs1317694975 1082 dbSNP
rs1283695051 1083 dbSNP
rs1365677005 1088 dbSNP
rs1281139750 1092 dbSNP
rs1442646390 1097 dbSNP
rs577174820 1099 dbSNP
rs1335151382 1101 dbSNP
rs891985507 1103 dbSNP
rs1041255319 1119 dbSNP
rs944172561 1120 dbSNP
rs911341792 1121 dbSNP
rs1350122451 1136 dbSNP
rs1304889399 1140 dbSNP
rs1049835614 1151 dbSNP
rs1179373896 1153 dbSNP
rs1470702366 1154 dbSNP
rs1234111791 1159 dbSNP
rs1251778012 1159 dbSNP
rs1180686427 1160 dbSNP
rs931310891 1161 dbSNP
rs919906396 1165 dbSNP
rs1210249236 1166 dbSNP
rs1431050034 1167 dbSNP
rs973743613 1168 dbSNP
rs1224170095 1169 dbSNP
rs1349732701 1170 dbSNP
rs1286177467 1173 dbSNP
rs1416559872 1176 dbSNP
rs1344278739 1177 dbSNP
rs940588439 1179 dbSNP
rs1436106803 1180 dbSNP
rs1395157074 1197 dbSNP
rs560470757 1203 dbSNP
rs1159335324 1207 dbSNP
rs1452438361 1208 dbSNP
rs1399715880 1210 dbSNP
rs540562323 1211 dbSNP
rs1186852451 1213 dbSNP
rs1476511962 1217 dbSNP
rs992649957 1218 dbSNP
rs1181408049 1221 dbSNP
rs1482300347 1226 dbSNP
rs1243881866 1236 dbSNP
rs1216807902 1237 dbSNP
rs1446584039 1242 dbSNP
rs1485406268 1245 dbSNP
rs1266016641 1247 dbSNP
rs1241799453 1251 dbSNP
rs1335451786 1253 dbSNP
rs574470742 1255 dbSNP
rs554308451 1258 dbSNP
rs1226153435 1260 dbSNP
rs1363492402 1262 dbSNP
rs1214714874 1263 dbSNP
rs1429605438 1267 dbSNP
rs1061880 1268 dbSNP
rs544292261 1271 dbSNP
rs1463325551 1272 dbSNP
rs1210824195 1282 dbSNP
rs370953816 1283 dbSNP
rs1164731432 1285 dbSNP
rs1034515365 1286 dbSNP
rs979842441 1287 dbSNP
rs879720769 1305 dbSNP
rs1464671406 1325 dbSNP
rs1246406668 1335 dbSNP
rs1215572679 1342 dbSNP
rs1361681540 1345 dbSNP
rs575250574 1347 dbSNP
rs1219307979 1349 dbSNP
rs1416173502 1352 dbSNP
rs4443835 1354 dbSNP
rs1295677142 1361 dbSNP
rs199846995 1365 dbSNP
rs1432822375 1366 dbSNP
rs1441137463 1370 dbSNP
rs1395704977 1372 dbSNP
rs539662770 1375 dbSNP
rs968802143 1385 dbSNP
rs1356252990 1388 dbSNP
rs1171037900 1397 dbSNP
rs193184099 1400 dbSNP
rs1448912788 1401 dbSNP
rs1417039420 1404 dbSNP
rs1388590895 1408 dbSNP
rs554026543 1419 dbSNP
rs183114556 1423 dbSNP
rs1454835710 1427 dbSNP
rs1476280263 1428 dbSNP
rs1481614157 1443 dbSNP
rs1021267654 1449 dbSNP
rs1203863713 1453 dbSNP
rs763118667 1459 dbSNP
rs1281784087 1462 dbSNP
rs1234590647 1463 dbSNP
rs1330083759 1467 dbSNP
rs1301100554 1468 dbSNP
rs1385446342 1469 dbSNP
rs1009885408 1477 dbSNP
rs1299207736 1481 dbSNP
rs201191342 1482 dbSNP
rs1368812817 1484 dbSNP
rs892079386 1485 dbSNP
rs1377278945 1491 dbSNP
rs1196540936 1494 dbSNP
rs1019868568 1498 dbSNP
rs1250925015 1505 dbSNP
rs1482304073 1506 dbSNP
rs1253655709 1507 dbSNP
rs1482001350 1511 dbSNP
rs1205829978 1517 dbSNP
rs1008437952 1535 dbSNP
rs1210977824 1542 dbSNP
rs1343932005 1543 dbSNP
rs1253858869 1544 dbSNP
rs1231578153 1554 dbSNP
rs1319136795 1555 dbSNP
rs1289320264 1571 dbSNP
rs889921268 1578 dbSNP
rs1314918526 1583 dbSNP
