miRTarBase - #MIRT726166 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol USP31   
Synonyms -
Description ubiquitin specific peptidase 31
Transcript NM_020718   
Expression
Putative miRNA Targets on USP31
3'UTR of USP31
(miRNA target sites are highlighted)
>USP31|NM_020718|3'UTR
   1 TATTTCTGCAATCAAAGTGTTTTATCTGTAAAGATGTTTATTTATTTAGAACCCCTGCCCTCCCACCAAAGCCTCCTGTG
  81 CTTTTGTTTTGTACTTTTTTGAGTCACGTGCCCGACTGTGTGTGTGTGTGTGAGTGTATGCGTGTGTGTGTCTAATTCAA
 161 TTGCAAATTGTTCAAAGCGTCGCCTTATTCTGCCATTGAACCAAATAACAGCCATAGGCAAAACATTGACACCAAGCTAA
 241 CTGGAATAATTGTAGACGATACCCAGGACGGTCCCTTTAGCAATTGTACATATTTCTTTCTAGAGAACTCTAATGACTTT
 321 CTTTGGATATGAGGGTTTTGAAACCTGTGAACCAGAAAAGCTACCATTAGTGCGTAGAAGGAGGAAGGAGCTGACTCGTG
 401 TTTCTTCTGAGCAGGACTTGTCCTTACTGTGGATTGTGGGTGGCACCAGGAGCTCTAAAAACTGTGACTCTAACAACGAA
 481 ACAAATCGAGGGAAAAACTCTTGCTTTCTGCACTTTCGCCCCATCTACCAGTCTTTGTAAAGGGCAATATTTTAACACTA
 561 ATGTTTCTCAGGTATATACTCAGCTAGTCTAGGATGGTTGCACACCAGTAAATGGATTAAAGAGGAAGGTGCCATGTGGG
 641 TGACTGTGTCATTTCTCCTACTGCCACAGATAGACATTTTCGAGGTAGAAATGAAGCCTTTCACCACCTTCCTATCTGTG
 721 GTGACATGTGCACCAAAACCTGTCTTGACTCTTGGGATAGGTCCTAGGAAGTGGCAGATTGGATAGCCAGAAAGCCAGTC
 801 ACTCGTTTAATTTTTTTTCCTTCTGAAATTACTAGCTAAGGCTCTTGGAATTTTGCACTGTAGTAGAGCAGTTAACACCT
 881 TTGACAGATTCCTGGAAAAAACTTCTAGATTCTAAACTGGGTGAAAGACTGGACATCATTTTCCTTGTCAGGTGTTGCAT
 961 TTTTCCGTTAGAGGTGGGAAGCTCCACGATGCCCTGTGTCTGTGGGCTCATGTTCCCTCATCTTGTAGCTTGGAGAGGAA
1041 AGAAGTTGCCTTCTGCCAAAAGCCAATGGTGGTATGTTGAAGCGTTGTGTGATCAAGTGTTACATATGCACTTCAGATCC
1121 TGTCTGTCAGTCTCTGTTAGGGCTGCCTTTCAGTAACTCATTTATTATTTCTTCTTTGTTCTTAAGATTTCATCTCATGC
1201 CCAGAACTCACAAGCAGGTTTTGGAGTGTGTTCCATCTGGCCGTGTCAGTGCAAATTGCATTTCTTACAAAGGAGAACCT
1281 CACCAAAAAAAACCTCACAGATAAGCAAAGTATATAGTTTTGCAAGCTTTTTCAAGGTCTCCTGGCAATACTTTCCTGCT
1361 CAATTTTTAGCTTTTCTTTTTTTTTTAAATGTCAAGAGAGTGAAGGTCTTGATTCTCTCTGAATAGCATTTGTCACTTTG
1441 CCAGTAAATACAGCATGCTAAGTTTATGTGCTTTTAAATATTAGCGTTTTTCGTCAGACTCTTCAAGTTCTTCTTGAACC
1521 CTTGGTGCACAGATCCATATATAACCTCCCTTTTCAGTATTGCTGTGTGTGAATTAACTACAACACATATGCATGCATAG
1601 CTGTGAATTCTGCACTACTTTTTTTTTCTTTTTTCCCCCCAAGAATATCTCTTGGGAAAAGTTTTTAGTACGTTACTTAA
1681 CTTTATTTTGCTGCTAATTTGCGCATTAGCCGGTAACTTGCAAGTCTGGAGACCACTTACTGTTGAGGGTAGCTGGAATT
1761 TTAGACCCTTGGCAGTATTTAAGATTTAGACATTTAGCCTTGTGAAAGTTACCACAGTGCTCCATGTGATTCATTGACTG
