miRTarBase - #MIRT720092 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SPTLC3   
Synonyms C20orf38, LCB 3, LCB2B, LCB3, SPT 3, SPT3, SPTLC2L, dJ718P11, dJ718P11.1, hLCB2b
Description serine palmitoyltransferase long chain base subunit 3
Transcript NM_018327   
Expression
Putative miRNA Targets on SPTLC3
3'UTR of SPTLC3
(miRNA target sites are highlighted)
>SPTLC3|NM_018327|3'UTR
   1 GTTTCCTGGTCCTGAATGACACATAAAGACTTTGCGAGAAAGACCTCCCTCCTTGCCTCACAAGGAATATAAATGGATTT
  81 CTCCCCCTTCCTCAGGACAATTTTGGTTCCCAGACCAGCTTGATTGAACTGAGGGAGACGTTGTTGTTTTTAATGTCTCC
 161 AGCTTGGACTGCAGAGACAAAAACATGATTCCAGATTTAAGTCTCTCTTCTTCCAAGTATTCTACTAGAAATACACACAC
 241 ACACACACACACACTTCTGAGAATATTTTTAATGGCAATAAGCCTGTGTTTTAGCTGCTACTGTGCAGACCCTTTCAGGG
 321 ATTCCAACCAAATGCAAATGAGAGAATTTAAAATTTTTATTCAGTAAGTTCACTATGTGTTTACTTATTCCATCTGCAGA
 401 TGTAAGTGAGTGTGGTGGACAGTAGCCACCTTCCTTGTTCCACTCATAAAAGCATCAGCTAGATCTCATCTGTATCATGG
 481 GAAGTTCCAGGCAGGAGGGTAAAGAAATGTTGTTTCTACCATTTGTCACATTTGGACGTTTTTCACAGACAAGTGTCAAA
 561 AGACATAGTTAATGTTTCGAGGGGGAAAGCAGAACTGATCAACTGCGACTAGAGACGTCTTTGAAGGAAATTTTCCTTTT
 641 CCTCTTGCTGGTCTCCTACAGTTTTACAGCTGAGCTTTTGAGGTTTGGAAAATTCAAGATGTTTGTTTCATAAGAAAAGG
 721 GGCAGAAAGCAAGCACAAGACACTTTTAGGTCTAGACTAAAATGGTAGTTACAACAATTTGAACCTTGTTGGTGCAGTGC
 801 ACGGTGAATGCTTACCCTGCACAGCCTCTATTACCTTAAGGAATTAGTTGTCATTTTCCTATTGAATTTTGAGTAAATGG
 881 TGAAATTCAGTGTCCTTTAGAATCGACTCCCAAGACTATATTTGAAGAATGCATTGATTCAAGAAGGACATTTAAAAGCA
 961 AATTCTGACTTTTTCAAGACCAACACACTTGTTTAGGCCTATTAAATTGTACTATCACTTGTTACATGCCCTCTGAATTG
1041 GGAGAAAGTGGGCTTGCACACTTTGAGGTAACTAACTGTAATTTACTTGTGTTCTCTCTTTCTTGCTCTCCTTCTCAACA
1121 TGAACACAAACCTCTATGGAAAAGTAGCCTCTTGTTAATCTGATCTAGTTTGTATGGAAAAAGCCCATGGAGAACCTTAT
1201 CTTTAACAAGCTCCCAGAGGGTGCCCAGATTTGGAAATTCTAGAGAGCAGTGGTGACCTTTTAGCAAAGCTTCTGTAACA
1281 GTTCGAATGAGTTGCAGAACATTCCACTCCATCAAATGACACTGTAAACAAATCACTTCAAGAGAGGCTTGGTTTTGTGT
1361 GGCACAGATGGACCCAAGCTTTCATGCTGTGCACTGAGATAGAAACTCCACCCGCAGCGCCTGCGATGGATGGAGCAGTG
1441 TGCCCTGATGCTCAAAGCGTATTAAAGGAAAAAAAGTGATCAGCATGGAAAGTTTTTATGGGGAAATTATAACTCCAAGT
1521 GGGTGCATTGGTTTAAAAATGGATCACAATGATAGAGTTCTTCATGAATGTTTACAAGTTGTAAGGAATACCGTTAGTGA
1601 AAGAGGAAAAGAAGTGGGTTCTGAAAATGCAGTTTCCCATCCAATGATTTTGATAACAAAATTCCAACTTTTCTCAATGA
1681 AACTGATGCAGTATTATTTGTGCAAATAAAATGTGTCATAAATATGCAAAGAAAGGGAGACATACTGTTCTTATCTTGAA
1761 TATGTGCATTTAAATGAATTGTCCAAAATGCATAAATGCCTTGCGTTCTATAAAGGAAACAGGAGGTCAAAAAGACAGCG
1841 AGATATCTAGTCCTTCCACAAGGTATGGAAAGCAATAAACATCTTCCTTTCTTTCTGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUG-GUAACAGUGUGAGGu 5'
             |||| ||    ||||||:| 
Target 5' cacACACACACACACACACTTCt 3'
236 - 258 139.00 -15.40
2
miRNA  3' guuuGUGGU-AACAGUGUGAGgu 5'
              :|||| ||||||||:|:  
Target 5' tttcTACCATTTGTCACATTTgg 3'
513 - 535 126.00 -17.80
3
miRNA  3' guUUGUGGUAACAG---UGUGAGGu 5'
            ||::  :||| |   |||:||| 
Target 5' cgAATG-AGTTG-CAGAACATTCCa 3'
1284 - 1306 126.00 -12.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31486676 9 COSMIC
COSN30604585 47 COSMIC
COSN30115946 50 COSMIC
COSN32056850 62 COSMIC
COSN30527818 128 COSMIC
COSN23042734 254 COSMIC
COSN20116265 255 COSMIC
COSN30259645 270 COSMIC
COSN15724405 298 COSMIC
COSN27801958 636 COSMIC
COSN9395679 641 COSMIC
COSN14599332 661 COSMIC
COSN5763051 973 COSMIC
COSN31540845 1174 COSMIC