rs61776766 1589 dbSNP
rs1234775464 1600 dbSNP
rs1355655793 1607 dbSNP
rs1050279777 1610 dbSNP
rs534258676 1616 dbSNP
rs1292263991 1621 dbSNP
rs1158063987 1630 dbSNP
rs1393845324 1633 dbSNP
rs931385906 1634 dbSNP
rs1188111867 1635 dbSNP
rs983241665 1636 dbSNP
rs1441300381 1637 dbSNP
rs1253408105 1638 dbSNP
rs1298679888 1640 dbSNP
rs1485955974 1641 dbSNP
rs1461365809 1644 dbSNP
rs1269165805 1647 dbSNP
rs1228158362 1660 dbSNP
rs868359038 1664 dbSNP
rs1327771878 1665 dbSNP
rs1295618654 1666 dbSNP
rs1246116940 1667 dbSNP
rs1339971631 1669 dbSNP
rs1397872127 1674 dbSNP
rs530610094 1677 dbSNP
rs1389654436 1678 dbSNP
rs1319713730 1680 dbSNP
rs1461739814 1681 dbSNP
rs6700227 1683 dbSNP
rs1472396730 1685 dbSNP
rs1366213297 1686 dbSNP
rs1037061223 1688 dbSNP
rs940013770 1689 dbSNP
rs568437208 1696 dbSNP
rs764133948 1699 dbSNP
rs1252676134 1701 dbSNP
rs1178295407 1703 dbSNP
rs1275387065 1705 dbSNP
rs1480565089 1707 dbSNP
rs1356184428 1708 dbSNP
rs1282569951 1713 dbSNP
rs1229689518 1721 dbSNP
rs1236768869 1723 dbSNP
rs907833242 1723 dbSNP
rs992703895 1724 dbSNP
rs1335886720 1728 dbSNP
rs1323898725 1729 dbSNP
rs1404697524 1736 dbSNP
rs1388481769 1741 dbSNP
rs377091481 1747 dbSNP
rs1242160996 1748 dbSNP
rs531790076 1754 dbSNP
rs927118593 1755 dbSNP
rs1455261843 1757 dbSNP
rs1255292455 1761 dbSNP
rs1200024779 1763 dbSNP
rs1451599769 1770 dbSNP
rs1307022210 1771 dbSNP
rs1390777415 1773 dbSNP
rs1342996480 1775 dbSNP
rs372729377 1779 dbSNP
rs1327812214 1781 dbSNP
rs1441440269 1785 dbSNP
rs1373381749 1789 dbSNP
rs1236378749 1802 dbSNP
rs1393451533 1803 dbSNP
rs1329321834 1809 dbSNP
rs1330774480 1813 dbSNP
rs1430275154 1816 dbSNP
rs4313339 1821 dbSNP
rs1166104261 1824 dbSNP
rs552372393 1828 dbSNP
rs532325519 1829 dbSNP
rs560425256 1833 dbSNP
rs540523742 1841 dbSNP
rs1418535698 1842 dbSNP
rs1483632531 1844 dbSNP
rs529991218 1850 dbSNP
rs1195981926 1851 dbSNP
rs1203102135 1853 dbSNP
rs1469189906 1854 dbSNP
rs1279571212 1857 dbSNP
rs1218468646 1858 dbSNP
rs1252752701 1860 dbSNP
rs1281014146 1864 dbSNP
rs1349795439 1865 dbSNP
rs1207753588 1867 dbSNP
rs1486627337 1878 dbSNP
rs1260909056 1879 dbSNP
rs1359425722 1885 dbSNP
rs1237734287 1886 dbSNP
rs1412348802 1887 dbSNP
rs544769199 1892 dbSNP
rs1350791118 1896 dbSNP
rs1473242275 1901 dbSNP
rs1411854053 1905 dbSNP
rs1180167183 1910 dbSNP
rs1484258703 1911 dbSNP
rs1238085091 1917 dbSNP
rs1305542646 1919 dbSNP
rs1234926178 1924 dbSNP
rs1286169083 1925 dbSNP
rs1370052494 1926 dbSNP
rs1021779115 1931 dbSNP
rs1321312413 1935 dbSNP
rs1385349301 1936 dbSNP
rs1283025675 1938 dbSNP
rs1445358055 1939 dbSNP
rs1387453859 1940 dbSNP
rs560896248 1941 dbSNP
rs1419183192 1945 dbSNP
rs143134567 1950 dbSNP
rs1176149475 1956 dbSNP
rs1426024481 1965 dbSNP
rs1181349014 1966 dbSNP
rs188309802 1968 dbSNP
rs1250112836 1969 dbSNP
rs1209169468 1970 dbSNP
rs186465849 1971 dbSNP
rs1265960672 1982 dbSNP
