miRTarBase - #MIRT726158 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol USP3   
Synonyms SIH003, UBP
Description ubiquitin specific peptidase 3
Transcript NM_006537   
Expression
Putative miRNA Targets on USP3
3'UTR of USP3
(miRNA target sites are highlighted)
>USP3|NM_006537|3'UTR
   1 TACCTCCTCCAAATCATCATTCACCAACCATACCAGAGAAACATTTCCAGTTTTCCACAAATACTTGATACAAGATTTAA
  81 TTTCATTATGCACTTTTCAATTTCCTATTTTGGATTTAGTTTTGTCAATGGTAGTGACTTACTGAACATGGGCACCAACT
 161 AATTTTGTTGTTGTTCTACCAGAAAACCTCAGCAGATGTTTTGATTTGCTGCTTTAGTTGTAATAATTCAATTTTTATAG
 241 GTAGTTGTAAGAACTTAGTCTTATTTGACTTTTTTATTTTATGTTAATGTTTTCAGTTCTCACTTTGAGGCACATTTACA
 321 TCAATGCTTTTGTTCCTCTCACATGCTGAAAGCAAGATGTGTTCCTTATTGTGAAGAGCGACACAACTGCCTGCTGCCTT
 401 TCCACAGCTATAATGGACATCAGGTTGACTCTAAATCAAGGATCATGTGTGCACAATACTTGTGGCCCACAAAATTTCAC
 481 AATGACTGCTGAGGAATCATTCTTTTTGCCTGTAAAATATAACAAAGGGCATCATTAAGTAGACCAGGTAATTACTGCTT
 561 GTCTCTCAAGGCTGCTGTCTTTATCAGCACTAACTAAATAAATTTGTTGGTTCAGTTGTACTTGTCCTGCAAATACAAGA
 641 ATTACTCTCTTTGTTGGTTTTTTTGGTTTTGGGGCATACTTGTTTGCGGGGAGGTAAGATGGGAGTAAAGACCAAATACA
 721 TGTAATGTTTAAAAAAAATGCTGTGACTCACTGACATGGTATAGGTGTTACCAGTGAGGTAAAGCCATGGCGTCTGCCTC
 801 CTTTTGAATCAGTATCTCATTCCCCCTTAGTTGTACCACTGGAAGTCACGACATGTCCATTATAGACTTACTTACTGCTT
 881 GTGTTTGGCATCTGAGTCTGAGGTGTGACCCTCTGGGATTTACTTGGATCATCACCCGCACTTCAGTTTATCACTGGGGG
 961 GTGTGCTTCCACAGGAGGAAATTTAGAATCTTCGCTGCTCTGGGTTTTAACACCTCTCTCTGGCCTATCCTGATTGATAG
1041 GACAAGTTGAAAATACTGTTGGAGTAAGTAAGTGGAGTTTTCGTTTTGTTTTTTGGGGGTTTTTGGAGACAAGAGTCTCT
1121 CTCTGTTGCCCAGGCTGGAGTGCAGTGGCACGATCTCAGCTCATTGCAACCTCGGCCTCCCGAGTAGCAATTCTCCTGCC
1201 TCAACCTCCTGAGTAGCTGGGATTACAGGTGCCCACCACTACACCTGGCTAATTTTTTTTTTGTATTTTTAGTAAAGACG
1281 GGGGTTTACCATGTTGGCTAGGGTGGTCTCAACCTCCCTCCTGACCTCAGGTGATCCGCCTGCCTCAGCCTCCCAAAGTG
1361 CTGAGATTACAGGCGTGAGCCATCACGCCCAGACAGTTTTGTTTTTAAAAAACAGATTTAACTCAAAGATTCAAATTTGG
1441 AACCAGAATCCCATTTAAAGAAAGCAGTTGTGGTTTCTACAAGTGTTCTAAGACAGTCCTGTGGTGGTTTTTTTTTTTTC
1521 TTTTTTTTGGTTGGGGGCGGTGGGGGTTGGTAGACATAGCCTACCAATTCTCCACAAGGGACAAAATGTATCTTGTGTTA
1601 AGCCAACGAGACTTTCTGGCAATTTTTTTTTTTTTTTTTTAATGGAGTCTTACTCTGTCCCTCAGGCTGGAGTGCAGTGT
1681 GGCATGATCACAGCTCACTGTAGCCTCAACCTCCCAGGCTCAAGCGATCCTCCCACTTCAGCCTCGAAGTAGCTGGCACC
1761 ACCACACCCAGCTAATTTTTAATATTTTTACTAGAGATGGGGTTTCACCACGTTGCCCAGGCTGGTCTTGCACTCCTGGG
1841 CTCAAGTGATCCACCCACCTTGGCTTCCCAAGGTGCTAGCATTACAGGCATGAGCCACCACGCCCAGCCTGTTCTATTAA
1921 AAACATCTTGACCTTTTTTTTTTTTTAAGTTTATGATATAAAAACAGTCTGGTGGCTTTCCCTCAGGTTGGATATCTGAA
2001 GTTGTGGGAGCAGATGTAGCTCCATTTCCATTTTAATATTAACTGGATAAATCCCACATCTTCCCAGAACACATCTGCTA
2081 AACACTTTAACATGACAAGGAGCAAATTACAATTATGTGTAAACTTATATCATCCAGTACAATGGCCCCTAGCCACATGT
2161 GACTGAAATTTAAATTAGAAACTCAGTGCCTTCAGTCACACTAGCCACATTTCAAGTGCTCAGCACCCACATACGGCGTA
2241 GGACAATGCTGGTCTAAATTTTCACTCCAAAGAATAAAACTTTGCCATCATGTTTAGGTCTTACAACTTTGAGTCCTAAA
2321 AGATAATAGGGAGATGTGTGCTTAAATTAATTTACAATGCTAAATTATATTAGGTTAAACTGTATGAAACCCTGCTATTT
2401 GATGAGTTCTGATCTACAAAAATGACAGCTCCACCTGATCTGATGTATCACACATTAACATCACATCTAATTCAACCTGA
2481 AATGTGAGTCTCCTTTGATCTTGCAAAGTATCTCCTATGAATCCGGGCTCTTTTGCTTAGAAGGTAGACAGCTGTAACCT
2561 CTAACATTGATACTTCGATCTTCAGTCTCTCTGAATGGGCAGCTGTTAAACAGTAAAGGCCTGGGCAGAGTTGATGGTGA
2641 AAAAAAGCTGTATTTTTATACCAAATGGAACTTCAGCAACACGTTGGACTACTTTGTCGGGCAGAGTGGTCTTCAGACAG
2721 GTGATGCTGTTGGCTTAAGAGATGAACACGTCTTCTCTCTGAATTTGTTTTTATTGGTTGGTTTTACTTGAACAGAAACG
2801 TTTGAATGGTGTGAAGATTCTTTAGAAAAGTGATTGGATCCATCTCAATTGTGCACTTGAACAGCAGTGATGTAAATGTG
2881 CTTATTTGTGTTTTCATTTTTAACTGTGCAGCCTTACCACACCTATTTTGAAAGCTGATCTTTTGTCCTCTTCAGGGCTT
2961 TTCCCTTGTGCCATGTTGTCTCCAGCAATATATGTGGCTTCTGGCTCAGAGCTTCTGCTGAGGCAGGGCCTCGCGCTGAG
3041 TCACATGGCTCCTTGGAACAAGAAAACTTTCTCAGAAGTCCCCACACGGGTGGGTGACAGAAACAGTTTGTGGCAACACA
3121 AATCTCTCTCCATGGTGGAGAAACCTTTGCTTATCCACTGTATTCTACTCAGTGTATAGTGATGACAGATGTACTAGAAT
3201 TAAACCAGTCAAGTGTACTGGCCCGGGGTGAGTGTTAAATGTGTATCTCGCCTGTGGAACCTACTCAGCAGCTTGGTTTC
3281 TGGGGTTGGGGGCATATTTATTTCTTAAAGCCAAACCTCTCCTTCATTGGTTTAGTGTACATAAGTCTATTTAGATACAC
3361 TTATCCCACTTTAATCTCCACCAGCCCCTAAACTCTCTCCTGTACCCTCTGTTGCTGAAGTGGCCTCTTCACCTGGGCCC
3441 TGGAAAAGCCGATGGAAAAAGTCTGTTCCTGCAGCCAAGGCCTGGGTCCCAGGTGACTAGGAGTAGCCATAGGAAGGTGA