COSN31566544 1184 COSMIC
COSN31551044 1220 COSMIC
COSN28797850 1366 COSMIC
COSN31542929 1414 COSMIC
COSN20093692 1678 COSMIC
COSN10011395 1860 COSMIC
COSN20593442 2244 COSMIC
COSN22356333 2421 COSMIC
COSN1864914 2442 COSMIC
COSN15055879 2632 COSMIC
COSN1864915 2726 COSMIC
COSN10011396 2869 COSMIC
COSN27187504 2884 COSMIC
COSN21205568 3152 COSMIC
COSN28489526 3317 COSMIC
COSN14814103 3319 COSMIC
COSN23772623 4079 COSMIC
rs2144134 2639 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1463627254 3 dbSNP
rs757677844 8 dbSNP
rs781435313 9 dbSNP
rs963554621 12 dbSNP
rs745483202 15 dbSNP
rs769441414 20 dbSNP
rs779482335 22 dbSNP
rs980345574 26 dbSNP
rs748859192 28 dbSNP
rs1402638661 29 dbSNP
rs181292850 30 dbSNP
rs775802960 30 dbSNP
rs774930430 31 dbSNP
rs185155266 35 dbSNP
rs371448672 36 dbSNP
rs375337032 37 dbSNP
rs1279504315 41 dbSNP
rs759762058 44 dbSNP
rs147569987 47 dbSNP
rs1251168448 53 dbSNP
rs973380186 87 dbSNP
rs547285772 95 dbSNP
rs1322734158 101 dbSNP
rs1439520258 106 dbSNP
rs1391892198 107 dbSNP
rs1203996332 117 dbSNP
rs919284614 121 dbSNP
rs56997176 125 dbSNP
rs570398121 132 dbSNP
rs975581857 134 dbSNP
rs1248029702 140 dbSNP
rs547182291 141 dbSNP
rs1186392082 147 dbSNP
rs1417849390 148 dbSNP
rs149055323 152 dbSNP
rs1042868563 155 dbSNP
rs1245223284 164 dbSNP
rs924566552 165 dbSNP
rs1451967442 170 dbSNP
rs934560926 173 dbSNP
rs549460509 174 dbSNP
rs1039619731 175 dbSNP
rs1232996528 186 dbSNP
rs904253437 195 dbSNP
rs142096985 197 dbSNP
rs1052703266 204 dbSNP
rs1012893106 217 dbSNP
rs189912717 218 dbSNP
rs1044875199 231 dbSNP
rs891492652 231 dbSNP
rs112191821 233 dbSNP
rs1275295868 233 dbSNP
rs1309939294 233 dbSNP
rs1463239963 233 dbSNP
rs200852357 233 dbSNP
rs1429965453 238 dbSNP
rs1280059462 239 dbSNP
rs141156663 243 dbSNP
rs67418808 245 dbSNP
rs1268307876 246 dbSNP
rs1372207117 250 dbSNP
rs557702960 253 dbSNP
rs34511643 255 dbSNP
rs899243036 259 dbSNP
rs995036602 261 dbSNP
rs1024186679 262 dbSNP
rs1309175576 284 dbSNP
rs183283922 288 dbSNP
rs1026469585 295 dbSNP
rs151174742 303 dbSNP
rs1178405652 325 dbSNP
rs78379730 334 dbSNP
rs1407597378 340 dbSNP
rs1016795190 341 dbSNP
rs532811777 364 dbSNP
rs768505525 365 dbSNP
rs1482270035 367 dbSNP
rs1445874550 378 dbSNP
rs1239097973 385 dbSNP
rs1210266408 394 dbSNP
rs1315759290 395 dbSNP
rs975068546 396 dbSNP
rs1028068357 400 dbSNP
rs1331670585 402 dbSNP
rs1289431135 405 dbSNP
rs1212993062 407 dbSNP
rs968432467 408 dbSNP
rs542302884 409 dbSNP
rs1240913891 412 dbSNP
rs919249347 418 dbSNP
rs1474054334 421 dbSNP
rs556141788 423 dbSNP
rs1305090876 427 dbSNP
rs978595136 428 dbSNP
rs375238450 440 dbSNP
rs1344649468 444 dbSNP
rs1157224791 445 dbSNP
rs1458964596 450 dbSNP
rs987882564 453 dbSNP
rs549640934 459 dbSNP
rs6078943 460 dbSNP
rs994078035 477 dbSNP
rs934488764 485 dbSNP
rs993169796 493 dbSNP
rs1258207463 499 dbSNP
rs917141579 506 dbSNP
rs1485261715 508 dbSNP
rs948767880 508 dbSNP
rs1245600409 517 dbSNP
rs943633339 522 dbSNP
rs576088094 533 dbSNP
rs1389511569 534 dbSNP
rs781114265 538 dbSNP
rs545064606 539 dbSNP
rs1364566504 548 dbSNP
rs569656722 558 dbSNP
rs1429122726 562 dbSNP
rs1437365611 567 dbSNP
rs535268344 572 dbSNP
rs1052835818 573 dbSNP
rs886618386 580 dbSNP
rs1456226764 599 dbSNP
rs1009033561 607 dbSNP
rs891452900 608 dbSNP