rs1215496423 1983 dbSNP
rs1322180363 1989 dbSNP
rs149075179 1993 dbSNP
rs1226100438 1998 dbSNP
rs1430617623 2000 dbSNP
rs1297836433 2004 dbSNP
rs1433850819 2009 dbSNP
rs370771686 2009 dbSNP
rs1204117668 2013 dbSNP
rs1008451033 2017 dbSNP
rs1281824588 2020 dbSNP
rs1350963094 2021 dbSNP
rs1211569892 2022 dbSNP
rs4307513 2023 dbSNP
rs1403648301 2024 dbSNP
rs1272959563 2027 dbSNP
rs1229366189 2028 dbSNP
rs369071058 2033 dbSNP
rs553988490 2034 dbSNP
rs1192699926 2036 dbSNP
rs116497550 2040 dbSNP
rs1399621539 2043 dbSNP
rs374765976 2044 dbSNP
rs77042062 2047 dbSNP
rs1435379638 2052 dbSNP
rs145135074 2061 dbSNP
rs1339629494 2063 dbSNP
rs190231537 2066 dbSNP
rs1388863368 2069 dbSNP
rs1476597376 2070 dbSNP
rs1373990768 2071 dbSNP
rs1434875336 2076 dbSNP
rs1372498562 2077 dbSNP
rs1169233434 2080 dbSNP
rs1429433411 2081 dbSNP
rs1028467845 2084 dbSNP
rs149957037 2091 dbSNP
rs1476623319 2092 dbSNP
rs1266361834 2098 dbSNP
rs1259052175 2113 dbSNP
rs1483962167 2117 dbSNP
rs1188081628 2128 dbSNP
rs1203793080 2136 dbSNP
rs1339693283 2139 dbSNP
rs186992805 2143 dbSNP
rs1276429242 2146 dbSNP
rs1233465891 2151 dbSNP
rs1313172335 2153 dbSNP
rs1300945738 2155 dbSNP
rs1197410866 2156 dbSNP
rs566670234 2157 dbSNP
rs1308778480 2159 dbSNP
rs377619547 2161 dbSNP
rs1250533630 2165 dbSNP
rs1037072102 2168 dbSNP
rs1218300667 2169 dbSNP
rs1304842967 2175 dbSNP
rs1338759996 2177 dbSNP
rs1295302086 2181 dbSNP
rs1173613887 2182 dbSNP
rs940066033 2188 dbSNP
rs1327572007 2193 dbSNP
rs1387334881 2194 dbSNP
rs546821356 2204 dbSNP
rs1180876561 2205 dbSNP
rs1412591127 2205 dbSNP
rs1056989196 2209 dbSNP
rs1339882177 2212 dbSNP
rs1200686424 2216 dbSNP
rs938575059 2219 dbSNP
rs1412119491 2220 dbSNP
rs1397719472 2224 dbSNP
rs1170372016 2225 dbSNP
rs1228277772 2229 dbSNP
rs182324701 2231 dbSNP
rs369522459 2234 dbSNP
rs1396831084 2243 dbSNP
rs1401751780 2248 dbSNP
rs1300913623 2249 dbSNP
rs1419599472 2255 dbSNP
rs947200965 2256 dbSNP
rs1158360591 2258 dbSNP
rs554533727 2260 dbSNP
rs1369697306 2262 dbSNP
rs1235234435 2266 dbSNP
rs113078172 2269 dbSNP
rs530405358 2274 dbSNP
rs564577693 2276 dbSNP
rs1202219249 2278 dbSNP
rs1466556601 2283 dbSNP
rs190637252 2288 dbSNP
rs187504737 2289 dbSNP
rs560272523 2293 dbSNP
rs1336606224 2294 dbSNP
rs955700243 2304 dbSNP
rs1340137936 2305 dbSNP
rs1313227258 2307 dbSNP
rs1437484234 2309 dbSNP
rs1365675648 2310 dbSNP
rs147663190 2319 dbSNP
rs1398944914 2320 dbSNP
rs1392783571 2326 dbSNP
rs1163388346 2328 dbSNP
rs374046736 2330 dbSNP
rs1366163494 2331 dbSNP
rs1190137970 2333 dbSNP
rs1249041664 2343 dbSNP
rs1449638735 2343 dbSNP
rs1282479485 2354 dbSNP
rs1210916044 2358 dbSNP
rs1445041116 2362 dbSNP
rs1289606781 2371 dbSNP
rs1336900690 2372 dbSNP
rs1343130489 2373 dbSNP
rs1296667789 2374 dbSNP
rs1428362969 2378 dbSNP
rs866303598 2379 dbSNP
rs1332804372 2380 dbSNP
rs1234580170 2382 dbSNP
rs1324164510 2383 dbSNP