3521 GGAAGGAGAAGTGGGCATGTGGTGTCATCTGTAGTCCAAGGTCTCTGCGTCTCGTCAGTGGGTGCAGTGCCTTCCCCCTC
3601 AGGTGTGAGCGTGATGGACTCTAGACTGCCTTCCATGAGTGTTGGTCATGCTATGATGTCATCATTTGCCATTAAAACCC
3681 AGTTTGTATGATGCCAAGAGGATTAATTGTGCAAGTGACTGATTCATTTAAATTGTAATCACATCCCTTTTCTGCTTCAC
3761 CAACCTGAACTGTTTTTAAAAATATCATTAAAAGTCTGTTCTCTTTCCTTTTGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAA--UACACGACGAu 5'
            ||:|:  ||  || ||||||| 
Target 5' agCAGATGTTTTGATTTGCTGCTt 3'
191 - 214 158.00 -11.50
2
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            ||:|| :  :|| |||||:| 
Target 5' ttCAGACAG--GTGATGCTGTTg 3'
2712 - 2732 136.00 -15.10
3
miRNA  3' guGUU-UGGUAAUACACGACGau 5'
            |:| || | |:  ||||||  
Target 5' agCGACACAACTGCCTGCTGCct 3'
377 - 399 132.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30153383 7 COSMIC
COSN30107353 16 COSMIC
COSN26650254 35 COSMIC
COSN30495640 36 COSMIC
COSN30147484 37 COSMIC
COSN30149594 56 COSMIC
COSN31560527 75 COSMIC
COSN30166397 127 COSMIC
COSN31485940 138 COSMIC
COSN24305260 143 COSMIC
COSN31522868 170 COSMIC
COSN7050749 241 COSMIC
COSN19655907 381 COSMIC
COSN8749181 827 COSMIC
COSN23263401 850 COSMIC
COSN28148253 1095 COSMIC
COSN6277874 1182 COSMIC
COSN17817727 1280 COSMIC
COSN27494387 1520 COSMIC
COSN16229156 1521 COSMIC
COSN23745174 1521 COSMIC
COSN16217906 1567 COSMIC
COSN8749182 2377 COSMIC
COSN17068701 2857 COSMIC
rs2649 3569 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs893209160 3 dbSNP
rs946149158 4 dbSNP
rs772552303 5 dbSNP
rs762683443 11 dbSNP
rs1162613462 13 dbSNP
rs1351477578 13 dbSNP
rs1415058113 15 dbSNP
rs752772188 17 dbSNP
rs1170722677 18 dbSNP
rs1355997169 19 dbSNP
rs747905340 23 dbSNP
rs1297528763 24 dbSNP
rs181592916 25 dbSNP
rs774046076 28 dbSNP
rs761176505 41 dbSNP
rs377232448 42 dbSNP
rs1215326771 43 dbSNP
rs754432620 45 dbSNP
rs1249207260 59 dbSNP
rs374557745 59 dbSNP
rs530605991 63 dbSNP
rs978093311 68 dbSNP
rs1365383763 69 dbSNP
rs925300915 72 dbSNP
rs1220947569 86 dbSNP
rs542672617 90 dbSNP
rs1359137993 97 dbSNP
rs560839795 98 dbSNP
rs1287246242 101 dbSNP
rs186257718 102 dbSNP
rs1055623168 103 dbSNP
rs764481231 106 dbSNP
rs895199389 108 dbSNP
rs1387365443 112 dbSNP
rs1312217845 124 dbSNP
rs767165461 129 dbSNP
rs1247346143 143 dbSNP
rs1360913234 146 dbSNP
rs547680542 150 dbSNP
rs1260717083 153 dbSNP
rs566020973 154 dbSNP
rs1451363317 156 dbSNP
rs1362797478 164 dbSNP
rs1035025354 165 dbSNP
rs1485188404 166 dbSNP
rs894608448 171 dbSNP
rs1264697743 172 dbSNP
rs1197872209 173 dbSNP
rs1490347459 176 dbSNP
rs117047171 180 dbSNP
rs138044573 181 dbSNP
rs1461001996 183 dbSNP
rs1182033241 190 dbSNP
rs897438723 197 dbSNP
rs1260314291 199 dbSNP
rs962428098 199 dbSNP
rs972485007 203 dbSNP
rs1025245026 204 dbSNP
rs1281518401 210 dbSNP
rs1404253082 213 dbSNP
rs1340976707 216 dbSNP
rs994433080 223 dbSNP
rs1245013621 232 dbSNP
rs955055434 234 dbSNP
rs1380260331 240 dbSNP
rs1027214323 241 dbSNP
rs1384009956 244 dbSNP
rs1172765432 245 dbSNP
rs1467300330 245 dbSNP
rs1136246 247 dbSNP
rs1445383472 248 dbSNP
rs560087437 250 dbSNP
rs1165378936 251 dbSNP
rs1477866617 255 dbSNP
rs371565475 255 dbSNP
rs546001230 255 dbSNP
rs1264459482 258 dbSNP
rs888113768 263 dbSNP
rs1196497785 264 dbSNP
rs1451545043 265 dbSNP
rs1160040512 270 dbSNP
rs1445599073 270 dbSNP
rs1389130264 272 dbSNP
rs375985158 272 dbSNP
rs1451430704 274 dbSNP
rs1484398008 276 dbSNP
rs754189617 279 dbSNP
rs1261499987 287 dbSNP
rs911133034 290 dbSNP
rs868064256 296 dbSNP
rs1006523514 297 dbSNP
rs1279969086 304 dbSNP
rs765615834 304 dbSNP
rs1018474584 306 dbSNP
rs1384351531 311 dbSNP
rs965153877 311 dbSNP
rs1325613513 315 dbSNP
rs773219945 325 dbSNP
rs1334644523 328 dbSNP
rs1396052029 328 dbSNP
rs569683082 335 dbSNP
rs990383051 337 dbSNP
rs1305684554 339 dbSNP
rs914442467 344 dbSNP
rs1425191098 347 dbSNP
rs868376387 348 dbSNP
rs1315612692 351 dbSNP
rs1170116741 353 dbSNP
rs1241836694 356 dbSNP
rs946098269 358 dbSNP
rs1372862471 370 dbSNP
rs977014853 380 dbSNP
rs74571066 381 dbSNP
rs555785932 383 dbSNP
rs1202002601 385 dbSNP
rs967155904 389 dbSNP
rs1241467501 392 dbSNP
rs1265294239 393 dbSNP
rs1458242886 401 dbSNP
rs62012781 406 dbSNP