rs186533179 613 dbSNP
rs1388241870 615 dbSNP
rs900751704 617 dbSNP
rs1045821877 618 dbSNP
rs1252018701 624 dbSNP
rs1027933901 640 dbSNP
rs1487715038 656 dbSNP
rs1267545606 657 dbSNP
rs968463563 659 dbSNP
rs978501833 669 dbSNP
rs1296009544 671 dbSNP
rs115472783 673 dbSNP
rs114733338 674 dbSNP
rs1300851532 676 dbSNP
rs1385246615 683 dbSNP
rs1016761964 686 dbSNP
rs962568204 709 dbSNP
rs994918292 716 dbSNP
rs549151228 721 dbSNP
rs1368681889 722 dbSNP
rs1349470934 723 dbSNP
rs1170361366 727 dbSNP
rs1202907505 731 dbSNP
rs1026360274 750 dbSNP
rs1280124239 755 dbSNP
rs1444643957 759 dbSNP
rs769922307 767 dbSNP
rs1196328022 768 dbSNP
rs1434604448 771 dbSNP
rs555096310 773 dbSNP
rs1212155500 774 dbSNP
rs1192180018 776 dbSNP
rs1257289301 780 dbSNP
rs917186448 785 dbSNP
rs773278565 786 dbSNP
rs1207832148 792 dbSNP
rs1184747100 795 dbSNP
rs1364648932 796 dbSNP
rs368443956 798 dbSNP
rs4510290 801 dbSNP
rs1231151928 803 dbSNP
rs752297822 821 dbSNP
rs77169376 822 dbSNP
rs1333085408 831 dbSNP
rs980120672 836 dbSNP
rs1409014734 847 dbSNP
rs1427288251 848 dbSNP
rs1435286024 849 dbSNP
rs771124123 854 dbSNP
rs1309784663 875 dbSNP
rs1430269918 883 dbSNP
rs1401393889 890 dbSNP
rs375987073 891 dbSNP
rs551827660 905 dbSNP
rs926116642 906 dbSNP
rs1308392082 910 dbSNP
rs367568380 911 dbSNP
rs73087773 913 dbSNP
rs1184768471 919 dbSNP
rs1236354105 923 dbSNP
rs1254987963 931 dbSNP
rs1198847622 944 dbSNP
rs1256845209 944 dbSNP
rs371326030 945 dbSNP
rs1326837454 946 dbSNP
rs900780173 947 dbSNP
rs1410205103 952 dbSNP
rs1339846836 954 dbSNP
rs533700342 960 dbSNP
rs1345053149 968 dbSNP
rs1235710713 969 dbSNP
rs1402211208 970 dbSNP
rs1157978663 974 dbSNP
rs1455369001 979 dbSNP
rs1045383940 982 dbSNP
rs905553462 986 dbSNP
rs141017982 987 dbSNP
rs999786173 988 dbSNP
rs767915632 991 dbSNP
rs1186000820 997 dbSNP
rs1031387394 1000 dbSNP
rs538676097 1002 dbSNP
rs1208176832 1012 dbSNP
rs1463765299 1027 dbSNP
rs1270216168 1032 dbSNP
rs1228831841 1034 dbSNP
rs577148614 1055 dbSNP
rs1014530975 1069 dbSNP
rs993969879 1076 dbSNP
rs1025497725 1095 dbSNP
rs886503240 1096 dbSNP
rs1319376620 1097 dbSNP
rs1432223019 1097 dbSNP
rs1437477036 1099 dbSNP
rs970270443 1107 dbSNP
rs1179858920 1116 dbSNP
rs1390387508 1127 dbSNP
rs1161992671 1129 dbSNP
rs1248559360 1135 dbSNP
rs1386405770 1137 dbSNP
rs980027550 1138 dbSNP
rs1447712017 1139 dbSNP
rs573636413 1140 dbSNP
rs1018935014 1149 dbSNP
rs952028193 1165 dbSNP
rs965108710 1168 dbSNP
rs558544342 1169 dbSNP
rs1431541896 1171 dbSNP
rs1168290743 1174 dbSNP
rs145113740 1176 dbSNP
rs555910965 1188 dbSNP
rs1033184908 1189 dbSNP
rs1325072193 1191 dbSNP
rs746221508 1193 dbSNP
rs191527206 1196 dbSNP
rs1347745123 1229 dbSNP
rs1439588565 1234 dbSNP
rs1322063487 1244 dbSNP
rs922143115 1247 dbSNP
rs1366791631 1254 dbSNP
rs988915005 1263 dbSNP
rs1427942696 1274 dbSNP
rs575963628 1275 dbSNP
rs1300611132 1277 dbSNP
rs576852589 1286 dbSNP
rs949816122 1292 dbSNP
rs1252279035 1305 dbSNP
rs183829192 1307 dbSNP
rs1194403771 1308 dbSNP
rs926975055 1310 dbSNP
rs1052771446 1323 dbSNP
rs1292347411 1333 dbSNP
rs891560903 1348 dbSNP
rs767326669 1349 dbSNP
rs1273864879 1365 dbSNP
rs867188081 1371 dbSNP
rs867549238 1372 dbSNP
rs936949419 1380 dbSNP
rs1038047407 1382 dbSNP
rs1273168194 1391 dbSNP
rs1024445558 1395 dbSNP