rs1386099986 2385 dbSNP
rs1363185281 2390 dbSNP
rs1169867862 2395 dbSNP
rs1430084636 2396 dbSNP
rs1164199800 2397 dbSNP
rs1389155593 2399 dbSNP
rs1168394137 2402 dbSNP
rs1446337504 2402 dbSNP
rs1331204573 2403 dbSNP
rs182001072 2404 dbSNP
rs867555943 2405 dbSNP
rs1383259387 2407 dbSNP
rs1207361484 2413 dbSNP
rs1165276201 2414 dbSNP
rs1274158306 2415 dbSNP
rs1212987722 2421 dbSNP
rs1346892727 2433 dbSNP
rs1404377234 2441 dbSNP
rs1411052634 2445 dbSNP
rs1343561604 2452 dbSNP
rs1159833360 2453 dbSNP
rs912203161 2457 dbSNP
rs1369358383 2458 dbSNP
rs1326469516 2462 dbSNP
rs575047716 2465 dbSNP
rs1415762537 2466 dbSNP
rs111597796 2471 dbSNP
rs1176630370 2474 dbSNP
rs538566148 2485 dbSNP
rs1469705895 2489 dbSNP
rs200953341 2490 dbSNP
rs1028982381 2495 dbSNP
rs140002360 2496 dbSNP
rs995725938 2497 dbSNP
rs1321390663 2498 dbSNP
rs1225559198 2501 dbSNP
rs1290169972 2502 dbSNP
rs1228879581 2507 dbSNP
rs1349349912 2523 dbSNP
rs1277194205 2527 dbSNP
rs963202883 2529 dbSNP
rs1359365332 2531 dbSNP
rs1335327279 2535 dbSNP
rs1469588218 2536 dbSNP
rs1404318936 2544 dbSNP
rs1162032783 2545 dbSNP
rs1407357383 2546 dbSNP
rs1473173614 2546 dbSNP
rs1175554535 2553 dbSNP
rs1015635749 2555 dbSNP
rs1309173471 2563 dbSNP
rs1004223786 2567 dbSNP
rs368634364 2568 dbSNP
rs1326964940 2569 dbSNP
rs1459829512 2573 dbSNP
rs1436162518 2574 dbSNP
rs1328382878 2579 dbSNP
rs1281592775 2581 dbSNP
rs1056411952 2596 dbSNP
rs1229511111 2596 dbSNP
rs1319820594 2598 dbSNP
rs1400791191 2600 dbSNP
rs1349346023 2602 dbSNP
rs1002600113 2605 dbSNP
rs1458291648 2613 dbSNP
rs1345103622 2615 dbSNP
rs1156842218 2616 dbSNP
rs1455515774 2618 dbSNP
rs1395502287 2621 dbSNP
rs1190438429 2638 dbSNP
rs566982967 2642 dbSNP
rs1476890776 2643 dbSNP
rs1245213395 2649 dbSNP
rs1218130729 2652 dbSNP
rs1442935640 2652 dbSNP
rs1188951229 2654 dbSNP
rs1485529879 2657 dbSNP
rs1488695093 2664 dbSNP
rs1240249266 2677 dbSNP
rs905813927 2681 dbSNP
rs1044702104 2682 dbSNP
rs375882709 2685 dbSNP
rs1343853030 2688 dbSNP
rs192056551 2691 dbSNP
rs536081676 2694 dbSNP
rs947243043 2697 dbSNP
rs112067060 2698 dbSNP
rs1365852079 2705 dbSNP
rs1208501806 2706 dbSNP
rs1302621769 2708 dbSNP
rs1271641886 2709 dbSNP
rs1392229377 2712 dbSNP
rs1169026122 2718 dbSNP
rs1430997969 2724 dbSNP
rs1339338444 2727 dbSNP
rs377316985 2728 dbSNP
rs878914618 2728 dbSNP
rs1295778974 2737 dbSNP
rs1435998608 2739 dbSNP
rs1376017831 2740 dbSNP
rs7416520 2744 dbSNP
rs1052869238 2753 dbSNP
rs185863724 2754 dbSNP
rs912297288 2756 dbSNP
rs1483860608 2757 dbSNP
rs1274875468 2765 dbSNP
rs1226191260 2774 dbSNP
rs1188563976 2776 dbSNP
rs1307296871 2780 dbSNP
rs1293795204 2781 dbSNP
rs530879060 2784 dbSNP
rs953837587 2785 dbSNP
rs1372439120 2786 dbSNP
rs564491251 2787 dbSNP
rs1461621642 2794 dbSNP
rs1352553579 2795 dbSNP
rs974693141 2796 dbSNP
rs1433760517 2800 dbSNP
rs1428490337 2803 dbSNP
rs962921867 2815 dbSNP
