miRTarBase - #MIRT725403 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KIF6   
Synonyms C6orf102, dJ1043E3.1, dJ137F1.4, dJ188D3.1
Description kinesin family member 6
Transcript NM_145027   
Expression
Putative miRNA Targets on KIF6
3'UTR of KIF6
(miRNA target sites are highlighted)
>KIF6|NM_145027|3'UTR
   1 ATTTCCAGGAAATATCCATCCATGAATTATGCCAGCAAGAATGAAGCACAGATGAAGGCAGCGCCCCTCACTTGCTCTGG
  81 CTTCAGAAGTGAACTATGGGCTGCTGGGAGCAACTAGTGACTTTGATTCCCATGGAGGGGACTGTGTTTCTTTAAGGATG
 161 CTGACCTGGAGGCCACCGAGAGGCTGGGGCTGGGGCTGACCACAACATCCTTCCTGTGGTTGCTGGAGCTGCTGGCAGGG
 241 CCAGGCAAGGCCAGAGTGCTAGGGGCAGGGTGAAGGCTTCAGCTCACTGTTGTAGTGACGTTTTGTGTAGATCTTTATAA
 321 GCTTTTGAGAATGTGAAATAGCACCATCAAAATATAATGTCAGAGGATGCTCACACCAGTGGAATGTGGGGGGAATATTT
 401 TTATTTTTAACGATTTGCCAGCTCTCTCCCTTGGCCCGTGCTCTGGTTTGGAAGCCCAGAAATGGCCATGACAGGTCCAG
 481 GCAGGATGTCCCAGCCACAGGCAAGGCAGTGGAATGCAGGGCATCCTGAAGGCCAATCCTGATCTCCCAGACCACATCTT
 561 TCACCATCAGCCTCTTGGCCAGGATGACCTGGAGGCAGTGCCTGAACAGCTGTGTCTCCAGGGAGCCATCTGCCCTGCAG
 641 GGTCTAAGGACATCATAGCACCCAGAGAACAGTGGGCAGCTCCCAGGGGCTCTGCTGAGAGCTTGAGAGAGGGCAGTGTG
 721 GGTACCTTGGGCCTCACAACCTTCACCCAGCCACTTGGGAGGATTTGGGCTGACACTCCCCACTTCCACAGGGAAAAACA
 801 TAGCTGCCTGGGGGTCTTGTCTCCATGGGCCCTCTCCATGACAGATCCAAGGGAAGGTGGGCAGCCCTCAAGGAGGTTCT
 881 TGAAGAACTGCCCCCTGGGCCAGGGGGTTCCAACCCAGCTGCAGCCAGGGAGGGGCAGCGGAGGGTGAGCAGGAGTGGCA
 961 CCTGGAAATGAAGCTAACTGGATAAAAGTGCTGGTCCACTGCTCCTGGTGTCTCTGTCCTATAAATACAGGACCTGATGA
1041 CCCTGGAGGGGAGCAGAGTGGTAATATAGTATAATTGGCTTGATTTTCTTTTTCGTTTTTTAGGACTGGGTAACAGGATC
1121 ATGCAGGAGAAGATTAAACCATTACATTTCTAAGCTAGGCAGGCCCATCGAGCTCCTCTAATCCACACCCCTATTTTATA
1201 TAATTAGAAGGCCAGAGTGAAGGGGAGATTCAGCTTGCTGTTCTATGCCACTGACAAATGTCCCCTCTTCAGGGGGCTTC
1281 CCCTGACCACTCCATCTCGAGTCACCCCCTAGTTATCCCCTATCCCATTACCATTTTTTCTGCATCACTATCTGACATGT
1361 TATCCTTCCGAACTTGCCTATTTTTGAAATACCTGCAACCCCCCATAATACTAAGAGCTCCAATGCAACAGGGACCTGTT
1441 TGTCTTGCTCATTGCTGTGTCCCAAGCACAGAGTCGCTGTTCAGTAAACGGTCCTTCAGTTCATGAGTAGACGAGCCAGA
1521 ACCCAGATGTGTTTCTCAGGCTGGTGTCACTCTGACTTCCCCCAGGCTCTGACTGAATCCCATCGGGACAGGGGCCAGCA
1601 TCTCTGGTCCACTCCTGGCCCTCACAGTTCAATGGAACATAGTAAGCCCTCTGTAAAGTCTGTAGAACCAGAGGAAGACC
1681 AAATTCTGATTCTAGAAGCCTCCCCAAGAGTCCATGGAACACACATGTAACTGCACACACACACACACATACACACACAC
1761 ACTCTCAAGAGCCCTGAAGATGGCATGGCATTTGCCCCAGTCCCCTATGTAGCAGCAGCAGTATTCTTGGCATGCCTTAG
1841 TGCCCTCAGCCCTCTAGAGCTGGGTAGAGTCTACTAACTTTTATTTTCTTTTATTTTTACTTTCTTTTATTTATTTTTTG
1921 AGATGGGGGGGGTCTCTGTCAGCCAGGCTGGGGTGCAGTGGTGCGACCATACCTCACTAGTCAGCCTCCAACTCCTGGGC
2001 TCAAGCCATACTCAGCCTCCAACTCCTGGGCTCAAGCGATCCTCTCACCTCAGCCTCCAAAGTAGCTGGAACTACAGGCA
2081 TGCACCACCACACCTAGCTCGTTTTAAATTTTTTGTAGAGACAGGGTCTCACTGTGTGGCTCAGGATGGTCTCAAATTCC
2161 TGGCCTTAAGCGATGCTCCCGCCTTGGCCTCCCAAAGTGCTGGGATTGCAGGCATGAGCCACATACCCTGCCAGAGTCTT
2241 TCAACATTAGATCTCCCACTGAGACATCATCTCCTGGATCCAAAGGCCTTACTGACAGAGATGTGTGGCATGGCCCCATG
2321 CGGGGTGTGAACCAGCCTCCTGGGGCAATCACTAAGACAGGAAAGGAAATGAAGACAGAAAAACACACAACATGGGATCT
2401 GGGGCCACTGGTGTCCAGAGCATATGCAAAGTGTGTGCAGCAACTGGCCAAGGGGCCTTTTGCTCCGAACATCCCCTAAT
2481 GGAAGCCCAGCCTTTGATATGGACACATGCTTGACAGCAGTGCACCTTCCCAGAGTTCACTGGCCTCTGCAAATGGGAGA
2561 AATTGATGCAATGTTTTGAAAAGACTTTCCAGCAATCCACCTGGGATCAGTGGAGCCACGGATGACAAGAAGTATCTGAG
2641 TTCACTCTAGGCCAAAATGTGGGATTTTCAAAAACATTTTCTGGAAAGCAGCCTAGCCAGTGACTCCAGCCCAGTCCCTG
2721 CTAGAATTCAACTGGCTCTACCAATCCCTTGACAAGAAGTAGGGTGGACGGAGGTTGGAGGAGGGAAGTTAAAATGTAGC
2801 TTGCCCAGATCTTGCTAAAAAGGAGTTTTAGAAAGCAGATAGAGAAATTGTGGTATACTGAATACATCATTTTAATTCTT
2881 CACCACCAGTATAGAATTACACATCCAAAGCTTTGTCATGGCCCACTTTGACTAATGTGGTGTTGGCAAACCTGATCCAG
2961 GCAGAGGCTTGAATTGTGCTCTCATGGTTGAGCTTGCCTCTTGCTCCAGTGATCTCTCTTGGGATGAACATGCCATGGGT
3041 AGCTGCTGCCCCTTCAGCCTGGAACATCCAGAGAGCAGACCTGAGCCCAGTCTACAGCCTGGAGCAGAGCCTCCCAGGCA
3121 AGCCCAGCCCAGATCAGCTGAACTATGGCTCACCCAAAGACCTATTGGCATGAGAATATATGCTGCTTGTCATAAACCAC
3201 TGAGGTTTAGAGTGGTTTGTTATATAGCATTAATTGTAGCAATAGCAGACTGGCACAGAAATTGGAACCCAGAGACAGTA
3281 TATGACTGGATCTAGGATTTCTCAGTGCAGAGTTCATTGTCTCTCCATGCAGCCTGTGGAAAGGCACTGAGAGCATCCTG
3361 TATATGGAAAAGCAGGACCACCACCTACAGCCATGATGAAGCAACAAGGACCTGATTTACCCTCCTGCTTTAAATGACTA
3441 AAAATGAGACAAAATCCTCTATACAAACCAATGGTTTTCAGCCATTGGATAACAAGCAATATAGGGTATGATTGATCCGC
3521 AAGAGAAGGGAAACAAGTGAGGGGAGCCCTATGATTGCTCCAACTTACTGCCTGCAGTGAGTTTTCAGGCTGCAGCCCAG
3601 GAAGGGGGAACCAGGTAGAGCCCAGTGGTTTCCCTGAGTTGAGGAAATGGAGCTGGGAATCCAGGGAGGACAAAGTGGCT
3681 TAAATTTGCAAGGCAGAGTCCCAGGGATGAGAGAGAGAGAAGGAGAGAGAGAGGAGAAAAAAGAGAGAGAAAGAGAGAGA
3761 GCATGCTCTGGAGATCTTCAGAGGGTTACCCTTGAGTCTTCAGCTAACTACCGATCAACATCTGCATGTGAAGAAATTAC
3841 CCAAGGCAGGGGAAAGAACCACCAGGAGGAAGCAGGTGGAATAATTTCCTGAGATAACACTGTGTTGGGAAGAGTTCATG
3921 TTTCCAACAGCCAGAGTGGAGAAACCTCCCAAAACAGTCATTGTATAGAGACACATAAGGTACTGCCTCAGAAGTGGGGC
4001 CAAATTAGTCCTAGATGATAGATTGCTCTGGTCCCACCTAACAAAGCTTAAAAAGCCAGCCCCAAAGGAGTCAAATTGTT
4081 TCCAGTAAGTTTCCAAGTAACTTCAATGAGTCCCAAAACAAAGCTTCAAAATATCTAAAGGAATATGAAAAACAAACCAA
4161 AAAGAAACCAGCATCCAACAATATAGAATCCACAATGTCTGGTGTCCATTAAAAAATAATCAGGCATGCAAAGAAGCAGG
4241 AAAATATGGGCCATGAGAGGAGAAAAAACCATCAATAGAAATAGAGGCCGGGTGTGGTGGCTCACTCCTATAATCCCAGC
4321 ACTTTGGGAGGCCGAGGCAGGAGGATCACCTGAGGTCAGGAGTTCAAGAACAGCCTGTTCAACATGGGGAAACCCCGTCT