rs898388742 1412 dbSNP
rs1276233600 1414 dbSNP
rs558644399 1415 dbSNP
rs1046876848 1419 dbSNP
rs890984041 1420 dbSNP
rs1451272865 1421 dbSNP
rs1193752890 1424 dbSNP
rs1372939566 1425 dbSNP
rs1171267076 1426 dbSNP
rs1413956524 1429 dbSNP
rs1423350796 1430 dbSNP
rs578219254 1431 dbSNP
rs540877451 1442 dbSNP
rs1250727370 1459 dbSNP
rs542540582 1460 dbSNP
rs529594201 1462 dbSNP
rs983480557 1469 dbSNP
rs1208881976 1477 dbSNP
rs1032992427 1479 dbSNP
rs1309887149 1486 dbSNP
rs1280337561 1487 dbSNP
rs751313015 1496 dbSNP
rs543285260 1500 dbSNP
rs562766661 1501 dbSNP
rs1460591565 1504 dbSNP
rs1376222010 1514 dbSNP
rs1299194425 1524 dbSNP
rs772920822 1526 dbSNP
rs1323324062 1545 dbSNP
rs1336413525 1546 dbSNP
rs1366678278 1559 dbSNP
rs1411506240 1574 dbSNP
rs11547796 1575 dbSNP
rs976207743 1593 dbSNP
rs1296970234 1594 dbSNP
rs1181174079 1595 dbSNP
rs768734475 1596 dbSNP
rs1225765332 1598 dbSNP
rs932156731 1614 dbSNP
rs1203743554 1631 dbSNP
rs1286315751 1632 dbSNP
rs769691617 1633 dbSNP
rs1265821566 1637 dbSNP
rs78432885 1641 dbSNP
rs1213241954 1642 dbSNP
rs866270526 1647 dbSNP
rs925564953 1655 dbSNP
rs188381923 1658 dbSNP
rs1053090054 1677 dbSNP
rs565894483 1678 dbSNP
rs973712219 1684 dbSNP
rs1014302394 1688 dbSNP
rs1388242534 1690 dbSNP
rs1261015967 1704 dbSNP
rs1318733389 1704 dbSNP
rs919618003 1713 dbSNP
rs1345500404 1714 dbSNP
rs1045487746 1716 dbSNP
rs146875174 1720 dbSNP
rs1415832799 1733 dbSNP
rs1183716778 1735 dbSNP
rs1448295095 1740 dbSNP
rs1245847579 1744 dbSNP
rs1418224173 1746 dbSNP
rs929867160 1748 dbSNP
rs547222545 1756 dbSNP
rs1261739518 1763 dbSNP
rs1474688178 1765 dbSNP
rs1224084853 1789 dbSNP
rs1047457020 1791 dbSNP
rs1320485062 1793 dbSNP
rs771173338 1800 dbSNP
rs1246834081 1801 dbSNP
rs567097782 1805 dbSNP
rs943830460 1806 dbSNP
rs1384081823 1810 dbSNP
rs1362910054 1812 dbSNP
rs866923987 1817 dbSNP
rs1390345505 1823 dbSNP
rs1456174563 1828 dbSNP
rs1039546807 1839 dbSNP
rs900571126 1840 dbSNP
rs1428543812 1841 dbSNP
rs761995240 1843 dbSNP
rs996239744 1844 dbSNP
rs887718461 1848 dbSNP
rs1054371766 1850 dbSNP
rs1428818179 1851 dbSNP
rs1266194787 1852 dbSNP
rs1045351 1859 dbSNP
rs1191030499 1866 dbSNP
rs1015227658 1880 dbSNP
rs372956837 1883 dbSNP
rs1384953092 1886 dbSNP
rs78596184 1891 dbSNP
rs1272647280 1900 dbSNP
rs2144133 1913 dbSNP
rs1356451684 1922 dbSNP
rs1020914114 1930 dbSNP
rs1308349750 1932 dbSNP
rs1232937369 1935 dbSNP
rs971678450 1938 dbSNP
rs373890448 1952 dbSNP
rs762666398 1963 dbSNP
rs1239931536 1965 dbSNP
rs1368625933 1973 dbSNP
rs1169185859 1997 dbSNP
rs958428451 2011 dbSNP
rs1376739190 2018 dbSNP
rs925471647 2026 dbSNP
rs935471119 2027 dbSNP
rs973849350 2032 dbSNP
rs1200588943 2033 dbSNP
rs538580346 2036 dbSNP
rs988417374 2042 dbSNP
rs558583512 2046 dbSNP
rs918123912 2067 dbSNP
rs1197650398 2079 dbSNP
rs1480975398 2094 dbSNP
rs919585578 2104 dbSNP
rs1231263988 2106 dbSNP
rs1325908673 2117 dbSNP
rs1258001909 2123 dbSNP
rs1227522753 2143 dbSNP
rs1045802058 2144 dbSNP
rs905640455 2145 dbSNP
rs951066683 2152 dbSNP
rs1400794566 2154 dbSNP
rs192828813 2155 dbSNP
rs1470786305 2156 dbSNP
rs1185501775 2158 dbSNP
rs1177659585 2161 dbSNP
rs182573330 2162 dbSNP
rs1362598062 2166 dbSNP
rs1184513271 2170 dbSNP
rs772547275 2172 dbSNP
rs1255627960 2174 dbSNP
rs1419294525 2179 dbSNP