rs550969664 2819 dbSNP
rs1486663558 2820 dbSNP
rs181381268 2821 dbSNP
rs1251834758 2822 dbSNP
rs1194876775 2829 dbSNP
rs1250036265 2830 dbSNP
rs188593527 2832 dbSNP
rs960804679 2834 dbSNP
rs539141119 2838 dbSNP
rs1222165854 2843 dbSNP
rs1218905043 2846 dbSNP
rs1352426488 2847 dbSNP
rs559044163 2848 dbSNP
rs1391110609 2849 dbSNP
rs141732428 2849 dbSNP
rs1304423832 2852 dbSNP
rs1466333699 2860 dbSNP
rs1405034458 2868 dbSNP
rs1174215468 2869 dbSNP
rs1458685700 2871 dbSNP
rs1412149265 2872 dbSNP
rs74047817 2875 dbSNP
rs1278507509 2880 dbSNP
rs1416988267 2881 dbSNP
rs771858066 2886 dbSNP
rs1257790644 2888 dbSNP
rs1379175263 2895 dbSNP
rs1302259730 2897 dbSNP
rs905152897 2903 dbSNP
rs397780437 2906 dbSNP
rs1262843969 2916 dbSNP
rs1044326678 2926 dbSNP
rs1061892 2927 dbSNP
rs1334243945 2935 dbSNP
rs1011880445 2943 dbSNP
rs892994150 2952 dbSNP
rs561571857 2959 dbSNP
rs1381773158 2960 dbSNP
rs1052964756 2962 dbSNP
rs1437261321 2964 dbSNP
rs1464869727 2967 dbSNP
rs1157521790 2968 dbSNP
rs1389260763 2968 dbSNP
rs1423200990 2972 dbSNP
rs17162801 2973 dbSNP
rs1165052024 2977 dbSNP
rs1443564834 2982 dbSNP
rs17162798 2983 dbSNP
rs1256942908 2991 dbSNP
rs934468502 2993 dbSNP
rs1263006086 3002 dbSNP
rs1138961 3005 dbSNP
rs746047233 3008 dbSNP
rs539053744 3011 dbSNP
rs774014051 3013 dbSNP
rs1235064315 3020 dbSNP
rs1138964 3021 dbSNP
rs1247075656 3021 dbSNP
rs1330884207 3026 dbSNP
rs1138965 3032 dbSNP
rs1326762312 3033 dbSNP
rs1317615219 3039 dbSNP
rs112198495 3041 dbSNP
rs1392263745 3042 dbSNP
rs5772057 3042 dbSNP
rs1183086162 3044 dbSNP
rs1382986710 3049 dbSNP
rs1423673413 3049 dbSNP
rs573349696 3055 dbSNP
rs1051286852 3057 dbSNP
rs371528017 3061 dbSNP
rs562524486 3061 dbSNP
rs932339995 3066 dbSNP
rs1193118376 3076 dbSNP
rs553483637 3077 dbSNP
rs369307212 3085 dbSNP
rs536789626 3086 dbSNP
rs1375478133 3088 dbSNP
rs1223289042 3096 dbSNP
rs1490259011 3097 dbSNP
rs1289900278 3103 dbSNP
rs1230818425 3106 dbSNP
rs1331891855 3112 dbSNP
rs1339843726 3113 dbSNP
rs1445783333 3114 dbSNP
rs1332749664 3119 dbSNP
rs1283427894 3120 dbSNP
rs1397846902 3124 dbSNP
rs1363122105 3126 dbSNP
rs1309498734 3136 dbSNP
rs1329631108 3146 dbSNP
rs1410127375 3152 dbSNP
rs1459621807 3153 dbSNP
rs1369169723 3155 dbSNP
rs1474740665 3162 dbSNP
rs1379846795 3175 dbSNP
rs1200731115 3176 dbSNP
rs1480160999 3183 dbSNP
rs920896002 3187 dbSNP
rs1207561735 3189 dbSNP
rs567609429 3190 dbSNP
rs548986616 3196 dbSNP
rs1193838894 3197 dbSNP
rs1347092837 3199 dbSNP
rs1061902 3200 dbSNP
rs1222772408 3201 dbSNP
rs1343112927 3204 dbSNP
rs1179737788 3209 dbSNP
rs1289610519 3210 dbSNP
rs974369211 3218 dbSNP
rs1328649994 3221 dbSNP
rs1236716319 3224 dbSNP
rs1408604089 3225 dbSNP
rs1408690646 3227 dbSNP
rs1215226109 3229 dbSNP
rs941629295 3233 dbSNP
rs1427366504 3238 dbSNP
rs1179014534 3240 dbSNP
rs908784424 3248 dbSNP
rs567343832 3263 dbSNP
rs550753548 3264 dbSNP