rs188517426 411 dbSNP
rs938670209 416 dbSNP
rs1056009564 417 dbSNP
rs1246646180 418 dbSNP
rs894715750 422 dbSNP
rs1313873345 425 dbSNP
rs1006507150 428 dbSNP
rs1038262128 431 dbSNP
rs1326358357 434 dbSNP
rs936684662 444 dbSNP
rs1248544605 445 dbSNP
rs898021663 446 dbSNP
rs552939721 448 dbSNP
rs1183960984 453 dbSNP
rs1396331234 453 dbSNP
rs1446779397 455 dbSNP
rs577982617 463 dbSNP
rs1183198656 467 dbSNP
rs1412394959 473 dbSNP
rs147151352 482 dbSNP
rs557306509 485 dbSNP
rs1469155693 491 dbSNP
rs575283651 492 dbSNP
rs1179673764 495 dbSNP
rs993849818 496 dbSNP
rs1290447681 497 dbSNP
rs1211598735 498 dbSNP
rs1025356706 499 dbSNP
rs990830416 500 dbSNP
rs916693721 501 dbSNP
rs1378571566 503 dbSNP
rs1277423099 507 dbSNP
rs949481010 513 dbSNP
rs181290084 520 dbSNP
rs1017975295 529 dbSNP
rs1324745230 531 dbSNP
rs964294356 534 dbSNP
rs1364085585 538 dbSNP
rs1163414958 541 dbSNP
rs770462654 549 dbSNP
rs1410371108 555 dbSNP
rs1157072359 556 dbSNP
rs773783037 556 dbSNP
rs1247408797 562 dbSNP
rs1370603210 562 dbSNP
rs753767302 563 dbSNP
rs1201476146 568 dbSNP
rs1046887376 574 dbSNP
rs1489856218 578 dbSNP
rs897345844 580 dbSNP
rs1268101689 584 dbSNP
rs1393617009 586 dbSNP
rs1216996583 589 dbSNP
rs1318525859 591 dbSNP
rs990108927 595 dbSNP
rs1222888227 596 dbSNP
rs1345257552 597 dbSNP
rs1222004113 599 dbSNP
rs914387774 601 dbSNP
rs1407288349 604 dbSNP
rs1344107495 605 dbSNP
rs1303098419 619 dbSNP
rs560996198 631 dbSNP
rs977468162 638 dbSNP
rs1048684896 639 dbSNP
rs1425944071 643 dbSNP
rs1178758534 644 dbSNP
rs1204119417 645 dbSNP
rs569470403 648 dbSNP
rs1481681034 650 dbSNP
rs528212370 652 dbSNP
rs1486705631 653 dbSNP
rs1240187365 654 dbSNP
rs114228149 658 dbSNP
rs1214613195 658 dbSNP
rs757160698 666 dbSNP
rs1007006467 671 dbSNP
rs1322249106 672 dbSNP
rs942257645 674 dbSNP
rs1196968706 680 dbSNP
rs115106040 686 dbSNP
rs778992803 688 dbSNP
rs997959022 689 dbSNP
rs1019969457 691 dbSNP
rs116696077 696 dbSNP
rs1308120906 698 dbSNP
rs1405489311 699 dbSNP
rs890866766 703 dbSNP
rs1403668216 705 dbSNP
rs148486263 707 dbSNP
rs1368805522 709 dbSNP
rs1185646129 713 dbSNP
rs1473013651 714 dbSNP
rs1244550981 720 dbSNP
rs1201424279 721 dbSNP
rs1018337001 726 dbSNP
rs978533034 728 dbSNP
rs899513092 731 dbSNP
rs1032927441 732 dbSNP
rs958649811 733 dbSNP
rs374351607 739 dbSNP
rs916596429 742 dbSNP
rs767106078 746 dbSNP
rs1317386794 748 dbSNP
rs1450787389 753 dbSNP
rs1405419685 755 dbSNP
rs971110201 758 dbSNP
rs1338391215 760 dbSNP
rs1332204896 763 dbSNP
rs368536276 769 dbSNP
rs779525240 770 dbSNP
rs1352629322 779 dbSNP
rs1490152190 780 dbSNP
rs918639507 784 dbSNP
rs750534158 785 dbSNP
rs1220232612 786 dbSNP
rs1048589937 788 dbSNP
rs910159585 792 dbSNP
rs538405745 793 dbSNP
rs570018658 798 dbSNP
rs973586714 801 dbSNP
rs1479380417 805 dbSNP
rs139463591 807 dbSNP
rs370042149 807 dbSNP
rs554432738 813 dbSNP
rs549151157 816 dbSNP
rs185841582 824 dbSNP
rs191085227 827 dbSNP
rs1307990033 830 dbSNP
rs1393166121 832 dbSNP
rs1384090667 836 dbSNP
rs760962249 841 dbSNP
rs553187699 850 dbSNP
rs1367194690 851 dbSNP
rs1000026819 852 dbSNP
rs1161516594 853 dbSNP
rs1423772864 854 dbSNP
rs943759119 858 dbSNP
rs571432348 860 dbSNP
rs1416759546 863 dbSNP
rs899464792 864 dbSNP
rs1350826337 865 dbSNP
rs1430388848 866 dbSNP
rs1271686485 867 dbSNP
rs372908092 870 dbSNP
rs1364300059 871 dbSNP
rs1359200178 877 dbSNP
rs1261495510 878 dbSNP
rs1241502829 881 dbSNP
rs1021342467 882 dbSNP
rs764509116 884 dbSNP
rs1315181671 886 dbSNP
rs1306462676 892 dbSNP
rs1405478884 893 dbSNP
rs903095713 897 dbSNP
rs1301231933 899 dbSNP
rs1404059168 900 dbSNP
rs116484228 903 dbSNP
rs575618291 921 dbSNP
rs149655439 925 dbSNP
rs879896275 926 dbSNP
rs1023051141 931 dbSNP
rs982099575 931 dbSNP
rs1432016938 936 dbSNP
rs1322269002 938 dbSNP
rs918699777 939 dbSNP
rs1207110226 940 dbSNP
rs747284526 944 dbSNP
rs754352107 945 dbSNP
rs1214723523 951 dbSNP
rs757748908 956 dbSNP
rs552011265 961 dbSNP
rs1240171180 962 dbSNP
rs878906973 968 dbSNP
rs1325786961 979 dbSNP
rs951440460 981 dbSNP
rs1465933711 992 dbSNP
rs1222876480 994 dbSNP
rs554312478 995 dbSNP
rs769034921 998 dbSNP
rs572882006 1001 dbSNP
rs1442313097 1013 dbSNP