rs532748881 2187 dbSNP
rs887623867 2190 dbSNP
rs1263966244 2191 dbSNP
rs1005091364 2192 dbSNP
rs1014847697 2196 dbSNP
rs186552959 2200 dbSNP
rs921124406 2211 dbSNP
rs997563295 2212 dbSNP
rs932059266 2224 dbSNP
rs1376564806 2240 dbSNP
rs1414608332 2243 dbSNP
rs1054507840 2246 dbSNP
rs1311430505 2247 dbSNP
rs775685103 2250 dbSNP
rs893223375 2253 dbSNP
rs377736146 2258 dbSNP
rs1010617335 2260 dbSNP
rs1032352582 2274 dbSNP
rs574151131 2280 dbSNP
rs1392114396 2283 dbSNP
rs111900805 2289 dbSNP
rs117836221 2305 dbSNP
rs1188091907 2309 dbSNP
rs1445083622 2331 dbSNP
rs949655850 2336 dbSNP
rs75782152 2339 dbSNP
rs145625619 2341 dbSNP
rs1263550967 2355 dbSNP
rs138168173 2364 dbSNP
rs1382797398 2369 dbSNP
rs1253617680 2372 dbSNP
rs1296430446 2373 dbSNP
rs150147153 2375 dbSNP
rs1327825294 2376 dbSNP
rs527805631 2380 dbSNP
rs1320737734 2390 dbSNP
rs1048850869 2393 dbSNP
rs1390675007 2394 dbSNP
rs767343509 2402 dbSNP
rs1026696866 2408 dbSNP
rs951171187 2416 dbSNP
rs887487950 2428 dbSNP
rs149566255 2429 dbSNP
rs1247846995 2435 dbSNP
rs370912137 2436 dbSNP
rs1019300298 2438 dbSNP
rs75890949 2450 dbSNP
rs1385881619 2452 dbSNP
rs74748390 2456 dbSNP
rs965660906 2457 dbSNP
rs765958649 2459 dbSNP
rs1187994057 2464 dbSNP
rs1474589417 2465 dbSNP
rs567138987 2466 dbSNP
rs921093343 2472 dbSNP
rs1193698635 2474 dbSNP
rs901790202 2476 dbSNP
rs936466962 2477 dbSNP
rs997858255 2477 dbSNP
rs1224550535 2481 dbSNP
rs1360048673 2481 dbSNP
rs529855801 2491 dbSNP
rs529112463 2493 dbSNP
rs914626894 2510 dbSNP
rs889122183 2514 dbSNP
rs1270364360 2519 dbSNP
rs1431969616 2522 dbSNP
rs1330819548 2528 dbSNP
rs1172172098 2544 dbSNP
rs143266153 2556 dbSNP
rs1407363657 2557 dbSNP
rs569979762 2559 dbSNP
rs76686777 2560 dbSNP
rs1009766201 2563 dbSNP
rs1025545871 2566 dbSNP
rs1443270106 2567 dbSNP
rs938925867 2569 dbSNP
rs1304245887 2570 dbSNP
rs1427009587 2572 dbSNP
rs1201310722 2575 dbSNP
rs1056099577 2583 dbSNP
rs894733377 2597 dbSNP
rs1201850255 2599 dbSNP
rs1439003389 2602 dbSNP
rs558620208 2604 dbSNP
rs549023018 2612 dbSNP
rs1307823077 2614 dbSNP
rs1203522682 2619 dbSNP
rs1249313924 2622 dbSNP
rs1469525966 2627 dbSNP
rs868160009 2628 dbSNP
rs1307912313 2630 dbSNP
rs1440114592 2633 dbSNP
rs1356290645 2636 dbSNP
rs2144134 2639 dbSNP
rs984454581 2641 dbSNP
rs1427419486 2643 dbSNP
rs1178385024 2648 dbSNP
rs1019689469 2652 dbSNP
rs1480612192 2655 dbSNP
rs534546050 2677 dbSNP
rs1470887917 2681 dbSNP
rs1192253094 2691 dbSNP
rs940424511 2694 dbSNP
rs975049867 2697 dbSNP
rs1170172303 2701 dbSNP
rs1353044943 2707 dbSNP
rs370693774 2713 dbSNP
rs1326675157 2714 dbSNP
rs756072066 2715 dbSNP
rs1376157385 2721 dbSNP
rs1280250935 2722 dbSNP
rs1438659416 2723 dbSNP
rs923107902 2725 dbSNP
rs1338898440 2733 dbSNP
rs752142052 2737 dbSNP
rs1387562833 2739 dbSNP
rs1156655474 2740 dbSNP
rs1402445701 2747 dbSNP
rs1408588838 2750 dbSNP
rs777647999 2755 dbSNP
rs889029252 2757 dbSNP
rs1213837886 2760 dbSNP
rs1244633525 2762 dbSNP
rs191390783 2765 dbSNP
rs1053701048 2768 dbSNP
rs913761494 2769 dbSNP
rs1260572370 2774 dbSNP
rs892574718 2794 dbSNP
rs1319303362 2795 dbSNP
rs1285512475 2807 dbSNP
rs1336499684 2809 dbSNP
rs574163160 2810 dbSNP
rs1245376309 2812 dbSNP
rs1380589747 2819 dbSNP
rs1272016320 2834 dbSNP
rs1010084214 2838 dbSNP
rs536810427 2839 dbSNP
rs1217281332 2847 dbSNP