4401 CTACTAAAAATACAAAAAATAGCCGGGCATGGTGTTGCGTACCTGTAATCCCAGCTACTCAGAGGCTGAGGCAGGAGAAT
4481 TGCTTGAGCCCAGGAGGCAGAGGTTACAGTGAGCCGAAATTGTGCCATTGCACTCCAGCTTGGGCAACAAGAGTGAAACT
4561 CTGTCTCAAAAAAAAAAAAAAGAAAAAACAAATAGAAACAGCCCCAGGCATGGCACAGTTGATAGAGTAAATAGACAGAA
4641 ACATTTTTTAAAATGCAATGGGTGTGTGTTTCAAATCTAGGCAGAAAAAATGCTCCTTGTAATTCCTTAAACATAAGCAT
4721 GTCTCATTCATCTGGTCATTGTTTTGACAAGGATGTGCCATCCATTGTGCTAAGTTCTGAGGAGTCAGAGGTGACAGAGA
4801 CAGAGAAAGTGCCAGCATTCTTGGAACCTTCTAACGAAGGAGAGGGACAAGCCAGGCATGGTGGCTCACGCCTGTAATCC
4881 CAACACTTTGGGAGACTGAGGCTGGCGGATCACGAGGTCAGGAGTTTGAGACCAACCTGGCCAACATGGCGAAACCCCAT
4961 CGCTACTAAAAATACAAAAATTAGCTGGGTGTGGTGGTGCGCACCTGTAATCCCAGCTACTCTGGAGGCTGAGGCAGGAC
5041 AATCACTTGAACCCTGGAGGCAGAGTTTGCAGTGAGCTGAGATCGTGCCACTGCACTCCAACCTGGGCAACAAGAGCGAG
5121 ACTCCTTCTCTGAAAAAAAAAAAAAGAGAGGGACAATAAACAAGTAAGCAAGACAATCTGATTAAGAAGGAGTTGGGGTT
5201 AGCTGGGCATGGTAGCAAGCGCCTGTAGTCTCAGCTACTCGGGAGGCTGAGGTGGGAGGATCCTTGAACCCAGGAGGTTA
5281 AGGCTGCAGTGAGCTGTGATCACACCACTGCACTCCAGCCTGGATGACAGAGCAAGACCCTGTCTCAGAAAAAGAAGAAG
5361 GAGTTGGGGGTGGGGTAGGATGGGCTTGGACTCACTATCAAGGTGGGTGGGAGTGTGAGAACCCGGCAAGGTGCAAAGAG
5441 AGAAGCAGGGAAGGGAAGCTTAGGACAATGATGGCAGGTTGGGTATTGGGTGATGGGAAGAGGCAAAGGACGTGGAGCTT
5521 GGCAAAAAGGGGACTTGTGGGGATTTGGGCCATGTGAGCATGTGGGGGAGACAGTGTTCCTTCCATAACACGTGTCCAGG
5601 GACTGCCAGGGCTCCGAGGCAGAGCAGGTGTAGAGAGGTTGGCTGTGAATGTTGGATGTTGAAAACATATGTGTCAAATG
5681 TGGGAGGAAAAAGCAGTGTTTCCTTGAATACAAGCTCCTCCTCACCTTGCGAAAAGTGGCCTCTGAGTGTAGCCCTGAAT
5761 GCATCTCCCAAGGAATAGGAGGAAGCAGCAACCTTTTCAGAGTTAACTGCTTTATTTGGGTTTTCCATGGCCTCGTGCCA
5841 GCCAGCAGGGCTGAGCCAGTTTCACCCACACTGAGAGGGAACTCAGCAAAGAGCAAGCAGCATGCCAGCTGGTACTCTTC
5921 CCTCTCCATTCACTCAGCTCCTGATCTCAGGAGGGCAGCCCCTCCCCAGGCCAGCACCCCTCCCCTTCTGGCCCCAGGTG
6001 TGGGATGTTGTTGTTTTCTTTTCTCCGAAACATCTCCTGGGTTTGTCTTTTCCATCACTGTCTTTAGACTGAGGCAAGCA
6081 GTCCCCATGCCTTCAGCCCCATGTTTTGGGGGTAACCTGTGCTTTGACATGCTTTGCTAAAAACTTTCTAAGTCTCCCTC
6161 TGGTGCTGGGACCAGCCATGACCAACAACGTCATCCATGCAGGCCACCCCTAACATAGTCCAGGCCTCATGTGGGTCTCA
6241 GTTCCCTTTTCTTCTTTCAGGAAGTTCTCCAGTGCATGCATAGGGTTGACCAGATGTCCCAAGGTGCTCTAGGACTTATG
6321 CCTATGAAGCTGTTTTAGGGCTTCCTAGTCAGTCCCTGGTTCCAGGAAAGCAGCCTGATGAGGAGATCATTCCCGCTGGC
6401 TGGTGTGGCATTTCTTTTATGGCACTACCTGGGATTGGGCCACCAGACCTGCGCTAACATGCTGATTTGATGGACTCTTA
6481 ACATCATAGGACAAAGAATCGTCATGTGAACCAATTAGACAATAAACAAATGCCTAAGTGCC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugugguAAC---AGUGUGAGGu 5'
                   |||   | ||||||| 
Target 5' tgggaggatTTGGGCTGACACTCCc 3'
756 - 780 145.00 -10.90
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' atcACACCACT---GCACTCCa 3'
5299 - 5317 144.00 -18.50
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :::|||||   :|||||| 
Target 5' attGTGCCATT---GCACTCCa 3'
4519 - 4537 140.00 -17.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30114149 3 COSMIC
COSN31511229 8 COSMIC
COSN30491363 9 COSMIC
COSN31491871 15 COSMIC
COSN30108238 19 COSMIC
COSN31552715 20 COSMIC
COSN30180441 24 COSMIC
COSN31497527 33 COSMIC
COSN30507596 49 COSMIC
COSN30496473 63 COSMIC
COSN30447991 65 COSMIC
COSN30157601 91 COSMIC
COSN18731415 93 COSMIC
COSN30502400 96 COSMIC
COSN31483990 107 COSMIC
COSN31611830 110 COSMIC
COSN31605432 115 COSMIC
COSN30525238 135 COSMIC
COSN30525222 136 COSMIC
COSN30101552 140 COSMIC
COSN30134881 150 COSMIC
COSN6320181 317 COSMIC
COSN20217578 411 COSMIC
COSN16917154 501 COSMIC
COSN5858713 831 COSMIC
COSN28201834 943 COSMIC
COSN21263184 1095 COSMIC
COSN2161452 1468 COSMIC
COSN9782449 1704 COSMIC
COSN19402669 1925 COSMIC
COSN25684492 3105 COSMIC
COSN2161451 3256 COSMIC
COSN9312338 3258 COSMIC
COSN9312337 3262 COSMIC
COSN21148884 3303 COSMIC
COSN19281726 3509 COSMIC
COSN32065654 3757 COSMIC
COSN2161450 3848 COSMIC
COSN22181196 3886 COSMIC
COSN32065653 4178 COSMIC
COSN4927697 4279 COSMIC
COSN19393414 4413 COSMIC
COSN29313337 4422 COSMIC
COSN19359988 5012 COSMIC
COSN21847066 5060 COSMIC
COSN9782448 5144 COSMIC
COSN24367078 5184 COSMIC
COSN24035082 5289 COSMIC
COSN9782447 5574 COSMIC
COSN4625191 5667 COSMIC
COSN25148923 6075 COSMIC
COSN28202180 6119 COSMIC
COSN19305160 6209 COSMIC
COSN2161449 6394 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1339546731 8 dbSNP
rs776989498 10 dbSNP
rs975500912 15 dbSNP
rs964080768 18 dbSNP
rs766537075 21 dbSNP
rs549521015 22 dbSNP
rs1340722513 29 dbSNP
rs768527931 30 dbSNP
rs1427293635 40 dbSNP
rs773771305 42 dbSNP
rs772417796 45 dbSNP
rs748532146 46 dbSNP
rs1210304466 51 dbSNP
rs529251571 62 dbSNP
rs368284457 63 dbSNP
rs1195901164 66 dbSNP
rs986756966 71 dbSNP
rs1184043328 74 dbSNP
rs1474723786 75 dbSNP
rs1262511410 78 dbSNP
rs16891957 96 dbSNP
rs3734621 97 dbSNP
rs145320572 101 dbSNP
rs993399014 109 dbSNP
rs1007391113 118 dbSNP
rs888916552 119 dbSNP
rs899021915 120 dbSNP
rs1289943848 128 dbSNP
rs1016079883 129 dbSNP
rs879262827 132 dbSNP
rs533456636 137 dbSNP
rs946600523 139 dbSNP
rs1229914660 147 dbSNP
rs1357124656 153 dbSNP
rs139767998 160 dbSNP
rs949033693 163 dbSNP
rs1485591348 165 dbSNP
rs1203529367 170 dbSNP
rs1258526146 172 dbSNP
rs544385537 177 dbSNP
rs1052849403 178 dbSNP
rs939409545 182 dbSNP
rs928046812 183 dbSNP
rs980789877 191 dbSNP
rs1442046808 192 dbSNP