rs1166002571 1014 dbSNP
rs973367620 1018 dbSNP
rs938130542 1025 dbSNP
rs910058964 1026 dbSNP
rs929540413 1029 dbSNP
rs751136463 1031 dbSNP
rs111497513 1035 dbSNP
rs374557529 1035 dbSNP
rs1195699024 1037 dbSNP
rs1347366195 1039 dbSNP
rs942822532 1041 dbSNP
rs1336403823 1045 dbSNP
rs1261401434 1046 dbSNP
rs1462692438 1046 dbSNP
rs1202954009 1051 dbSNP
rs1380664433 1053 dbSNP
rs539919356 1056 dbSNP
rs1339916497 1057 dbSNP
rs1271866886 1058 dbSNP
rs1224902068 1063 dbSNP
rs144135041 1063 dbSNP
rs763002639 1063 dbSNP
rs534283671 1065 dbSNP
rs922815210 1069 dbSNP
rs564662126 1072 dbSNP
rs1041344982 1073 dbSNP
rs758575562 1074 dbSNP
rs1281851692 1078 dbSNP
rs1330998293 1082 dbSNP
rs1208959265 1083 dbSNP
rs902874701 1083 dbSNP
rs902978182 1083 dbSNP
rs1241535927 1084 dbSNP
rs999912263 1084 dbSNP
rs1186852886 1090 dbSNP
rs1438482883 1091 dbSNP
rs780368976 1096 dbSNP
rs1194043316 1097 dbSNP
rs1459705728 1099 dbSNP
rs894328963 1101 dbSNP
rs1057084343 1107 dbSNP
rs895599825 1107 dbSNP
rs991002488 1110 dbSNP
rs1237573325 1111 dbSNP
rs1313943337 1111 dbSNP
rs1023253439 1116 dbSNP
rs144623296 1134 dbSNP
rs994903289 1141 dbSNP
rs1176030163 1146 dbSNP
rs769711378 1153 dbSNP
rs1164532429 1155 dbSNP
rs1426956468 1155 dbSNP
rs1026247746 1164 dbSNP
rs950730438 1165 dbSNP
rs148473726 1167 dbSNP
rs1176182491 1170 dbSNP
rs1003584705 1171 dbSNP
rs182704240 1174 dbSNP
rs531155498 1175 dbSNP
rs1224366294 1180 dbSNP
rs1354056237 1180 dbSNP
rs773786120 1182 dbSNP
rs759046879 1183 dbSNP
rs974932860 1189 dbSNP
rs1352197606 1191 dbSNP
rs549337708 1197 dbSNP
rs368433457 1198 dbSNP
rs1304300203 1205 dbSNP
rs975971547 1206 dbSNP
rs1407099834 1210 dbSNP
rs1364139777 1219 dbSNP
rs922899736 1220 dbSNP
rs1228716914 1228 dbSNP
rs1401566519 1232 dbSNP
rs1410249972 1243 dbSNP
rs915425750 1244 dbSNP
rs934239572 1245 dbSNP
rs8043465 1251 dbSNP
rs1042847120 1253 dbSNP
rs1201542246 1253 dbSNP
rs931781333 1255 dbSNP
rs1201872306 1264 dbSNP
rs1278677139 1266 dbSNP
rs1216058654 1267 dbSNP
rs934322702 1270 dbSNP
rs1281715375 1273 dbSNP
rs1207497653 1274 dbSNP
rs1203024183 1278 dbSNP
rs1057240451 1279 dbSNP
rs935647620 1280 dbSNP
rs1054226584 1281 dbSNP
rs187274268 1285 dbSNP
rs1427663209 1288 dbSNP
rs1431943010 1293 dbSNP
rs1044217971 1302 dbSNP
rs1316526020 1306 dbSNP
rs948605258 1308 dbSNP
rs1045973379 1311 dbSNP
rs1479114662 1314 dbSNP
rs899010433 1315 dbSNP
rs1168949068 1322 dbSNP
rs1178476003 1327 dbSNP
rs907151585 1329 dbSNP
rs1479452942 1332 dbSNP
rs994850982 1338 dbSNP
rs993422457 1339 dbSNP
rs1476283289 1340 dbSNP
rs1239959654 1345 dbSNP
rs1187579564 1351 dbSNP
rs1026362772 1356 dbSNP
rs1408335949 1365 dbSNP
rs1026196840 1366 dbSNP
rs950678092 1368 dbSNP
rs1206120407 1370 dbSNP
rs1310892568 1371 dbSNP
rs146481737 1373 dbSNP
rs1019399812 1374 dbSNP
rs1364562847 1375 dbSNP
rs1005525785 1376 dbSNP
rs1017047169 1378 dbSNP
rs571771575 1379 dbSNP
rs538795688 1380 dbSNP
rs192115687 1385 dbSNP
rs975644971 1387 dbSNP
rs775088809 1388 dbSNP
rs374332026 1390 dbSNP
rs577049681 1390 dbSNP
rs915389506 1390 dbSNP
rs1417185912 1392 dbSNP
rs1187523702 1394 dbSNP
rs1444937516 1395 dbSNP
rs1030233512 1396 dbSNP
rs1181154313 1397 dbSNP
rs1482658403 1403 dbSNP
rs978473561 1405 dbSNP
rs1205881458 1408 dbSNP
rs1309611597 1415 dbSNP
rs1273008100 1416 dbSNP
rs1228128701 1425 dbSNP
rs955502859 1427 dbSNP
rs8023506 1438 dbSNP
rs1275139433 1442 dbSNP
rs1394324195 1445 dbSNP
rs1466585528 1452 dbSNP
rs536181844 1465 dbSNP
rs1378582899 1468 dbSNP
rs1338362189 1469 dbSNP
rs924840071 1471 dbSNP
rs1444360817 1480 dbSNP
rs1212231974 1483 dbSNP
rs1056786418 1493 dbSNP
rs1483638286 1499 dbSNP
rs1161321292 1507 dbSNP
rs11311204 1508 dbSNP
rs1204822420 1508 dbSNP
rs1250263376 1508 dbSNP
rs1422698080 1508 dbSNP
rs1481946936 1508 dbSNP
rs76836079 1508 dbSNP
rs916924290 1508 dbSNP
rs1490624456 1509 dbSNP
rs948639475 1509 dbSNP
rs1222458394 1510 dbSNP
rs935699821 1514 dbSNP
rs1307878219 1517 dbSNP
rs1225546323 1520 dbSNP
rs1348495666 1520 dbSNP
rs1307368074 1521 dbSNP
rs370937630 1521 dbSNP
rs990205193 1522 dbSNP
rs1199834212 1529 dbSNP
rs1372661004 1530 dbSNP
rs1474551671 1531 dbSNP