rs531771704 2853 dbSNP
rs778847282 2854 dbSNP
rs1476024767 2856 dbSNP
rs746140201 2859 dbSNP
rs1432614691 2866 dbSNP
rs772160881 2869 dbSNP
rs576705409 2872 dbSNP
rs1055813358 2873 dbSNP
rs6134802 2875 dbSNP
rs1417738243 2876 dbSNP
rs1033972876 2880 dbSNP
rs1422225641 2882 dbSNP
rs894701208 2890 dbSNP
rs1476321052 2891 dbSNP
rs141255250 2893 dbSNP
rs1487030686 2894 dbSNP
rs1243203437 2901 dbSNP
rs184644821 2902 dbSNP
rs1357908951 2907 dbSNP
rs1459990883 2909 dbSNP
rs1320358559 2911 dbSNP
rs908855216 2918 dbSNP
rs1345789494 2919 dbSNP
rs1293642790 2920 dbSNP
rs887317618 2925 dbSNP
rs1004365862 2938 dbSNP
rs1302285863 2954 dbSNP
rs923004448 2969 dbSNP
rs572072204 2977 dbSNP
rs541136443 2978 dbSNP
rs1040760060 2982 dbSNP
rs1371014402 2983 dbSNP
rs1357077588 2985 dbSNP
rs1233558772 2994 dbSNP
rs1050210473 3021 dbSNP
rs1199144593 3024 dbSNP
rs900925541 3030 dbSNP
rs1490015053 3035 dbSNP
rs1271657770 3037 dbSNP
rs996438186 3038 dbSNP
rs1332199972 3042 dbSNP
rs1027961783 3048 dbSNP
rs1229960021 3050 dbSNP
rs190794075 3053 dbSNP
rs1225036112 3055 dbSNP
rs1221440570 3061 dbSNP
rs1347344489 3067 dbSNP
rs957928749 3070 dbSNP
rs1053607658 3072 dbSNP
rs892476315 3075 dbSNP
rs1393620698 3089 dbSNP
rs1299372019 3093 dbSNP
rs530133807 3094 dbSNP
rs1404864816 3096 dbSNP
rs550353765 3115 dbSNP
rs1176225910 3120 dbSNP
rs1215636647 3127 dbSNP
rs1432126516 3139 dbSNP
rs1011004340 3142 dbSNP
rs547855920 3151 dbSNP
rs549988344 3152 dbSNP
rs1021201906 3169 dbSNP
rs1261515883 3178 dbSNP
rs1248587626 3180 dbSNP
rs6041932 3190 dbSNP
rs1481108575 3209 dbSNP
rs74848972 3213 dbSNP
rs1201567335 3215 dbSNP
rs6109736 3216 dbSNP
rs960126337 3218 dbSNP
rs1471932855 3222 dbSNP
rs1333904241 3235 dbSNP
rs1308567719 3238 dbSNP
rs1391443977 3242 dbSNP
rs1381616597 3254 dbSNP
rs991465377 3256 dbSNP
rs1334244347 3262 dbSNP
rs1468574408 3266 dbSNP
rs769287356 3273 dbSNP
rs888726896 3274 dbSNP
rs1400067792 3284 dbSNP
rs1005827889 3291 dbSNP
rs1440350758 3292 dbSNP
rs6041933 3293 dbSNP
rs1181915779 3301 dbSNP
rs1204298006 3302 dbSNP
rs1263601655 3302 dbSNP
rs1462815493 3302 dbSNP
rs1348517328 3306 dbSNP
rs111351596 3314 dbSNP
rs1335328725 3314 dbSNP
rs1381957798 3314 dbSNP
rs1383474594 3314 dbSNP
rs1454305111 3314 dbSNP
rs368000096 3314 dbSNP
rs55633710 3314 dbSNP
rs571910378 3314 dbSNP
rs978348424 3314 dbSNP
rs199597185 3316 dbSNP
rs200812597 3317 dbSNP
rs11698269 3318 dbSNP
rs1312041968 3319 dbSNP
rs1353184336 3320 dbSNP
rs139744244 3323 dbSNP
rs1238254479 3326 dbSNP
rs796982354 3327 dbSNP
rs1192217452 3330 dbSNP
rs1444997624 3330 dbSNP
rs1217183070 3331 dbSNP
rs1263802366 3331 dbSNP
rs1358611583 3332 dbSNP
rs1279650013 3333 dbSNP
rs1289049239 3338 dbSNP
rs1247520659 3340 dbSNP
rs985128907 3345 dbSNP
rs185098896 3348 dbSNP
rs1284568769 3351 dbSNP
rs1350669566 3352 dbSNP
rs1212135587 3354 dbSNP
rs1030535998 3360 dbSNP
rs954444341 3367 dbSNP
rs1301435845 3369 dbSNP
rs908788383 3370 dbSNP
rs1184193376 3386 dbSNP
rs3747936 3387 dbSNP
rs1383514581 3388 dbSNP
rs752751321 3391 dbSNP
rs1374630041 3392 dbSNP
rs1194073198 3398 dbSNP
rs1490184001 3400 dbSNP
rs1469730125 3409 dbSNP
rs1176840931 3410 dbSNP
rs940168557 3411 dbSNP
rs1041621160 3412 dbSNP
rs536740180 3413 dbSNP
rs936484920 3420 dbSNP
rs996573887 3425 dbSNP
rs1399726814 3427 dbSNP