rs969448703 193 dbSNP
rs1053132362 199 dbSNP
rs72858477 205 dbSNP
rs925467420 208 dbSNP
rs1403871504 212 dbSNP
rs1396268912 228 dbSNP
rs996958602 232 dbSNP
rs942823388 244 dbSNP
rs1242156602 255 dbSNP
rs1300825375 259 dbSNP
rs561420897 265 dbSNP
rs1457106994 287 dbSNP
rs912655948 293 dbSNP
rs74659777 296 dbSNP
rs951705282 299 dbSNP
rs371244658 300 dbSNP
rs574698492 305 dbSNP
rs918582780 306 dbSNP
rs779931438 315 dbSNP
rs1194466375 316 dbSNP
rs1478883997 319 dbSNP
rs1266875264 325 dbSNP
rs1179723708 327 dbSNP
rs1190770530 330 dbSNP
rs1250432271 333 dbSNP
rs1488942616 336 dbSNP
rs1265770639 339 dbSNP
rs11756686 342 dbSNP
rs1315973148 343 dbSNP
rs1156248696 349 dbSNP
rs1378890128 357 dbSNP
rs1466169135 359 dbSNP
rs552690175 376 dbSNP
rs1018628218 378 dbSNP
rs1403517098 381 dbSNP
rs1007275135 382 dbSNP
rs1016137807 383 dbSNP
rs1331835342 386 dbSNP
rs745655730 388 dbSNP
rs1389628825 390 dbSNP
rs1298580908 394 dbSNP
rs1312853895 394 dbSNP
rs368168479 411 dbSNP
rs1010766646 412 dbSNP
rs892377789 416 dbSNP
rs1052399622 422 dbSNP
rs1295626937 423 dbSNP
rs534620298 424 dbSNP
rs116706958 430 dbSNP
rs3823213 438 dbSNP
rs1001564704 446 dbSNP
rs904099700 450 dbSNP
rs11758639 468 dbSNP
rs1487658118 489 dbSNP
rs1427236071 491 dbSNP
rs73731795 495 dbSNP
rs1433955938 500 dbSNP
rs10947807 501 dbSNP
rs1051139381 515 dbSNP
rs1460344795 516 dbSNP
rs984677146 522 dbSNP
rs930198902 530 dbSNP
rs1368293612 533 dbSNP
rs918825697 536 dbSNP
rs1404411037 538 dbSNP
rs930058229 544 dbSNP
rs6904582 553 dbSNP
rs1219509616 562 dbSNP
rs1272655809 570 dbSNP
rs1237351558 571 dbSNP
rs1224312967 574 dbSNP
rs974092738 586 dbSNP
rs962997285 589 dbSNP
rs550786134 607 dbSNP
rs909130869 618 dbSNP
rs546669368 619 dbSNP
rs1418460783 625 dbSNP
rs1426506919 627 dbSNP
rs1231950492 628 dbSNP
rs1366083082 632 dbSNP
rs1312393899 636 dbSNP
rs965620827 638 dbSNP
rs1423997510 642 dbSNP
rs1362540293 643 dbSNP
rs117842239 665 dbSNP
rs564418655 668 dbSNP
rs550887864 673 dbSNP
rs1313458535 685 dbSNP
rs1013779256 690 dbSNP
rs956482009 698 dbSNP
rs985805701 702 dbSNP
rs1244462343 707 dbSNP
rs9462531 714 dbSNP
rs1449607455 724 dbSNP
rs1215962156 725 dbSNP
rs561957643 729 dbSNP
rs1484714495 733 dbSNP
rs1183361735 736 dbSNP
rs1172048839 741 dbSNP
rs1466674156 744 dbSNP
rs1265157391 745 dbSNP
rs1011151132 746 dbSNP
rs1379446770 759 dbSNP
rs1382156258 769 dbSNP
rs1401353283 776 dbSNP
rs1317769377 779 dbSNP
rs903491658 781 dbSNP
rs1450491287 793 dbSNP
rs1303751529 799 dbSNP
rs1157114535 803 dbSNP
rs541863984 807 dbSNP
rs892266952 809 dbSNP
rs1031256796 811 dbSNP
rs1007067844 814 dbSNP
rs1355135161 825 dbSNP
rs1223826824 827 dbSNP
rs1283007314 828 dbSNP
rs1314718089 830 dbSNP
rs1003392156 835 dbSNP
rs1243462225 847 dbSNP
rs1459015690 848 dbSNP
rs1460692161 854 dbSNP
rs1181594472 855 dbSNP
rs891317663 861 dbSNP
rs1470499385 864 dbSNP
rs1199386474 866 dbSNP
rs906474475 876 dbSNP
rs1045031453 882 dbSNP
rs1416318221 888 dbSNP
rs1177439236 889 dbSNP
rs1405704104 890 dbSNP
rs1237444900 891 dbSNP
rs1450911687 903 dbSNP
rs1333841376 904 dbSNP
rs948080539 913 dbSNP
rs1051202478 914 dbSNP
rs764917673 915 dbSNP
rs1048506695 918 dbSNP
rs1370553955 926 dbSNP
rs147813134 939 dbSNP
rs918723940 940 dbSNP
rs977341615 947 dbSNP
rs142173734 955 dbSNP
rs1201513661 963 dbSNP
rs200765599 966 dbSNP
rs1259775997 967 dbSNP
rs139304973 969 dbSNP
rs1181006642 971 dbSNP
rs1334005968 976 dbSNP
rs1397133090 990 dbSNP
rs1404380572 994 dbSNP
rs927248483 996 dbSNP
rs944240880 998 dbSNP
rs1468483132 999 dbSNP
rs115025619 1001 dbSNP
rs1419295370 1010 dbSNP
rs758340470 1014 dbSNP
rs1333397533 1018 dbSNP
rs953060835 1019 dbSNP
rs1283420183 1022 dbSNP
rs1361467433 1024 dbSNP
rs16891944 1026 dbSNP
rs989207509 1029 dbSNP
rs917796232 1035 dbSNP
rs1195058967 1043 dbSNP
rs557259004 1050 dbSNP
rs530126032 1057 dbSNP
rs991999462 1060 dbSNP
rs1453321880 1061 dbSNP
rs1366502915 1064 dbSNP
rs956713982 1065 dbSNP
rs1479538855 1066 dbSNP
rs956681517 1067 dbSNP
rs1424351431 1071 dbSNP
rs1030806306 1075 dbSNP
rs190137715 1081 dbSNP
rs1213880566 1087 dbSNP
rs906441816 1088 dbSNP
rs574638149 1094 dbSNP
rs979568129 1094 dbSNP
rs1303161824 1095 dbSNP
rs1012195091 1104 dbSNP
rs554799040 1110 dbSNP
rs1402662164 1114 dbSNP
rs1319856011 1118 dbSNP
rs1326698048 1118 dbSNP
rs1226412590 1127 dbSNP
rs1017883551 1130 dbSNP
rs888419377 1135 dbSNP
rs1246624728 1141 dbSNP
rs72858469 1142 dbSNP
rs1246111906 1147 dbSNP
rs756237670 1155 dbSNP
rs1030292320 1160 dbSNP
rs566837496 1165 dbSNP
rs144747535 1169 dbSNP
rs1446700105 1170 dbSNP
rs539423221 1173 dbSNP
rs1191414740 1186 dbSNP
rs1276581279 1188 dbSNP
rs897242351 1205 dbSNP
rs1163531640 1211 dbSNP
rs1399537461 1211 dbSNP
rs1038465863 1215 dbSNP
rs1290186379 1223 dbSNP
rs941427964 1237 dbSNP
rs1300203764 1248 dbSNP
rs1315873720 1260 dbSNP
rs1384760519 1267 dbSNP
rs1453171818 1272 dbSNP
rs1314260078 1273 dbSNP
rs1357280074 1282 dbSNP
rs1241261049 1285 dbSNP
rs570530741 1294 dbSNP
rs546351750 1298 dbSNP
rs531115051 1299 dbSNP
rs1203643985 1305 dbSNP
rs947988766 1306 dbSNP
rs530786420 1308 dbSNP
rs1241829270 1312 dbSNP
rs917850083 1312 dbSNP