rs1264449659 3265 dbSNP
rs529025585 3269 dbSNP
rs1443951687 3271 dbSNP
rs1263466519 3272 dbSNP
rs111764075 3278 dbSNP
rs1202966498 3283 dbSNP
rs1321331870 3284 dbSNP
rs377386046 3286 dbSNP
rs960858418 3294 dbSNP
rs1035068385 3307 dbSNP
rs1449687704 3310 dbSNP
rs371881484 3321 dbSNP
rs1239325356 3322 dbSNP
rs981228749 3327 dbSNP
rs1404514337 3328 dbSNP
rs1161429596 3330 dbSNP
rs969429880 3333 dbSNP
rs1407291349 3341 dbSNP
rs1387096177 3342 dbSNP
rs1391754728 3344 dbSNP
rs368447223 3345 dbSNP
rs1360963616 3346 dbSNP
rs1010889381 3347 dbSNP
rs530552106 3348 dbSNP
rs1159845277 3350 dbSNP
rs1243806467 3355 dbSNP
rs1439595566 3356 dbSNP
rs1445925766 3357 dbSNP
rs1281438492 3360 dbSNP
rs1229739129 3366 dbSNP
rs1378893167 3368 dbSNP
rs1195925797 3373 dbSNP
rs893088215 3375 dbSNP
rs571222486 3385 dbSNP
rs10968 3386 dbSNP
rs998729759 3393 dbSNP
rs1383055849 3395 dbSNP
rs1207697928 3397 dbSNP
rs1163126799 3410 dbSNP
rs1486597684 3411 dbSNP
rs1286088396 3415 dbSNP
rs1421314083 3423 dbSNP
rs569657454 3424 dbSNP
rs1351459488 3430 dbSNP
rs528054094 3431 dbSNP
rs1233724433 3432 dbSNP
rs1490423851 3435 dbSNP
rs1290623705 3436 dbSNP
rs1219741264 3440 dbSNP
rs1330228885 3445 dbSNP
rs1298099339 3450 dbSNP
rs1215740116 3454 dbSNP
rs1300928598 3493 dbSNP
rs1385295024 3502 dbSNP
rs1268529780 3508 dbSNP
rs932368942 3511 dbSNP
rs899560464 3520 dbSNP
rs1302793159 3522 dbSNP
rs1422899066 3527 dbSNP
rs1419123284 3532 dbSNP
rs1359207216 3535 dbSNP
rs1427897100 3536 dbSNP
rs1417262981 3539 dbSNP
rs558956810 3540 dbSNP
rs1480491472 3542 dbSNP
rs1267485810 3546 dbSNP
rs548796082 3547 dbSNP
rs1466938360 3549 dbSNP
rs529032723 3550 dbSNP
rs1377414426 3551 dbSNP
rs1196370011 3556 dbSNP
rs1173318201 3559 dbSNP
rs1225824669 3560 dbSNP
rs1282720830 3562 dbSNP
rs561277861 3568 dbSNP
rs1263406982 3571 dbSNP
rs1403397689 3571 dbSNP
rs1298573783 3574 dbSNP
rs1478397543 3575 dbSNP
rs1352497317 3580 dbSNP
rs1178517292 3585 dbSNP
rs1470194139 3596 dbSNP
rs1428075416 3600 dbSNP
rs1192328925 3601 dbSNP
rs941020368 3609 dbSNP
rs1176216846 3614 dbSNP
rs1282390883 3617 dbSNP
rs908838400 3618 dbSNP
rs1200958290 3619 dbSNP
rs982956580 3621 dbSNP
rs1324873748 3624 dbSNP
rs1262641227 3630 dbSNP
rs1231118730 3634 dbSNP
rs1344107098 3637 dbSNP
rs1308006464 3638 dbSNP
rs1390982650 3642 dbSNP
rs1254002388 3650 dbSNP
rs1370915386 3652 dbSNP
rs544800901 3653 dbSNP
rs1320307732 3655 dbSNP
rs928092834 3656 dbSNP
rs1454911856 3660 dbSNP
rs980898316 3662 dbSNP
rs113367697 3664 dbSNP
rs531199562 3668 dbSNP
rs1336787022 3669 dbSNP
rs1378915972 3669 dbSNP
rs1243103265 3671 dbSNP
rs1199197817 3676 dbSNP
rs1486898641 3677 dbSNP
rs1261318015 3695 dbSNP
rs1238688616 3701 dbSNP
rs969902455 3704 dbSNP
rs1316963680 3708 dbSNP
rs1246402877 3719 dbSNP
rs1022365605 3725 dbSNP
rs1381723970 3725 dbSNP
rs1383780788 3729 dbSNP
rs1397103798 3731 dbSNP
rs1401997360 3734 dbSNP