rs1457146611 1532 dbSNP
rs200320067 1532 dbSNP
rs1160577430 1533 dbSNP
rs1390921748 1534 dbSNP
rs898967420 1536 dbSNP
rs758910691 1537 dbSNP
rs1182141253 1539 dbSNP
rs1410345608 1539 dbSNP
rs76115381 1540 dbSNP
rs1488239526 1541 dbSNP
rs572724877 1548 dbSNP
rs1395121804 1549 dbSNP
rs72750961 1554 dbSNP
rs1388241559 1555 dbSNP
rs1327204204 1556 dbSNP
rs1323975538 1557 dbSNP
rs1224103675 1558 dbSNP
rs1347150815 1565 dbSNP
rs915703501 1568 dbSNP
rs886520523 1571 dbSNP
rs1009426780 1575 dbSNP
rs1018930243 1585 dbSNP
rs1387332468 1586 dbSNP
rs900520461 1589 dbSNP
rs1470626730 1594 dbSNP
rs1432087952 1604 dbSNP
rs1197131932 1605 dbSNP
rs1432992183 1608 dbSNP
rs558191486 1609 dbSNP
rs1188548237 1611 dbSNP
rs1267656035 1615 dbSNP
rs1463586411 1615 dbSNP
rs1045451463 1619 dbSNP
rs576571527 1621 dbSNP
rs11437615 1623 dbSNP
rs1326844357 1623 dbSNP
rs1432523585 1623 dbSNP
rs530238806 1623 dbSNP
rs1342299901 1625 dbSNP
rs1245874701 1626 dbSNP
rs1363822810 1626 dbSNP
rs545195478 1631 dbSNP
rs907037465 1641 dbSNP
rs1290290142 1642 dbSNP
rs1359091821 1644 dbSNP
rs1404921721 1644 dbSNP
rs1171371799 1647 dbSNP
rs563568490 1648 dbSNP
rs1261501298 1650 dbSNP
rs1374042502 1656 dbSNP
rs1170707877 1662 dbSNP
rs1445474616 1673 dbSNP
rs1447966862 1675 dbSNP
rs1190794885 1678 dbSNP
rs141318187 1690 dbSNP
rs1184227746 1694 dbSNP
rs1022978388 1695 dbSNP
rs968169724 1697 dbSNP
rs1339810629 1699 dbSNP
rs1252923190 1700 dbSNP
rs1225906612 1710 dbSNP
rs1444152735 1712 dbSNP
rs187399062 1718 dbSNP
rs1315336792 1719 dbSNP
rs1454083101 1725 dbSNP
rs143691237 1726 dbSNP
rs761741557 1727 dbSNP
rs1310172053 1730 dbSNP
rs1459411330 1735 dbSNP
rs1017344901 1740 dbSNP
rs1389737305 1743 dbSNP
rs1163571599 1747 dbSNP
rs899947101 1750 dbSNP
rs561647793 1758 dbSNP
rs1164491077 1763 dbSNP
rs955755007 1764 dbSNP
rs1366849483 1766 dbSNP
rs1186744182 1769 dbSNP
rs1384033358 1773 dbSNP
rs1455285224 1783 dbSNP
rs146803323 1786 dbSNP
rs1029725585 1795 dbSNP
rs1322207682 1812 dbSNP
rs955553457 1813 dbSNP
rs1482625250 1816 dbSNP
rs547024665 1819 dbSNP
rs1031909149 1823 dbSNP
rs957616712 1827 dbSNP
rs989866735 1832 dbSNP
rs569824128 1833 dbSNP
rs980002332 1844 dbSNP
rs920507930 1845 dbSNP
rs775119371 1851 dbSNP
rs1408352072 1852 dbSNP
rs1349068691 1854 dbSNP
rs930597484 1857 dbSNP
rs915569984 1858 dbSNP
rs1210808648 1864 dbSNP
rs969711925 1866 dbSNP
rs981616451 1867 dbSNP
rs928339312 1870 dbSNP
rs1407356126 1871 dbSNP
rs1461044807 1873 dbSNP
rs1181791746 1876 dbSNP
rs1388853549 1877 dbSNP
rs1162678868 1884 dbSNP
rs532697086 1889 dbSNP
rs1414040354 1896 dbSNP
rs1179978065 1898 dbSNP
rs929151850 1899 dbSNP
rs550770663 1902 dbSNP
rs886298271 1903 dbSNP
rs1223314258 1909 dbSNP
rs944786154 1917 dbSNP
rs1188208792 1925 dbSNP
rs1363003639 1926 dbSNP
rs1471518747 1929 dbSNP
rs1161118933 1930 dbSNP
rs1352264046 1931 dbSNP
rs1290728119 1932 dbSNP
rs1284252891 1933 dbSNP
rs1491184613 1933 dbSNP
rs764921888 1933 dbSNP
rs1156840911 1934 dbSNP
rs1429917048 1934 dbSNP
rs1439066572 1934 dbSNP
rs1456703998 1934 dbSNP
rs1491376901 1934 dbSNP
rs34923651 1934 dbSNP
rs397792308 1934 dbSNP
rs1192657027 1935 dbSNP
rs900467052 1940 dbSNP
rs1468996217 1942 dbSNP
rs1245732189 1947 dbSNP
rs1300515891 1948 dbSNP
rs1403772240 1949 dbSNP
rs200817888 1950 dbSNP
rs1306987821 1952 dbSNP
rs1265764023 1953 dbSNP
rs1349193869 1954 dbSNP
rs1230553525 1955 dbSNP
rs1289408470 1956 dbSNP
rs1279980317 1960 dbSNP
rs1221251980 1966 dbSNP
rs996584093 1968 dbSNP
rs1022338588 1971 dbSNP
rs1431827216 1977 dbSNP
rs114855800 1985 dbSNP
rs1318552088 1999 dbSNP
rs1202060122 2001 dbSNP
rs536471746 2004 dbSNP
rs765261652 2008 dbSNP
rs1406670826 2015 dbSNP
rs760373771 2020 dbSNP
rs1178182521 2024 dbSNP
rs999801802 2031 dbSNP
rs1031151177 2033 dbSNP
rs1038914481 2045 dbSNP
rs960875791 2047 dbSNP
rs34042723 2053 dbSNP
rs992555043 2061 dbSNP
rs1483655879 2093 dbSNP
rs1200947385 2095 dbSNP
rs1187332274 2097 dbSNP
rs1461401291 2117 dbSNP
rs1238524372 2123 dbSNP
rs1212920539 2127 dbSNP
rs112614528 2129 dbSNP
rs1471571774 2135 dbSNP
rs980170477 2137 dbSNP
rs1295712574 2142 dbSNP
rs920292565 2144 dbSNP
rs1383674722 2146 dbSNP
rs1304496129 2147 dbSNP