rs1049373166 3431 dbSNP
rs989805870 3435 dbSNP
rs1350490452 3437 dbSNP
rs1329170685 3440 dbSNP
rs1328239247 3446 dbSNP
rs1408468088 3453 dbSNP
rs556742172 3464 dbSNP
rs1010777254 3466 dbSNP
rs1171145683 3468 dbSNP
rs1020832470 3471 dbSNP
rs945402933 3474 dbSNP
rs967038307 3475 dbSNP
rs1478303647 3477 dbSNP
rs1231852431 3479 dbSNP
rs1046389960 3481 dbSNP
rs1003350029 3483 dbSNP
rs576529657 3484 dbSNP
rs1035283425 3498 dbSNP
rs888622024 3500 dbSNP
rs190027946 3502 dbSNP
rs1261837660 3504 dbSNP
rs1235588965 3506 dbSNP
rs960093634 3507 dbSNP
rs1280093981 3508 dbSNP
rs1368874802 3515 dbSNP
rs1005691114 3519 dbSNP
rs1440046564 3520 dbSNP
rs1337761363 3522 dbSNP
rs1016296276 3523 dbSNP
rs1469125034 3535 dbSNP
rs1343264857 3536 dbSNP
rs759285333 3537 dbSNP
rs1415038520 3541 dbSNP
rs767032044 3547 dbSNP
rs1274049111 3555 dbSNP
rs538960450 3556 dbSNP
rs1437457719 3564 dbSNP
rs984535869 3568 dbSNP
rs1459680475 3569 dbSNP
rs1254904304 3572 dbSNP
rs765481986 3576 dbSNP
rs1454669603 3584 dbSNP
rs752525062 3585 dbSNP
rs1212675081 3586 dbSNP
rs111873522 3596 dbSNP
rs1375826421 3597 dbSNP
rs1041198682 3599 dbSNP
rs572109919 3603 dbSNP
rs764034227 3606 dbSNP
rs541073406 3607 dbSNP
rs1049508292 3612 dbSNP
rs893562080 3613 dbSNP
rs957873488 3626 dbSNP
rs989320128 3642 dbSNP
rs753833164 3652 dbSNP
rs1380428700 3654 dbSNP
rs1162339326 3657 dbSNP
rs1442464216 3658 dbSNP
rs1386688619 3665 dbSNP
rs1183974477 3668 dbSNP
rs1483762308 3670 dbSNP
rs561116244 3671 dbSNP
rs1329835755 3673 dbSNP
rs1489540248 3674 dbSNP
rs1286917304 3678 dbSNP
rs902405203 3700 dbSNP
rs945293118 3702 dbSNP
rs574911785 3703 dbSNP
rs1315027946 3705 dbSNP
rs1228703944 3706 dbSNP
rs982548319 3715 dbSNP
rs1230163560 3718 dbSNP
rs79699498 3720 dbSNP
rs1338995244 3721 dbSNP
rs1196930887 3724 dbSNP
rs368700536 3737 dbSNP
rs1422148100 3745 dbSNP
rs779097114 3748 dbSNP
rs1386744699 3749 dbSNP
rs139448635 3752 dbSNP
rs1164980600 3755 dbSNP
rs371206033 3768 dbSNP
rs1427537367 3770 dbSNP
rs1468992835 3781 dbSNP
rs1055225416 3788 dbSNP
rs6078944 3808 dbSNP
rs1034848104 3816 dbSNP
rs181151155 3817 dbSNP
rs758678053 3826 dbSNP
rs1448660202 3831 dbSNP
rs1012089747 3832 dbSNP
rs185786152 3848 dbSNP
rs1489868663 3860 dbSNP
rs941566933 3865 dbSNP
rs952784303 3876 dbSNP
rs1372231761 3877 dbSNP
rs1476648704 3881 dbSNP
rs897429900 3902 dbSNP
rs528394957 3905 dbSNP
rs1293256920 3926 dbSNP
rs1220219222 3928 dbSNP
rs998461174 3935 dbSNP
rs1282519773 3941 dbSNP
rs780352725 3942 dbSNP
rs1051263646 3945 dbSNP
rs1293574988 3950 dbSNP
rs541297040 3954 dbSNP
rs1016032937 3957 dbSNP
rs1352390154 3974 dbSNP
rs961634836 3975 dbSNP
rs6041934 3976 dbSNP
rs781757855 3977 dbSNP
rs1425011801 3984 dbSNP
rs1199265681 3987 dbSNP
rs1460512859 3989 dbSNP
rs1479728768 3993 dbSNP
rs1269607971 4004 dbSNP
rs866383815 4008 dbSNP
rs181001866 4011 dbSNP
rs149667121 4019 dbSNP
rs1249774875 4021 dbSNP
rs1200344666 4027 dbSNP
rs1384358040 4029 dbSNP
rs1262256829 4030 dbSNP
rs550367618 4030 dbSNP
rs373676111 4040 dbSNP
rs538799420 4043 dbSNP
rs558721853 4044 dbSNP
rs1390254021 4045 dbSNP
rs577273031 4046 dbSNP
rs534970012 4052 dbSNP
rs537595238 4060 dbSNP
rs1217149129 4062 dbSNP
rs145490921 4073 dbSNP
rs1042039120 4074 dbSNP
rs1176122093 4083 dbSNP
rs1491183457 4084 dbSNP
rs577421472 4085 dbSNP