rs1171223922 3735 dbSNP
rs1367016479 3736 dbSNP
rs1467466027 3737 dbSNP
rs1423915572 3745 dbSNP
rs1169434449 3754 dbSNP
rs1186056422 3755 dbSNP
rs1476592086 3768 dbSNP
rs1262594252 3769 dbSNP
rs989922058 3773 dbSNP
rs1238686467 3776 dbSNP
rs1204612774 3778 dbSNP
rs1487455645 3779 dbSNP
rs1188222161 3780 dbSNP
rs1223427621 3787 dbSNP
rs1441738254 3788 dbSNP
rs1253943842 3789 dbSNP
rs1229592514 3794 dbSNP
rs1326929975 3794 dbSNP
rs1200327225 3796 dbSNP
rs1397625609 3798 dbSNP
rs1423536699 3801 dbSNP
rs1457998483 3801 dbSNP
rs1390550253 3802 dbSNP
rs565602013 3803 dbSNP
rs956691465 3804 dbSNP
rs1374113422 3810 dbSNP
rs1316198852 3812 dbSNP
rs1286002913 3814 dbSNP
rs1245568357 3818 dbSNP
rs1271057205 3821 dbSNP
rs1340422711 3828 dbSNP
rs1490242717 3829 dbSNP
rs1287525124 3834 dbSNP
rs1197300618 3842 dbSNP
rs1332706204 3850 dbSNP
rs1031597618 3857 dbSNP
rs1250712493 3858 dbSNP
rs1216661986 3869 dbSNP
rs1346856996 3878 dbSNP
rs1283361828 3883 dbSNP
rs1328979659 3892 dbSNP
rs1404015426 3892 dbSNP
rs1393534433 3893 dbSNP
rs1397602347 3897 dbSNP
rs1170595965 3898 dbSNP
rs998739541 3910 dbSNP
rs1401478815 3911 dbSNP
rs1245233817 3918 dbSNP
rs890979481 3920 dbSNP
rs1029931894 3921 dbSNP
rs1249477529 3929 dbSNP
rs1196744972 3941 dbSNP
rs1263276097 3945 dbSNP
rs1342214732 3946 dbSNP
rs1330329016 3947 dbSNP
rs1463711872 3951 dbSNP
rs1415381893 3959 dbSNP
rs1336789809 3969 dbSNP
rs1331079794 3970 dbSNP
rs1445275680 3971 dbSNP
rs1408900526 3978 dbSNP
rs545746322 3987 dbSNP
rs1413997263 3991 dbSNP
rs1423080031 3992 dbSNP
rs1160519082 3993 dbSNP
rs1487142656 4000 dbSNP
rs1379519811 4001 dbSNP
rs1176522448 4005 dbSNP
rs1462631198 4008 dbSNP
rs1472147410 4009 dbSNP
rs1202908959 4011 dbSNP
rs899611972 4016 dbSNP
rs1366657832 4039 dbSNP
rs1285738055 4041 dbSNP
rs1224048071 4055 dbSNP
rs879035151 4057 dbSNP
rs1309036279 4061 dbSNP
rs1238468266 4068 dbSNP
rs1458095229 4070 dbSNP
rs1237320176 4071 dbSNP
rs1198302033 4078 dbSNP
rs1436325803 4080 dbSNP
rs1357569073 4084 dbSNP
rs1320356882 4087 dbSNP
rs1401554165 4110 dbSNP
rs1360099937 4113 dbSNP
rs1157043456 4115 dbSNP
rs1292233560 4120 dbSNP
rs1385572771 4122 dbSNP
rs751506242 4123 dbSNP
rs1181215647 4128 dbSNP
rs1038118164 4135 dbSNP
rs1243392915 4137 dbSNP
rs1005177027 4138 dbSNP
rs886741394 4142 dbSNP
rs1283466815 4148 dbSNP
rs1210525754 4153 dbSNP
rs1047314264 4155 dbSNP
rs1355651353 4164 dbSNP
rs1316165758 4169 dbSNP
rs1228312941 4170 dbSNP
rs1377592659 4178 dbSNP
rs1272040259 4180 dbSNP
rs551157223 4183 dbSNP
rs939582702 4184 dbSNP
rs928220658 4189 dbSNP
rs1296599827 4191 dbSNP
rs1426716964 4191 dbSNP
rs1200621788 4192 dbSNP
rs1163777334 4193 dbSNP
rs1403570062 4199 dbSNP
rs573261160 4202 dbSNP
rs1477217596 4206 dbSNP
rs1308948933 4207 dbSNP
rs948239102 4209 dbSNP
rs915352474 4210 dbSNP
rs1490408158 4213 dbSNP
rs553376312 4216 dbSNP
rs1062088 4220 dbSNP
rs1275753376 4221 dbSNP