rs1445815319 2149 dbSNP
rs930545072 2154 dbSNP
rs1412463979 2155 dbSNP
rs775710486 2157 dbSNP
rs1431422230 2158 dbSNP
rs1479889008 2163 dbSNP
rs996832362 2176 dbSNP
rs1444692194 2179 dbSNP
rs983352579 2180 dbSNP
rs944547378 2184 dbSNP
rs1051153821 2185 dbSNP
rs1237428559 2186 dbSNP
rs191573761 2213 dbSNP
rs999020016 2219 dbSNP
rs1272719469 2221 dbSNP
rs533536407 2225 dbSNP
rs1466054281 2228 dbSNP
rs1322397657 2231 dbSNP
rs371429284 2232 dbSNP
rs570190314 2235 dbSNP
rs540310028 2236 dbSNP
rs1023193319 2237 dbSNP
rs560020832 2238 dbSNP
rs758531332 2239 dbSNP
rs1307014034 2240 dbSNP
rs1424981519 2248 dbSNP
rs1351261831 2252 dbSNP
rs1308998109 2253 dbSNP
rs1422753902 2255 dbSNP
rs1413660599 2257 dbSNP
rs1183589607 2262 dbSNP
rs1345317188 2265 dbSNP
rs1473765989 2269 dbSNP
rs1250144139 2270 dbSNP
rs1204894642 2271 dbSNP
rs1488894263 2285 dbSNP
rs766606799 2291 dbSNP
rs1217681032 2293 dbSNP
rs1321236933 2293 dbSNP
rs1268663282 2296 dbSNP
rs981116323 2299 dbSNP
rs1303748763 2303 dbSNP
rs1313008027 2305 dbSNP
rs369251196 2307 dbSNP
rs1387150428 2311 dbSNP
rs1226693614 2314 dbSNP
rs556239232 2314 dbSNP
rs1291465338 2317 dbSNP
rs1456942955 2319 dbSNP
rs1388798954 2324 dbSNP
rs1160543835 2325 dbSNP
rs950444066 2329 dbSNP
rs372414807 2332 dbSNP
rs1482004036 2342 dbSNP
rs932113747 2343 dbSNP
rs1410413198 2349 dbSNP
rs1181845872 2351 dbSNP
rs1434149327 2355 dbSNP
rs754193264 2358 dbSNP
rs1189745192 2359 dbSNP
rs903873142 2362 dbSNP
rs999748723 2363 dbSNP
rs1052693987 2364 dbSNP
rs1326923744 2366 dbSNP
rs896611566 2368 dbSNP
rs941832482 2383 dbSNP
rs1023837748 2392 dbSNP
rs1039378812 2399 dbSNP
rs1385933032 2408 dbSNP
rs1365473972 2415 dbSNP
rs1189264925 2432 dbSNP
rs921860707 2438 dbSNP
rs138339977 2441 dbSNP
rs1051046036 2446 dbSNP
rs951729550 2448 dbSNP
rs1169080840 2449 dbSNP
rs1379791062 2455 dbSNP
rs1174214196 2462 dbSNP
rs983298615 2467 dbSNP
rs115222466 2469 dbSNP
rs1190539271 2478 dbSNP
rs1463626207 2490 dbSNP
rs1247311741 2491 dbSNP
rs1201019693 2494 dbSNP
rs573520112 2501 dbSNP
rs149213271 2506 dbSNP
rs755179274 2512 dbSNP
rs565304163 2521 dbSNP
rs532634500 2525 dbSNP
rs1011717876 2526 dbSNP
rs146846974 2531 dbSNP
rs906096470 2533 dbSNP
rs925238890 2534 dbSNP
rs1318232186 2544 dbSNP
rs74018138 2545 dbSNP
rs529812124 2546 dbSNP
rs1301403746 2555 dbSNP
rs1434514258 2559 dbSNP
rs896721731 2561 dbSNP
rs1170765872 2562 dbSNP
rs114934937 2568 dbSNP
rs1372638717 2576 dbSNP
rs566651475 2577 dbSNP
rs74573277 2578 dbSNP
rs1199621546 2584 dbSNP
rs1321055134 2586 dbSNP
rs551741472 2592 dbSNP
rs1202655994 2597 dbSNP
rs139235860 2599 dbSNP
rs1284205708 2603 dbSNP
rs778243850 2604 dbSNP
rs1027368710 2609 dbSNP
rs1248267107 2611 dbSNP
rs749829925 2614 dbSNP
rs537468790 2615 dbSNP
rs1014626408 2626 dbSNP
rs1245657519 2631 dbSNP
rs758486615 2633 dbSNP
rs1396053690 2634 dbSNP
rs1163859191 2639 dbSNP
rs1473833766 2640 dbSNP
rs1450850651 2649 dbSNP
rs555937376 2649 dbSNP
rs966336302 2661 dbSNP
rs7171858 2675 dbSNP
rs1179753242 2676 dbSNP
rs536434120 2683 dbSNP
rs953246371 2684 dbSNP
rs1404126772 2688 dbSNP
rs987316913 2699 dbSNP
rs925354135 2700 dbSNP
rs935434213 2709 dbSNP
rs988125441 2711 dbSNP
rs912566138 2719 dbSNP
rs917950999 2721 dbSNP
rs1408405852 2722 dbSNP
rs949647835 2727 dbSNP
rs1167284326 2730 dbSNP
rs934639352 2742 dbSNP
rs1407128345 2743 dbSNP
rs1388738439 2750 dbSNP
rs1164121532 2751 dbSNP
rs1457641019 2756 dbSNP
rs182591365 2758 dbSNP
rs149293823 2764 dbSNP
rs1053144316 2774 dbSNP
rs1200615760 2774 dbSNP
rs893206665 2782 dbSNP
rs573554488 2783 dbSNP
rs3210904 2786 dbSNP
rs143577823 2801 dbSNP
rs1330363465 2803 dbSNP
rs116485530 2804 dbSNP
rs887521274 2807 dbSNP
rs1350464210 2812 dbSNP
rs1275646652 2816 dbSNP
rs75963081 2820 dbSNP
rs1014980470 2824 dbSNP
rs1325238274 2831 dbSNP
rs562834850 2833 dbSNP
rs997807589 2835 dbSNP
rs1156909034 2837 dbSNP
rs530261532 2839 dbSNP
rs1226588426 2841 dbSNP
rs1425683004 2843 dbSNP
rs1291726811 2844 dbSNP
rs1476801072 2849 dbSNP
rs1035902866 2852 dbSNP
rs1188592728 2853 dbSNP
rs1465891293 2855 dbSNP
rs886122303 2857 dbSNP
rs1446781331 2858 dbSNP
rs1279697940 2860 dbSNP
rs1221307485 2861 dbSNP