rs58768602 4085 dbSNP
rs747077638 4085 dbSNP
rs959396951 4085 dbSNP
rs990819123 4085 dbSNP
rs72464124 4086 dbSNP
rs1263690437 4087 dbSNP
rs1352768223 4095 dbSNP
rs1205596599 4104 dbSNP
rs902206384 4105 dbSNP
rs1242377277 4106 dbSNP
rs1201525246 4107 dbSNP
rs769933677 4109 dbSNP
rs3178070 4113 dbSNP
rs1052038 4115 dbSNP
rs749530291 4118 dbSNP
rs1237743075 4121 dbSNP
rs941441632 4125 dbSNP
rs1310784594 4133 dbSNP
rs1447111804 4137 dbSNP
rs1037495687 4139 dbSNP
rs398035380 4141 dbSNP
rs61391158 4141 dbSNP
rs918781082 4143 dbSNP
rs1404986264 4144 dbSNP
rs112671254 4146 dbSNP
rs1303890608 4155 dbSNP
rs1453652380 4160 dbSNP
rs1378591686 4163 dbSNP
rs1160531598 4165 dbSNP
rs367797847 4169 dbSNP
rs543913575 4170 dbSNP
rs370239796 4173 dbSNP
rs1012057565 4174 dbSNP
rs1027506089 4175 dbSNP
rs1256806398 4200 dbSNP
rs1204535531 4205 dbSNP
rs557136906 4219 dbSNP
rs1006076423 4228 dbSNP
rs1287621546 4234 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacagUGUGAGGu 5'
                        |||:||| 
Target 5' --------ugcagaACAUUCCa 3'
1 - 14
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000399002.2 | 3UTR | UGCAGAACAUUCCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.975 1.7e-15 0.927 1.0e-10 23 Click to see details
GSE17306 Multiple myeloma 0.248 4.3e-2 0.207 7.7e-2 49 Click to see details
GSE21849 B cell lymphoma 0.302 5.6e-2 0.413 1.3e-2 29 Click to see details
GSE28544 Breast cancer -0.272 9.9e-2 -0.280 9.3e-2 24 Click to see details
GSE38226 Liver fibrosis 0.285 1.1e-1 0.421 2.9e-2 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.247 1.2e-1 -0.285 8.4e-2 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.201 1.7e-1 -0.251 1.1e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.178 2.0e-1 0.185 1.9e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.147 2.1e-1 -0.103 2.9e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.156 3.1e-1 -0.137 3.3e-1 13 Click to see details
GSE27834 Pluripotent stem cells 0.119 3.3e-1 0.079 3.9e-1 16 Click to see details
GSE14794 Lymphoblastoid cells -0.046 3.3e-1 -0.023 4.1e-1 90 Click to see details
GSE17498 Multiple myeloma 0.068 3.4e-1 -0.085 3.0e-1 40 Click to see details
GSE21687 Ependynoma primary tumors -0.048 3.5e-1 0.107 2.0e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.06 4.6e-1 0.257 3.1e-1 6 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.016 4.7e-1 0.233 1.6e-1 20 Click to see details
GSE19350 CNS germ cell tumors 0.01 4.9e-1 0.122 3.5e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.574 0 0.123 0.2 49 Click to see details
STAD 0.698 0.03 0.881 0 8 Click to see details
ESCA 0.78 0.06 0.700 0.09 5 Click to see details
KIRP 0.506 0.08 0.700 0.02 9 Click to see details
THCA 0.675 0.11 0.700 0.09 5 Click to see details
CHOL -0.434 0.12 -0.467 0.1 9 Click to see details
KICH 0.28 0.25 0.214 0.31 8 Click to see details
HNSC -0.581 0.3 -0.500 0.33 3 Click to see details
KIRC 0.083 0.33 0.136 0.24 29 Click to see details
KIRC 0.083 0.33 0.136 0.24 29 Click to see details
KIRC 0.083 0.33 0.136 0.24 29 Click to see details
KIRC 0.083 0.33 0.136 0.24 29 Click to see details
KIRC 0.083 0.33 0.136 0.24 29 Click to see details
KIRC 0.083 0.33 0.136 0.24 29 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*