rs1442146255 1317 dbSNP
rs1162466434 1318 dbSNP
rs1160575594 1321 dbSNP
rs568454515 1325 dbSNP
rs548477620 1327 dbSNP
rs1049974047 1344 dbSNP
rs866855069 1357 dbSNP
rs1156464483 1358 dbSNP
rs1477249540 1359 dbSNP
rs1263286412 1361 dbSNP
rs914890891 1369 dbSNP
rs114582772 1370 dbSNP
rs1449542948 1376 dbSNP
rs532668338 1378 dbSNP
rs1289571835 1380 dbSNP
rs923741875 1390 dbSNP
rs979234180 1392 dbSNP
rs775625832 1393 dbSNP
rs1265200455 1404 dbSNP
rs1324623304 1411 dbSNP
rs770046813 1418 dbSNP
rs559153397 1419 dbSNP
rs1359061186 1423 dbSNP
rs72858468 1432 dbSNP
rs1218567352 1436 dbSNP
rs781072162 1440 dbSNP
rs1481866827 1442 dbSNP
rs532104217 1444 dbSNP
rs985099528 1446 dbSNP
rs970568509 1457 dbSNP
rs1023432817 1458 dbSNP
rs1417972383 1459 dbSNP
rs563274951 1460 dbSNP
rs1430962259 1466 dbSNP
rs1470009114 1471 dbSNP
rs1887716 1476 dbSNP
rs897348280 1478 dbSNP
rs766585350 1489 dbSNP
rs1322628927 1490 dbSNP
rs1395735076 1491 dbSNP
rs1389738825 1492 dbSNP
rs1285336074 1507 dbSNP
rs994602971 1508 dbSNP
rs897217216 1512 dbSNP
rs185264696 1513 dbSNP
rs1281726852 1517 dbSNP
rs905940027 1529 dbSNP
rs1041187613 1536 dbSNP
rs1008326481 1544 dbSNP
rs1387196160 1545 dbSNP
rs1205716365 1546 dbSNP
rs1251244810 1552 dbSNP
rs1396593129 1558 dbSNP
rs574776317 1560 dbSNP
rs889921514 1569 dbSNP
rs193125655 1583 dbSNP
rs540847746 1584 dbSNP
rs7754225 1585 dbSNP
rs757893617 1587 dbSNP
rs796599898 1592 dbSNP
rs923822460 1593 dbSNP
rs1170966780 1594 dbSNP
rs1372416454 1598 dbSNP
rs752234678 1607 dbSNP
rs1043942191 1611 dbSNP
rs946517599 1616 dbSNP
rs1366303554 1618 dbSNP
rs1404510826 1622 dbSNP
rs1301496051 1624 dbSNP
rs553160543 1632 dbSNP
rs955052263 1634 dbSNP
rs922247423 1635 dbSNP
rs1306202233 1640 dbSNP
rs1245827220 1642 dbSNP
rs973030773 1648 dbSNP
rs935030901 1659 dbSNP
rs1244616412 1663 dbSNP
rs1486675734 1671 dbSNP
rs9380848 1694 dbSNP
rs1198518610 1698 dbSNP
rs775961055 1704 dbSNP
rs1447536213 1707 dbSNP
rs1319253155 1709 dbSNP
rs1165416094 1715 dbSNP
rs34631049 1718 dbSNP
rs1385836760 1719 dbSNP
rs1424058588 1725 dbSNP
rs1491012171 1735 dbSNP
rs868480609 1736 dbSNP
rs1260042220 1741 dbSNP
rs981791639 1742 dbSNP
rs1431761619 1747 dbSNP
rs1017137441 1748 dbSNP
rs144684670 1749 dbSNP
rs970453953 1749 dbSNP
rs1359441869 1750 dbSNP
rs1454963388 1750 dbSNP
rs199663493 1750 dbSNP
rs766093216 1750 dbSNP
rs767763139 1750 dbSNP
rs970176696 1752 dbSNP
rs1023074619 1754 dbSNP
rs1344567079 1756 dbSNP
rs1327888745 1763 dbSNP
rs1463357653 1763 dbSNP
rs566426149 1765 dbSNP
rs1443951624 1773 dbSNP
rs1235706914 1778 dbSNP
rs1293323136 1781 dbSNP
rs1410301696 1789 dbSNP
rs895845932 1797 dbSNP
rs1158629962 1803 dbSNP
rs1372843976 1806 dbSNP
rs7774204 1807 dbSNP
rs879051699 1813 dbSNP
rs990625610 1818 dbSNP
rs999481714 1819 dbSNP
rs1337868161 1820 dbSNP
rs1382615019 1822 dbSNP
rs1451100349 1832 dbSNP
rs1281881892 1833 dbSNP
rs1374903055 1842 dbSNP
rs952645253 1855 dbSNP
rs1283076671 1857 dbSNP
rs1326715306 1860 dbSNP
rs1330293826 1862 dbSNP
rs1043584806 1874 dbSNP
rs7774046 1876 dbSNP
rs1207967593 1883 dbSNP
rs188987720 1883 dbSNP
rs1455325753 1887 dbSNP
rs565311750 1892 dbSNP
rs1378813703 1899 dbSNP
rs994176176 1899 dbSNP
rs911024536 1909 dbSNP
rs1049494127 1915 dbSNP
rs1177519767 1916 dbSNP
rs1405848012 1920 dbSNP
rs1333410991 1925 dbSNP
rs568391272 1925 dbSNP
rs762340388 1930 dbSNP
rs1019631722 1931 dbSNP
rs1225002194 1932 dbSNP
rs1491043654 1933 dbSNP
rs558146326 1933 dbSNP
rs567929588 1933 dbSNP
rs570702532 1933 dbSNP
rs1008293865 1934 dbSNP
rs77519572 1936 dbSNP
rs114820637 1953 dbSNP
rs1249719391 1954 dbSNP
rs1012183468 1964 dbSNP
rs1490889952 1965 dbSNP
rs1200444158 1982 dbSNP
rs1428913531 1983 dbSNP
rs893386382 1988 dbSNP
rs1053813990 1991 dbSNP
rs933690363 2002 dbSNP
rs1477225379 2007 dbSNP
rs934935755 2011 dbSNP
rs1279445122 2015 dbSNP
rs1420827727 2035 dbSNP
rs1409905782 2036 dbSNP
rs1368194253 2037 dbSNP
rs1161715265 2038 dbSNP
rs184402419 2038 dbSNP
rs1046064249 2041 dbSNP
rs1230780068 2046 dbSNP
rs1271729847 2048 dbSNP
rs970227503 2049 dbSNP
rs949109644 2054 dbSNP
rs1272508896 2056 dbSNP
rs916357767 2065 dbSNP
rs552175482 2068 dbSNP
rs931177159 2080 dbSNP
rs1306776359 2088 dbSNP
rs771915258 2091 dbSNP
rs919844305 2094 dbSNP
rs79883150 2100 dbSNP
rs115324650 2101 dbSNP
rs1387679626 2114 dbSNP
rs1019600572 2115 dbSNP
rs139714676 2122 dbSNP
rs1358025115 2124 dbSNP
rs1389495263 2130 dbSNP
rs1334282368 2132 dbSNP
rs954092439 2134 dbSNP
rs1358289520 2136 dbSNP
rs1326827492 2142 dbSNP
rs1028450673 2144 dbSNP
rs1295268426 2149 dbSNP
rs1361580986 2151 dbSNP
rs1158408296 2164 dbSNP
rs1246783721 2169 dbSNP
rs745642751 2171 dbSNP
rs893261275 2172 dbSNP
rs1031841449 2173 dbSNP
rs999487863 2174 dbSNP
rs1410629540 2180 dbSNP
rs114578173 2181 dbSNP
rs1472774048 2183 dbSNP
rs1238091911 2197 dbSNP
rs889638156 2204 dbSNP
rs1046032751 2222 dbSNP
rs560998513 2223 dbSNP
rs1445783828 2229 dbSNP
rs949077279 2258 dbSNP
rs1183597932 2259 dbSNP
rs146152588 2275 dbSNP
rs1456015381 2280 dbSNP
rs1411367346 2282 dbSNP
rs115906685 2286 dbSNP
rs1385272069 2291 dbSNP
rs1456501166 2292 dbSNP
rs1317229997 2297 dbSNP
rs116537209 2300 dbSNP