rs1302988901 2865 dbSNP
rs1367505150 2868 dbSNP
rs1318447115 2871 dbSNP
rs1430018434 2873 dbSNP
rs1359679881 2875 dbSNP
rs1335877896 2876 dbSNP
rs376707949 2878 dbSNP
rs1028911084 2882 dbSNP
rs1168888566 2882 dbSNP
rs1450776397 2883 dbSNP
rs1387853523 2884 dbSNP
rs1185434734 2895 dbSNP
rs777596112 2899 dbSNP
rs953312542 2905 dbSNP
rs1238579220 2907 dbSNP
rs188122739 2911 dbSNP
rs1004539808 2917 dbSNP
rs192651383 2923 dbSNP
rs1016453296 2925 dbSNP
rs1484919412 2931 dbSNP
rs1127937 2935 dbSNP
rs979249421 2945 dbSNP
rs1206211822 2951 dbSNP
rs1344406228 2967 dbSNP
rs963158286 2968 dbSNP
rs1265785619 2969 dbSNP
rs975017628 2974 dbSNP
rs1208764063 2975 dbSNP
rs1236407311 2986 dbSNP
rs1445506590 2990 dbSNP
rs956759568 3004 dbSNP
rs1308254215 3019 dbSNP
rs988263765 3020 dbSNP
rs917884777 3030 dbSNP
rs1028834334 3031 dbSNP
rs1368327065 3033 dbSNP
rs954508119 3034 dbSNP
rs987367757 3035 dbSNP
rs748998969 3036 dbSNP
rs1157408148 3046 dbSNP
rs1474424494 3054 dbSNP
rs934691224 3056 dbSNP
rs1183360990 3057 dbSNP
rs776409609 3060 dbSNP
rs988753392 3061 dbSNP
rs1336140995 3068 dbSNP
rs1357544880 3087 dbSNP
rs527500500 3088 dbSNP
rs887294079 3089 dbSNP
rs1291915956 3091 dbSNP
rs947484234 3099 dbSNP
rs940414937 3101 dbSNP
rs1354746216 3103 dbSNP
rs1288684307 3104 dbSNP
rs1285940628 3105 dbSNP
rs1036120227 3107 dbSNP
rs552024929 3109 dbSNP
rs747090360 3120 dbSNP
rs1297293004 3123 dbSNP
rs901466563 3134 dbSNP
rs1375448607 3136 dbSNP
rs761498913 3145 dbSNP
rs1167526256 3146 dbSNP
rs1460278204 3150 dbSNP
rs1286256813 3154 dbSNP
rs1029107805 3155 dbSNP
rs1330708930 3155 dbSNP
rs1473796499 3170 dbSNP
rs1248655117 3171 dbSNP
rs1176894441 3173 dbSNP
rs28688226 3174 dbSNP
rs570415614 3184 dbSNP
rs938806768 3190 dbSNP
rs1000806560 3192 dbSNP
rs1334006860 3194 dbSNP
rs546285239 3197 dbSNP
rs1277256041 3200 dbSNP
rs1440263792 3204 dbSNP
rs886675302 3206 dbSNP
rs76361954 3207 dbSNP
rs1032155332 3212 dbSNP
rs1314961166 3214 dbSNP
rs1305835999 3223 dbSNP
rs1238490844 3225 dbSNP
rs11071758 3226 dbSNP
rs1180411998 3230 dbSNP
rs763015716 3235 dbSNP
rs988600296 3239 dbSNP
rs1439555910 3245 dbSNP
rs1394343598 3247 dbSNP
rs1321858019 3250 dbSNP
rs568056858 3251 dbSNP
rs995943638 3253 dbSNP
rs1473026107 3266 dbSNP
rs1029137125 3272 dbSNP
rs1172284821 3282 dbSNP
rs1434044272 3286 dbSNP
rs1427503481 3290 dbSNP
rs1423132886 3291 dbSNP
rs1191874028 3297 dbSNP
rs1468059245 3305 dbSNP
rs1248592265 3307 dbSNP
rs971259990 3316 dbSNP
rs1334927758 3317 dbSNP
rs1259996259 3320 dbSNP
rs1359629031 3323 dbSNP
rs1409156662 3324 dbSNP
rs954558543 3328 dbSNP
rs1008671115 3331 dbSNP
rs1232964216 3333 dbSNP
rs766519004 3335 dbSNP
rs1299003845 3336 dbSNP
rs532044106 3342 dbSNP
rs952948175 3349 dbSNP
rs11457 3355 dbSNP
rs1342442890 3356 dbSNP
rs755163955 3359 dbSNP
rs548477706 3365 dbSNP
rs1171957728 3371 dbSNP
rs1342050225 3376 dbSNP
rs567034124 3382 dbSNP
rs1041647251 3383 dbSNP
rs1190587565 3386 dbSNP
rs923035235 3389 dbSNP
rs534398412 3391 dbSNP
rs796702732 3393 dbSNP
rs1484086891 3398 dbSNP
rs1173712333 3403 dbSNP
rs969082726 3408 dbSNP
rs1198609813 3435 dbSNP
rs1342432054 3438 dbSNP
rs1245129714 3440 dbSNP
rs980226657 3441 dbSNP
rs767632712 3452 dbSNP
rs888805161 3461 dbSNP
rs184541014 3462 dbSNP
rs1053714372 3466 dbSNP
rs117744815 3467 dbSNP
rs1434406415 3477 dbSNP
rs1009401013 3478 dbSNP
rs1025263074 3479 dbSNP
rs1410133530 3481 dbSNP
rs1372460272 3485 dbSNP
rs1188104694 3486 dbSNP
rs11857801 3493 dbSNP
rs970825351 3496 dbSNP
rs1255225952 3499 dbSNP
rs1483208319 3501 dbSNP
rs1193606216 3504 dbSNP
rs1338121770 3505 dbSNP
rs1328948808 3511 dbSNP
rs1438233803 3513 dbSNP
rs1002724341 3526 dbSNP
rs1274896503 3532 dbSNP
rs1033610980 3537 dbSNP
rs1337578261 3543 dbSNP
rs1291884992 3548 dbSNP
rs1226825701 3552 dbSNP
rs867240679 3558 dbSNP
rs984298119 3563 dbSNP
rs571859521 3564 dbSNP
rs2649 3569 dbSNP
rs556549890 3570 dbSNP
rs778137792 3574 dbSNP
rs749743057 3575 dbSNP
rs976931083 3578 dbSNP
rs574822614 3587 dbSNP
rs1209572173 3589 dbSNP
rs1050215319 3591 dbSNP
rs890184636 3592 dbSNP
rs1008723166 3595 dbSNP
rs1179154732 3596 dbSNP
rs1436727000 3597 dbSNP
rs373663562 3599 dbSNP