rs1320250994 4221 dbSNP
rs1215614830 4224 dbSNP
rs1323738431 4228 dbSNP
rs1317381961 4230 dbSNP
rs15438 4232 dbSNP
rs533057236 4233 dbSNP
rs542706158 4237 dbSNP
rs956701356 4238 dbSNP
rs1160438470 4242 dbSNP
rs1293115043 4246 dbSNP
rs565290060 4247 dbSNP
rs1379575015 4249 dbSNP
rs1176573658 4253 dbSNP
rs1420914745 4256 dbSNP
rs1177939703 4263 dbSNP
rs987448930 4269 dbSNP
rs574086989 4272 dbSNP
rs1029570044 4282 dbSNP
rs1234896782 4288 dbSNP
rs1457690608 4292 dbSNP
rs997121478 4292 dbSNP
rs1256277290 4293 dbSNP
rs1225461870 4294 dbSNP
rs540861992 4295 dbSNP
rs1451168833 4300 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacaCGACGAu 5'
                         |||||| 
Target 5' -gcaggaagcugccaGCUGCU- 3'
1 - 20
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_ControlA_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control A
Location of target site ENST00000378662.1 | 3UTR | GCAGGAAGCUGCCAGCUGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.485 9.5e-3 -0.415 2.4e-2 23 Click to see details
GSE17306 Multiple myeloma -0.193 9.2e-2 -0.245 4.5e-2 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.223 1.4e-1 -0.324 5.7e-2 25 Click to see details
GSE21032 Prostate cancer -0.083 2.3e-1 -0.058 3.0e-1 83 Click to see details
GSE28544 Breast cancer -0.153 2.4e-1 -0.451 1.3e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.179 2.8e-1 -0.137 3.3e-1 13 Click to see details
GSE32688 Pancreatic cancer -0.103 2.9e-1 -0.098 3.0e-1 32 Click to see details
GSE21687 Ependynoma primary tumors -0.056 3.3e-1 -0.157 1.1e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.034 4.6e-1 -0.028 4.7e-1 12 Click to see details
GSE19350 CNS germ cell tumors -0.034 4.6e-1 -0.028 4.7e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.465 0 -0.382 0.01 42 Click to see details
KIRC -0.344 0 -0.335 0 68 Click to see details
PAAD 0.98 0.01 0.800 0.1 4 Click to see details
BLCA -0.527 0.01 -0.641 0 18 Click to see details
LIHC 0.29 0.02 0.326 0.01 49 Click to see details
THCA 0.172 0.1 0.163 0.11 59 Click to see details
ESCA -0.353 0.14 -0.191 0.29 11 Click to see details
PRAD 0.14 0.17 0.131 0.18 50 Click to see details
LUAD -0.275 0.19 -0.182 0.29 12 Click to see details
COAD -0.319 0.22 -0.381 0.18 8 Click to see details
CHOL -0.225 0.28 -0.150 0.35 9 Click to see details
UCEC -0.137 0.29 -0.123 0.31 19 Click to see details
KIRP -0.099 0.29 -0.129 0.24 32 Click to see details
LUSC 0.088 0.3 0.186 0.13 38 Click to see details
STAD -0.075 0.34 0.068 0.36 32 Click to see details
BRCA -0.03 0.39 -0.052 0.32 84 Click to see details
KICH 0.052 0.4 0.166 0.21 25 Click to see details
CESC -0.049 0.48 -0.500 0.33 3 Click to see details
PCPG 0.033 0.49 -0.500 0.33 3 Click to see details
PCPG 0.033 0.49 -0.500 0.33 3 Click to see details
PCPG 0.033 0.49 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1