rs1384827427 2301 dbSNP
rs1453289688 2302 dbSNP
rs544851763 2311 dbSNP
rs972608397 2321 dbSNP
rs1312037156 2322 dbSNP
rs920900820 2326 dbSNP
rs939702496 2327 dbSNP
rs576909304 2330 dbSNP
rs1280355100 2334 dbSNP
rs912507674 2342 dbSNP
rs948933488 2344 dbSNP
rs986796791 2350 dbSNP
rs557058532 2353 dbSNP
rs1337963595 2356 dbSNP
rs1297128251 2364 dbSNP
rs1419948299 2374 dbSNP
rs1028333598 2377 dbSNP
rs1347275286 2381 dbSNP
rs1462123619 2383 dbSNP
rs778864979 2386 dbSNP
rs728217 2390 dbSNP
rs191167012 2400 dbSNP
rs1421509360 2404 dbSNP
rs1032228056 2405 dbSNP
rs1183437171 2405 dbSNP
rs999061498 2408 dbSNP
rs1447986914 2411 dbSNP
rs1190147370 2416 dbSNP
rs1472066598 2427 dbSNP
rs1156598531 2445 dbSNP
rs554923140 2452 dbSNP
rs907444965 2456 dbSNP
rs1408060073 2460 dbSNP
rs1024549255 2461 dbSNP
rs187048570 2463 dbSNP
rs532492803 2466 dbSNP
rs537693081 2467 dbSNP
rs1393201471 2475 dbSNP
rs1264239971 2478 dbSNP
rs1194594285 2479 dbSNP
rs1206469729 2496 dbSNP
rs1285529705 2499 dbSNP
rs1032190652 2501 dbSNP
rs1262242659 2507 dbSNP
rs1054819864 2511 dbSNP
rs1321037088 2515 dbSNP
rs728218 2516 dbSNP
rs1235070650 2532 dbSNP
rs552739221 2544 dbSNP
rs1021560873 2545 dbSNP
rs898275057 2551 dbSNP
rs1179546735 2554 dbSNP
rs1431030733 2557 dbSNP
rs1010816430 2559 dbSNP
rs1175167353 2562 dbSNP
rs772038805 2565 dbSNP
rs552726404 2578 dbSNP
rs182680100 2583 dbSNP
rs1298780377 2587 dbSNP
rs1370051943 2590 dbSNP
rs1050967702 2613 dbSNP
rs1408129240 2619 dbSNP
rs932558657 2620 dbSNP
rs1292129825 2623 dbSNP
rs16891940 2638 dbSNP
rs73731794 2643 dbSNP
rs957672637 2644 dbSNP
rs1309707902 2648 dbSNP
rs924742452 2659 dbSNP
rs77872046 2663 dbSNP
rs971570041 2665 dbSNP
rs888136642 2667 dbSNP
rs1270583070 2676 dbSNP
rs17428273 2681 dbSNP
rs1190347281 2692 dbSNP
rs1265042199 2695 dbSNP
rs547330689 2731 dbSNP
rs1169116871 2732 dbSNP
rs1389522253 2744 dbSNP
rs959001875 2748 dbSNP
rs190098765 2755 dbSNP
rs757667914 2769 dbSNP
rs916167313 2770 dbSNP
rs73731793 2776 dbSNP
rs1292105658 2784 dbSNP
rs60227351 2787 dbSNP
rs1383169725 2788 dbSNP
rs924790124 2792 dbSNP
rs1036817069 2797 dbSNP
rs977931628 2798 dbSNP
rs1215436731 2803 dbSNP
rs532603159 2808 dbSNP
rs968770003 2814 dbSNP
rs1003973991 2825 dbSNP
rs1220405059 2830 dbSNP
rs1021612971 2835 dbSNP
rs34758255 2837 dbSNP
rs1256842203 2841 dbSNP
rs1189048890 2846 dbSNP
rs11756848 2848 dbSNP
rs1050933974 2854 dbSNP
rs932525857 2855 dbSNP
rs1028217082 2858 dbSNP
rs921219164 2859 dbSNP
rs4714239 2866 dbSNP
rs901031359 2867 dbSNP
rs752736895 2870 dbSNP
rs1347244783 2874 dbSNP
rs765314683 2884 dbSNP
rs543517333 2888 dbSNP
rs1387004790 2894 dbSNP
rs1455085120 2896 dbSNP
rs1015408977 2908 dbSNP
rs977440896 2911 dbSNP
rs1379238892 2919 dbSNP
rs1004409624 2921 dbSNP
rs1310127694 2922 dbSNP
rs114160593 2925 dbSNP
rs1209057566 2926 dbSNP
rs1372117764 2943 dbSNP
rs1463454769 2958 dbSNP
rs917387964 2971 dbSNP
rs1472508185 2972 dbSNP
rs1048133223 2981 dbSNP
rs529928599 2984 dbSNP
rs991647946 2993 dbSNP
rs1012606223 2995 dbSNP
rs1410246404 2996 dbSNP
rs1471190230 2997 dbSNP
rs894117081 3000 dbSNP
rs1359160912 3003 dbSNP
rs959197315 3021 dbSNP
rs1300581940 3022 dbSNP
rs1027947399 3025 dbSNP
rs1228657382 3029 dbSNP
rs1287430285 3033 dbSNP
rs995573193 3036 dbSNP
rs1376005894 3049 dbSNP
rs1225189090 3057 dbSNP
rs554945816 3073 dbSNP
rs1041879454 3074 dbSNP
rs1434009981 3076 dbSNP
rs1015272238 3086 dbSNP
rs1003941434 3092 dbSNP
rs1395416401 3098 dbSNP
rs1234704814 3107 dbSNP
rs890891634 3119 dbSNP
rs1029487822 3128 dbSNP
rs534748046 3143 dbSNP
rs561011006 3145 dbSNP
rs572682302 3146 dbSNP
rs867367095 3147 dbSNP
rs1410087736 3154 dbSNP
rs899744464 3164 dbSNP
rs541285574 3165 dbSNP
rs1425011108 3174 dbSNP
rs1413271124 3182 dbSNP
rs986156824 3185 dbSNP
rs935921424 3193 dbSNP
rs1409953105 3198 dbSNP
rs1237561917 3205 dbSNP
rs1348305790 3211 dbSNP
rs1196307866 3220 dbSNP
rs953394967 3223 dbSNP
rs1275228337 3229 dbSNP
rs1344173300 3233 dbSNP
rs766692753 3241 dbSNP
rs1275091927 3248 dbSNP
rs1342925871 3249 dbSNP
rs760609961 3252 dbSNP
rs1253761273 3253 dbSNP
rs1041717101 3256 dbSNP
rs1199943078 3269 dbSNP
rs1208938806 3270 dbSNP
rs773072751 3276 dbSNP
rs977097786 3290 dbSNP
rs965321539 3301 dbSNP
rs1391366948 3304 dbSNP
rs1015879017 3305 dbSNP
rs950126617 3306 dbSNP
rs188493680 3308 dbSNP
rs1406769167 3314 dbSNP
rs1323918313 3316 dbSNP
rs917356789 3339 dbSNP
rs1306055666 3344 dbSNP
rs1434084450 3348 dbSNP
rs1004059274 3368 dbSNP
rs771915390 3369 dbSNP
rs748069676 3373 dbSNP
rs937558690 3379 dbSNP
rs570278661 3380 dbSNP
rs1210684807 3388 dbSNP
rs1308256238 3391 dbSNP
rs1289492712 3394 dbSNP
rs77241452 3395 dbSNP
rs1056794764 3410 dbSNP
rs138485934 3412 dbSNP
rs1302370905 3427 dbSNP
rs903442174 3431 dbSNP
rs1187341918 3439 dbSNP
rs1015239402 3460 dbSNP
rs1387806471 3466 dbSNP
rs1473524267 3467 dbSNP
rs1163449564 3469 dbSNP
rs982472112 3471 dbSNP
rs1403376545 3472 dbSNP
rs1389198578 3488 dbSNP
rs1295434555 3490 dbSNP
rs955089569 3491 dbSNP
rs146352795 3497 dbSNP
rs1377559415 3502 dbSNP
rs183608189 3506 dbSNP
rs564495578 3512 dbSNP
rs879337730 3515 dbSNP
rs369000652 3518 dbSNP