rs1211092674 3603 dbSNP
rs1199899879 3606 dbSNP
rs1050188095 3608 dbSNP
rs1271786304 3611 dbSNP
rs560235961 3619 dbSNP
rs1447796029 3620 dbSNP
rs190603913 3623 dbSNP
rs1237246370 3625 dbSNP
rs746495070 3628 dbSNP
rs1324341189 3629 dbSNP
rs547847668 3633 dbSNP
rs148210375 3636 dbSNP
rs1022607184 3637 dbSNP
rs141161032 3643 dbSNP
rs892380471 3643 dbSNP
rs980494517 3645 dbSNP
rs1156590349 3646 dbSNP
rs1009928567 3652 dbSNP
rs927403750 3654 dbSNP
rs1466717207 3655 dbSNP
rs775029776 3662 dbSNP
rs1251702788 3680 dbSNP
rs1213548798 3683 dbSNP
rs1286857642 3685 dbSNP
rs1326242486 3685 dbSNP
rs1046212274 3689 dbSNP
rs10018 3691 dbSNP
rs192549124 3695 dbSNP
rs1364031357 3696 dbSNP
rs1275624286 3710 dbSNP
rs960105064 3718 dbSNP
rs1368804361 3719 dbSNP
rs1302591409 3722 dbSNP
rs1435808256 3724 dbSNP
rs1399863940 3726 dbSNP
rs150712603 3726 dbSNP
rs1033727258 3737 dbSNP
rs367840250 3738 dbSNP
rs1175073537 3741 dbSNP
rs1366492400 3743 dbSNP
rs908044836 3746 dbSNP
rs746633245 3752 dbSNP
rs1452041685 3761 dbSNP
rs940832830 3764 dbSNP
rs1188629277 3765 dbSNP
rs952837762 3766 dbSNP
rs768270434 3776 dbSNP
rs549486173 3778 dbSNP
rs1282753437 3782 dbSNP
rs1446737624 3785 dbSNP
rs920832162 3786 dbSNP
rs1213205214 3791 dbSNP
rs139217717 3792 dbSNP
rs1279776814 3800 dbSNP
rs1210646160 3804 dbSNP
rs961629921 3806 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.732 1.2e-4 0.717 1.9e-4 20 Click to see details
GSE21032 Prostate cancer 0.358 4.5e-4 0.277 5.6e-3 83 Click to see details
GSE17498 Multiple myeloma -0.343 1.5e-2 -0.163 1.6e-1 40 Click to see details
GSE28260 Renal cortex and medulla -0.562 2.3e-2 -0.533 3.0e-2 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.353 4.5e-2 -0.316 6.6e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.347 6.7e-2 -0.338 7.2e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.302 7.1e-2 0.441 1.4e-2 25 Click to see details
GSE19783 ER- ER- breast cancer 0.157 8.4e-2 0.114 1.6e-1 79 Click to see details
GSE27834 Pluripotent stem cells 0.324 1.1e-1 0.335 1.0e-1 16 Click to see details
GSE17306 Multiple myeloma -0.153 1.5e-1 -0.260 3.6e-2 49 Click to see details
GSE14794 Lymphoblastoid cells -0.104 1.6e-1 -0.008 4.7e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.169 2.1e-1 -0.003 4.9e-1 25 Click to see details
GSE28544 Breast cancer -0.163 2.2e-1 -0.469 1.0e-2 24 Click to see details
GSE19350 CNS germ cell tumors 0.227 2.4e-1 -0.056 4.3e-1 12 Click to see details
GSE21849 B cell lymphoma -0.128 2.5e-1 -0.197 1.5e-1 29 Click to see details
GSE19536 Breast cancer 0.057 2.9e-1 0.054 3.0e-1 100 Click to see details
GSE21687 Ependynoma primary tumors -0.062 3.1e-1 -0.168 9.2e-2 64 Click to see details
GSE32688 Pancreatic cancer -0.059 3.7e-1 0.044 4.1e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.065 3.8e-1 0.104 3.2e-1 23 Click to see details
GSE38226 Liver fibrosis 0.046 4.2e-1 0.055 4.1e-1 21 Click to see details
GSE38226 Liver fibrosis 0.046 4.2e-1 0.055 4.1e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.28 0.03 -0.165 0.13 49 Click to see details
ESCA -0.507 0.06 -0.482 0.07 11 Click to see details
KIRC 0.179 0.07 0.272 0.01 68 Click to see details
BRCA -0.111 0.16 -0.129 0.12 84 Click to see details
HNSC -0.153 0.17 -0.124 0.22 42 Click to see details
KICH 0.2 0.17 0.120 0.28 25 Click to see details
BLCA 0.235 0.17 0.112 0.33 18 Click to see details
STAD 0.168 0.18 0.199 0.14 32 Click to see details
PAAD 0.615 0.19 0.200 0.4 4 Click to see details
KIRP 0.152 0.2 0.066 0.36 32 Click to see details
COAD -0.306 0.23 -0.476 0.12 8 Click to see details
PRAD 0.086 0.28 0.050 0.37 50 Click to see details
CHOL -0.203 0.3 0.150 0.35 9 Click to see details
CESC 0.563 0.31 0.500 0.33 3 Click to see details
UCEC -0.111 0.33 -0.021 0.47 19 Click to see details
PCPG -0.425 0.36 -0.500 0.33 3 Click to see details
THCA 0.036 0.39 -0.080 0.27 59 Click to see details
LUAD -0.054 0.43 -0.084 0.4 12 Click to see details
LUSC -0.025 0.44 0.025 0.44 38 Click to see details
LUSC -0.025 0.44 0.025 0.44 38 Click to see details
LUSC -0.025 0.44 0.025 0.44 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1