rs551275041 3519 dbSNP
rs375834311 3522 dbSNP
rs903138647 3523 dbSNP
rs923305747 3525 dbSNP
rs1182374579 3531 dbSNP
rs1443641958 3538 dbSNP
rs34609565 3539 dbSNP
rs775697035 3539 dbSNP
rs962321707 3541 dbSNP
rs531360424 3543 dbSNP
rs779740803 3551 dbSNP
rs562345322 3557 dbSNP
rs1456552371 3562 dbSNP
rs950095968 3565 dbSNP
rs1404349016 3570 dbSNP
rs908472612 3572 dbSNP
rs1282102834 3590 dbSNP
rs1338886127 3607 dbSNP
rs1214011889 3612 dbSNP
rs1289274970 3618 dbSNP
rs1328878804 3627 dbSNP
rs1353370850 3633 dbSNP
rs982666606 3641 dbSNP
rs61075053 3642 dbSNP
rs58687888 3643 dbSNP
rs386700389 3644 dbSNP
rs1254906596 3645 dbSNP
rs1339271676 3647 dbSNP
rs1484455345 3648 dbSNP
rs937426213 3650 dbSNP
rs1252140222 3655 dbSNP
rs561259279 3657 dbSNP
rs541394912 3658 dbSNP
rs755760875 3661 dbSNP
rs1002543844 3664 dbSNP
rs1296514256 3665 dbSNP
rs902825852 3668 dbSNP
rs1020549630 3673 dbSNP
rs1011773159 3674 dbSNP
rs747381187 3707 dbSNP
rs1455262827 3711 dbSNP
rs1308863963 3713 dbSNP
rs1350167505 3721 dbSNP
rs202071291 3721 dbSNP
rs575726597 3723 dbSNP
rs762667470 3723 dbSNP
rs369923486 3724 dbSNP
rs144584932 3733 dbSNP
rs113162608 3734 dbSNP
rs1491340526 3734 dbSNP
rs563858909 3734 dbSNP
rs1475212304 3736 dbSNP
rs1050551302 3743 dbSNP
rs940938867 3750 dbSNP
rs78824997 3751 dbSNP
rs1191000121 3753 dbSNP
rs759989015 3755 dbSNP
rs1274892289 3757 dbSNP
rs374388579 3757 dbSNP
rs556943399 3759 dbSNP
rs758856342 3759 dbSNP
rs1207315686 3762 dbSNP
rs1375929245 3762 dbSNP
rs1433609234 3762 dbSNP
rs1354848849 3765 dbSNP
rs1169321580 3771 dbSNP
rs1265299999 3784 dbSNP
rs955058494 3792 dbSNP
rs1428096079 3796 dbSNP
rs148215160 3802 dbSNP
rs1368715446 3807 dbSNP
rs545725950 3809 dbSNP
rs1336976773 3811 dbSNP
rs982720253 3811 dbSNP
rs975148851 3812 dbSNP
rs114708257 3813 dbSNP
rs556795690 3814 dbSNP
rs536488980 3816 dbSNP
rs1000462921 3827 dbSNP
rs9369112 3833 dbSNP
rs553604740 3838 dbSNP
rs1020194809 3847 dbSNP
rs1014135379 3848 dbSNP
rs981572053 3849 dbSNP
rs967101128 3850 dbSNP
rs895783106 3851 dbSNP
rs1056218579 3852 dbSNP
rs1001599588 3853 dbSNP
rs1449428482 3867 dbSNP
rs1167136938 3875 dbSNP
rs1350753137 3876 dbSNP
rs187271323 3882 dbSNP
rs571162334 3888 dbSNP
rs1029167507 3890 dbSNP
rs996362580 3893 dbSNP
rs1297577382 3899 dbSNP
rs1461916857 3900 dbSNP
rs551211756 3901 dbSNP
rs1212358232 3906 dbSNP
rs753960178 3913 dbSNP
rs531497867 3919 dbSNP
rs1321967603 3936 dbSNP
rs908116338 3941 dbSNP
rs1243715389 3957 dbSNP
rs1051980084 3963 dbSNP
rs1271074757 3968 dbSNP
rs58400484 3979 dbSNP
rs1209250884 3983 dbSNP
rs1474866751 3986 dbSNP
rs922238492 3997 dbSNP
rs975495839 3998 dbSNP
rs1414726849 4010 dbSNP
rs760920633 4014 dbSNP
rs56979582 4024 dbSNP
rs925735409 4033 dbSNP
rs548483804 4037 dbSNP
rs767303358 4047 dbSNP
rs1320473439 4059 dbSNP
rs1344011557 4064 dbSNP
rs1427974953 4078 dbSNP
rs967152608 4081 dbSNP
rs1379397388 4096 dbSNP
rs991380282 4101 dbSNP
rs1020077587 4118 dbSNP
rs1291107063 4120 dbSNP
rs112382701 4129 dbSNP
rs928445684 4135 dbSNP
rs981238792 4141 dbSNP
rs1315071143 4152 dbSNP
rs1238153304 4153 dbSNP
rs1482996062 4154 dbSNP
rs959961204 4169 dbSNP
rs375611060 4176 dbSNP
rs867479520 4182 dbSNP
rs1254326995 4184 dbSNP
rs1001963730 4197 dbSNP
rs912935981 4224 dbSNP
rs899244884 4227 dbSNP
rs1256211911 4231 dbSNP
rs1038225193 4233 dbSNP
rs1416686414 4234 dbSNP
rs761480721 4236 dbSNP
rs1340319500 4238 dbSNP
rs989785176 4245 dbSNP
rs886565563 4247 dbSNP
rs774397001 4255 dbSNP
rs1352010828 4260 dbSNP
rs1410141284 4262 dbSNP
rs1371038909 4269 dbSNP
rs143099423 4269 dbSNP
rs541183283 4271 dbSNP
rs1325013658 4272 dbSNP
rs1208895138 4275 dbSNP
rs1441510271 4278 dbSNP
rs1276972288 4283 dbSNP
rs1483509797 4284 dbSNP
rs1396665497 4288 dbSNP
rs1231553642 4289 dbSNP
rs189678271 4290 dbSNP
rs1425160519 4294 dbSNP
rs748865582 4296 dbSNP
rs942396573 4299 dbSNP
rs1433544245 4307 dbSNP
rs1171215457 4310 dbSNP
rs1408789971 4315 dbSNP
rs925651026 4320 dbSNP
rs1327882552 4333 dbSNP
rs774917254 4334 dbSNP
rs755069135 4342 dbSNP
rs1275357073 4352 dbSNP
rs1005000380 4355 dbSNP
rs1232097809 4359 dbSNP
rs1476854153 4362 dbSNP
rs59865576 4371 dbSNP
rs1343080394 4373 dbSNP
rs1204678523 4379 dbSNP
rs1271192924 4384 dbSNP
rs7742057 4388 dbSNP
rs1222841453 4389 dbSNP
rs994856305 4393 dbSNP
rs146932965 4394 dbSNP
rs879144753 4395 dbSNP
rs556932670 4397 dbSNP
rs1391503965 4402 dbSNP
rs1449586421 4405 dbSNP
rs1166958817 4407 dbSNP
rs758650934 4410 dbSNP
rs928527210 4413 dbSNP
rs1438412397 4419 dbSNP
rs11756084 4420 dbSNP
rs945869021 4422 dbSNP
rs574165402 4424 dbSNP
rs1016266481 4425 dbSNP
rs912988251 4427 dbSNP
rs1268621453 4429 dbSNP
rs989836195 4432 dbSNP
rs1344633455 4434 dbSNP
rs957062786 4436 dbSNP
rs553786615 4439 dbSNP
rs533651119 4463 dbSNP
rs886534522 4471 dbSNP
rs1030489942 4475 dbSNP
rs1370918924 4493 dbSNP
rs571056187 4494 dbSNP
rs966685453 4497 dbSNP
rs997724538 4504 dbSNP
rs1163575996 4508 dbSNP
rs60994975 4515 dbSNP
rs185265663 4516 dbSNP
rs1161273092 4518 dbSNP
rs1389356444 4525 dbSNP
rs936943896 4528 dbSNP
rs1441415958 4544 dbSNP
rs1316314742 4545 dbSNP
rs904163038 4553 dbSNP
rs1354570610 4559 dbSNP
rs994911601 4562 dbSNP
rs1449058982 4563 dbSNP
rs1412376037 4565 dbSNP
rs1374534151 4567 dbSNP
rs1174651546 4568 dbSNP
rs1230688074 4568 dbSNP
rs1333143966 4568 dbSNP
rs895173261 4575 dbSNP
rs1042717652 4578 dbSNP
rs1436899565 4580 dbSNP
rs1203998154 4582 dbSNP
rs1256445165 4582 dbSNP
rs1443694686 4582 dbSNP
rs72262714 4582 dbSNP
rs945787343 4584 dbSNP
rs1001493438 4585 dbSNP
rs913007944 4586 dbSNP
rs1177087996 4592 dbSNP
rs756195656 4593 dbSNP
rs748443059 4601 dbSNP
rs992617166 4611 dbSNP
rs560465807 4625 dbSNP
rs549030915 4626 dbSNP
rs1185576904 4640 dbSNP
rs1373005660 4647 dbSNP
rs927156445 4649 dbSNP
rs1289408247 4652 dbSNP
rs1485462166 4654 dbSNP
rs1281403266 4658 dbSNP
rs974819345 4662 dbSNP
rs1258334704 4664 dbSNP
rs1346506905 4670 dbSNP
rs944349033 4683 dbSNP
rs1484487219 4691 dbSNP
rs377112600 4691 dbSNP
rs552524364 4691 dbSNP
rs983692068 4693 dbSNP
rs755466124 4696 dbSNP
rs1418333341 4699 dbSNP
rs950888028 4703 dbSNP
rs1379359408 4705 dbSNP
rs980388039 4709 dbSNP
rs1167254129 4723 dbSNP
rs1374030920 4729 dbSNP
rs963342548 4739 dbSNP
rs1373826450 4745 dbSNP
rs1431889242 4747 dbSNP
rs1308919822 4774 dbSNP
rs1329234856 4777 dbSNP
rs1445259212 4788 dbSNP
rs1016647697 4790 dbSNP
rs1390097062 4811 dbSNP
rs753978614 4817 dbSNP
rs1304028858 4825 dbSNP
rs149713504 4827 dbSNP
rs566557921 4835 dbSNP
rs1030455688 4836 dbSNP
rs959436428 4842 dbSNP
rs1251570770 4845 dbSNP
rs181422438 4858 dbSNP
rs140847827 4859 dbSNP
rs900631202 4861 dbSNP
rs189750915 4869 dbSNP
rs1158893014 4870 dbSNP
rs1001496008 4873 dbSNP
rs1393327036 4873 dbSNP
rs904134397 4893 dbSNP
rs1401774644 4898 dbSNP
rs1451455100 4899 dbSNP
rs1042686747 4900 dbSNP
rs945754316 4906 dbSNP
rs551785903 4907 dbSNP
rs1056772464 4913 dbSNP
rs1322774386 4914 dbSNP
rs1024656834 4932 dbSNP
rs1230059630 4933 dbSNP
rs1396050396 4939 dbSNP
rs1295774886 4945 dbSNP
rs1258339515 4946 dbSNP
rs1306567181 4949 dbSNP
rs530154116 4950 dbSNP
rs563140146 4951 dbSNP
rs1212959893 4952 dbSNP
rs185301671 4961 dbSNP
rs941928293 4962 dbSNP
rs1187195456 4973 dbSNP
rs750696937 4973 dbSNP
rs1167284205 4981 dbSNP
rs1426991275 4981 dbSNP
rs1969744 4984 dbSNP
rs1461285560 4988 dbSNP
rs1163395459 4989 dbSNP
rs547280257 4996 dbSNP
rs142375909 4997 dbSNP
rs181650829 5000 dbSNP
rs976141711 5001 dbSNP
rs190473224 5006 dbSNP
rs964840043 5007 dbSNP
rs140079706 5008 dbSNP
rs1335234124 5013 dbSNP
rs1232519823 5017 dbSNP
rs1001066474 5025 dbSNP
rs1338034850 5027 dbSNP
rs968703957 5030 dbSNP
rs911547033 5031 dbSNP
rs527542160 5035 dbSNP
rs1484960886 5054 dbSNP
rs146048759 5059 dbSNP
rs1258564139 5066 dbSNP
rs144211560 5073 dbSNP
rs1483743845 5084 dbSNP
rs535388602 5085 dbSNP
rs1401819770 5092 dbSNP
rs1418621393 5092 dbSNP
rs374117021 5101 dbSNP
rs1451084904 5103 dbSNP
rs1304214687 5108 dbSNP
rs1355717086 5111 dbSNP
rs184526605 5117 dbSNP
rs114197324 5118 dbSNP
rs959491353 5126 dbSNP
rs1204313091 5130 dbSNP
rs1224249588 5132 dbSNP
rs1283523074 5133 dbSNP
rs1034200994 5136 dbSNP
rs1187334861 5139 dbSNP
rs544604283 5144 dbSNP
rs112403603 5146 dbSNP
rs1281235241 5146 dbSNP
rs373127092 5146 dbSNP
rs58611533 5146 dbSNP
rs796451820 5146 dbSNP
rs1243656398 5147 dbSNP
rs1211700842 5149 dbSNP
rs1177134897 5150 dbSNP
rs1416735486 5151 dbSNP
rs1468011492 5151 dbSNP
rs982191504 5151 dbSNP
rs35208662 5153 dbSNP
rs571749327 5154 dbSNP
rs1003007820 5156 dbSNP
rs1020950361 5159 dbSNP
rs1010140979 5174 dbSNP
rs551929410 5176 dbSNP
rs1442739650 5184 dbSNP
rs72858451 5184 dbSNP
rs941912563 5205 dbSNP
rs1365683284 5207 dbSNP
rs1214816036 5210 dbSNP
rs1274469824 5210 dbSNP
rs909054601 5220 dbSNP
rs1000003854 5221 dbSNP
rs1347308653 5222 dbSNP
rs1301745239 5225 dbSNP
rs1232332009 5228 dbSNP
rs1277123349 5239 dbSNP
rs1440786896 5241 dbSNP
rs1204288286 5251 dbSNP
rs1231608056 5254 dbSNP
rs1194901969 5259 dbSNP
rs1047640212 5264 dbSNP
rs929227127 5266 dbSNP
rs1327998889 5280 dbSNP
rs1453307836 5285 dbSNP
rs923239049 5289 dbSNP
rs1464068760 5293 dbSNP
rs769257446 5298 dbSNP
rs1410266564 5311 dbSNP
rs192457141 5313 dbSNP
rs373922124 5315 dbSNP
rs1421352428 5318 dbSNP
rs758941963 5325 dbSNP
rs944452365 5330 dbSNP
rs776399094 5333 dbSNP
rs1272091009 5338 dbSNP
rs890158038 5352 dbSNP
rs1047421242 5354 dbSNP
rs760146075 5354 dbSNP
rs188338337 5364 dbSNP
rs1453713653 5368 dbSNP
rs1323933032 5371 dbSNP
rs1222984931 5373 dbSNP
rs1214833718 5375 dbSNP
rs1253000726 5387 dbSNP
rs1467631892 5388 dbSNP
rs540386225 5396 dbSNP
rs1037936226 5397 dbSNP
rs113540182 5397 dbSNP
rs183562962 5398 dbSNP
rs1250296725 5405 dbSNP
rs1462879622 5406 dbSNP
rs1165543229 5409 dbSNP
rs779086539 5410 dbSNP
rs1438714635 5411 dbSNP
rs7774977 5417 dbSNP
rs555097332 5424 dbSNP
rs543913021 5425 dbSNP
rs1372178059 5444 dbSNP
rs988102960 5445 dbSNP
rs1390145271 5447 dbSNP
rs1002565173 5463 dbSNP
rs1376478535 5465 dbSNP
rs1333343352 5469 dbSNP
rs905605743 5479 dbSNP
rs1044118661 5481 dbSNP
rs72858448 5482 dbSNP
rs1298778928 5486 dbSNP
rs555066095 5489 dbSNP
rs1032904475 5490 dbSNP
rs1240058234 5492 dbSNP
rs1476030692 5497 dbSNP
rs72858446 5508 dbSNP
rs559338954 5511 dbSNP
rs1160281974 5512 dbSNP
rs573040865 5517 dbSNP
rs1433936525 5525 dbSNP
rs1017436162 5531 dbSNP
rs929197672 5532 dbSNP
rs923209665 5535 dbSNP
rs116194393 5538 dbSNP
rs1417197828 5553 dbSNP
rs1293095300 5555 dbSNP
rs943418854 5556 dbSNP
rs72858444 5558 dbSNP
rs1047474817 5562 dbSNP
rs35268572 5564 dbSNP
rs751385960 5570 dbSNP
rs1486464157 5572 dbSNP
rs1277833989 5574 dbSNP
rs549930125 5575 dbSNP
rs898806822 5575 dbSNP
rs1183903156 5580 dbSNP
rs1364372724 5583 dbSNP
rs1037988543 5584 dbSNP
rs1282873798 5589 dbSNP
rs914040714 5591 dbSNP
rs988297770 5592 dbSNP
rs558233720 5594 dbSNP
rs1435595950 5595 dbSNP
rs1312540518 5602 dbSNP
rs1374020232 5607 dbSNP
rs769893124 5615 dbSNP
rs538338227 5616 dbSNP
rs1307810872 5620 dbSNP
rs1237652904 5627 dbSNP
rs569371696 5630 dbSNP
rs1349477143 5636 dbSNP
rs981505273 5639 dbSNP
rs969712253 5645 dbSNP
rs1312557504 5650 dbSNP
rs1482147700 5658 dbSNP
rs1197355391 5661 dbSNP
rs1023073316 5662 dbSNP
rs1437199220 5666 dbSNP
rs914004147 5669 dbSNP
rs1396944445 5670 dbSNP
rs988155578 5671 dbSNP
rs1005941611 5679 dbSNP
rs887555111 5683 dbSNP
rs1393513831 5688 dbSNP
rs1451566062 5693 dbSNP
rs1363093690 5700 dbSNP
rs958060056 5709 dbSNP
rs762912559 5719 dbSNP
rs979125617 5724 dbSNP
rs1159743071 5729 dbSNP
rs549091902 5730 dbSNP
rs993371954 5731 dbSNP
rs1302168989 5738 dbSNP
rs1420417484 5745 dbSNP
rs1254747540 5752 dbSNP
rs1310081598 5763 dbSNP
rs1229289436 5764 dbSNP
rs901755441 5768 dbSNP
rs1040259614 5779 dbSNP
rs529314297 5786 dbSNP
rs943281718 5787 dbSNP
rs1254876160 5801 dbSNP
rs1468922896 5809 dbSNP
rs1193089805 5810 dbSNP
rs1265483324 5815 dbSNP
rs1430541843 5818 dbSNP
rs1171449462 5828 dbSNP
rs1008734499 5833 dbSNP
rs114696114 5834 dbSNP
rs1044127395 5835 dbSNP
rs1395876020 5837 dbSNP
rs1461450352 5842 dbSNP
rs752676332 5843 dbSNP
rs1364993358 5850 dbSNP
rs1383536848 5857 dbSNP
rs16891937 5858 dbSNP
rs1261891028 5859 dbSNP
rs533310509 5871 dbSNP
rs988265079 5875 dbSNP
rs567666565 5877 dbSNP
rs544451196 5883 dbSNP
rs928126241 5885 dbSNP
rs144856073 5886 dbSNP
rs115737814 5889 dbSNP
rs1047060855 5906 dbSNP
rs1263730237 5908 dbSNP
rs541440385 5915 dbSNP
rs1022615963 5922 dbSNP
rs892621882 5930 dbSNP
rs770628271 5937 dbSNP
rs984482155 5940 dbSNP
rs951775631 5952 dbSNP
rs1419164399 5965 dbSNP
rs1052494754 5966 dbSNP
rs936754875 5972 dbSNP
rs1026105194 5973 dbSNP
rs975448936 5977 dbSNP
rs1458721799 5978 dbSNP
rs780230515 5981 dbSNP
rs942657060 5983 dbSNP
rs1415064125 5991 dbSNP
rs1163517136 5996 dbSNP
rs1232566162 6008 dbSNP
rs993255725 6010 dbSNP
rs1318802318 6011 dbSNP
rs547562727 6016 dbSNP
rs572820777 6023 dbSNP
rs772432922 6025 dbSNP
rs1026135004 6026 dbSNP
rs552960245 6027 dbSNP
rs1180620653 6031 dbSNP
rs1007445946 6033 dbSNP
rs889058359 6054 dbSNP
rs1015980611 6056 dbSNP
rs1043713762 6057 dbSNP
rs946758414 6061 dbSNP
rs546119646 6073 dbSNP
rs892541276 6079 dbSNP
rs769183120 6084 dbSNP
rs1337037787 6109 dbSNP
rs192775003 6112 dbSNP
rs1300955585 6113 dbSNP
rs1375451830 6116 dbSNP
rs1224372022 6123 dbSNP
rs1268701834 6133 dbSNP
rs1351664860 6136 dbSNP
rs1236733314 6138 dbSNP
rs1052434891 6141 dbSNP
rs1281398605 6147 dbSNP
rs188134077 6158 dbSNP
rs1208465005 6162 dbSNP
rs149400659 6189 dbSNP
rs369339092 6190 dbSNP
rs868247610 6192 dbSNP
rs569229060 6198 dbSNP
rs892674008 6206 dbSNP
rs1175109493 6211 dbSNP
rs1437347325 6211 dbSNP
rs1395327309 6213 dbSNP
rs948312070 6215 dbSNP
rs936808785 6229 dbSNP
rs903951386 6230 dbSNP
rs1461567031 6238 dbSNP
rs1442811051 6241 dbSNP
rs1392239162 6254 dbSNP
rs115597878 6261 dbSNP
rs942732006 6264 dbSNP
rs984449716 6276 dbSNP
rs951660479 6281 dbSNP
rs1374019595 6304 dbSNP
rs770198682 6306 dbSNP
rs918930566 6307 dbSNP
rs933223290 6312 dbSNP
rs971782275 6313 dbSNP
rs1453125552 6315 dbSNP
rs1253000738 6319 dbSNP
rs919139730 6320 dbSNP
rs1456030986 6321 dbSNP
rs966198618 6324 dbSNP
rs971892105 6329 dbSNP
rs963182216 6330 dbSNP
rs9471071 6341 dbSNP
rs980916484 6345 dbSNP
rs1340260718 6346 dbSNP
rs1410389684 6356 dbSNP
rs969104655 6382 dbSNP
rs1398030951 6383 dbSNP
rs1463041957 6386 dbSNP
rs1251685844 6388 dbSNP
rs1230255708 6394 dbSNP
rs781076967 6395 dbSNP
rs574681779 6399 dbSNP
rs1302649792 6400 dbSNP
rs1007828728 6402 dbSNP
rs757524438 6404 dbSNP
rs747161498 6405 dbSNP
rs749326549 6407 dbSNP
rs1218420111 6408 dbSNP
rs1256647662 6416 dbSNP
rs892728192 6418 dbSNP
rs1214965772 6419 dbSNP
rs56370893 6423 dbSNP
rs1236726482 6428 dbSNP
rs1326230011 6429 dbSNP
rs1218921394 6433 dbSNP
rs1409029020 6435 dbSNP
rs1001006750 6450 dbSNP
rs904002155 6452 dbSNP
rs369679079 6453 dbSNP
rs1476133848 6454 dbSNP
rs752480285 6463 dbSNP
rs1052400488 6473 dbSNP
rs1390098153 6480 dbSNP
rs867790667 6480 dbSNP
rs116593907 6484 dbSNP
rs2281685 6487 dbSNP
rs1346013098 6492 dbSNP
rs1399742700 6496 dbSNP
rs1045235429 6500 dbSNP
rs529928836 6501 dbSNP
rs1357816121 6503 dbSNP
rs910060644 6505 dbSNP
rs1036249152 6520 dbSNP
rs1479267219 6522 dbSNP
rs1048641076 6523 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + A
Location of target site ENST00000287152.7 | 3UTR | GGGGGCUUCCCCUGACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
</
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1