1841 TGAGCCTGTTGTCCATTGCACTCAGCCCTGTACTCACTTCTTCACTCGCTGTCCTGGTTTTACTGTTCAGATTTTGGTGG
1921 GTTCTCAAAGCAGTACCACTCTCATCTGCTCAGTACATCTGCGGCAACTGGCTGCCTTCGATGCTGTCATTGCGTTCAGC
2001 CCAGCACATCACAGCCCCATCAGTGTGTAGCCACCGCTCTCGTTTTTCTGTATCGCTTTTATCTCCTGAAAAAGATGCAC
2081 CAAATAAGAGATCATCTATATCAGGAATTGAATGTCTAACTCAAACCTCTCATTTTTGTTTAATAGGTAGATCTCATTTG
2161 AAGTCTCCTATCTGAATCTCTGAAACAATTATAGTTTGATTAGACAAAGGTTTTTAATAACACTTCTTTTTTGCTGTAGT
2241 CAAGCATTAATAGAAACTAGTTTAATTTTCACAGTGGTAAATATTTTTATTCTTGAGTTATCTAGGAATGGATTTTCCAC
2321 GATGTCTAGTGACTTAAAAAAAAAAAGGAAAAACGTTTCTACAAATCCCTTTGGTTTTCCATGGGATCTGGAATAAAATG
2401 TCAGTGTCTATAAACTGTATGTCATGGAGTTTAGTCCTTGTTTCAGGTTTAATAGAAAAAATCAGGAAGTATCATGGCAT
2481 TGTCTAGACATCATGAAGCTATTTTATTTCCATAGTTGGTAAACAGTGAAAATTTCATTATCTCCAACTACTAGGTACAA
2561 CTTTAGGCCACAGGAAAGGTTATTTGGCCCGAAAGTTTGGAGGTGCTCCTTGAGGTGGGAAGTATCTTGTGGGAAAGTAG
2641 TTACTTGATTCAATTTAGTTCATTGGTAGGGTTGGGGACTTGGTGTTGGTTTCTTTCTTTCTTTTCTTTTTTTTTTTTTT
2721 TTTAATTTTCCCAGCAATATTTAGCACAATGAGCGTGTATGTGCTTTGGGGTTAAAAATTATCTGCTAGGGATGATAGGC
2801 CTGGGTTTCTCGTTGACATCTAGATGGGCCTGATTAGAGCAGTCATCTCCTGGTAGGCACAAAATAATCACCAACAGTAA
2881 TGTTGTATCTGTAATGTTTGTTTGCTTTTTAAAGTTTTATTCTTGATTTCTTGTAAACATCCATTGCACTGAGGCCGTAT
2961 CATTCCTTAAGACAGCCCTACATCTTGCCTTGGTAATCCCTTAGATAATGTGGAAACTCAAACCGTTAGGCTCCAGTCAT
3041 CTTAGACCATTTCCCATCCGTTTTGTATTTTCTCGTCCTGAAAGCAGCTGAACTGAAAGTAAGTAATAATATGCTGGACC
3121 AGTGGGAACGGATGTGGGAGTATTTGTGGTGTGCTAAAATACTGTAATTATCTGTGAGGCTGCCTGACACGCTTTTGCAA
3201 TCTTGTTTTCATCATTCATTCTGCAAACGTTTATGGAGGGCCTTCTTTGAGCACAGAGGCAAAACTGAAAGCTTCAGGGA
3281 TTTGCTGTAGCTGAGGAGCCCTGGGAGCACAGCCCATCAAGCAAGGGATGTGATGGTGTCCTAAATGGAGTGACAGTTCT
3361 CCTGGGAAAAGAGATCACGTGGATTCCGGTCAAATCGGCTAAGGCTTGTGGTTCTCTTGAGCAAGTCTGTTCCTTCTGGA
3441 AACCAAAAGTGCCCTTCATCTTTAGAGACATTTTACTCTTCCATCCACCTTTTCAGACTGAGCTGTCTCTACTATTTAGG
3521 GGTTGAAAATCCATTACACAGTCACTTTACGTTAACATTGGGTCATCTTATGTTTGTATGAGACGGATGTGGGATTTGAG
3601 GGGAACATTGTCATTCCCTTAAAATAACTATCATGAAAAAAATAGCAACAGTATGTAAAGGGACCAAGAGTGGCAGCCTT
3681 TAGGGAAAATGGAGCAGAGAAGAGCTGTGAACAAAGCTCATTTATTTGAAATAAGCGTGCTTTATTTCACATAGAGGGGC
3761 ATCAGACGTTACATTTCATTCGGACAAATTACTGAACAGCCGAAGTGATTGTTTCCAATGTAGGTTATTATAATTATTGG
3841 ATACAAAGATTTAACTAGTGTTTCTGGGTTGGATTTTTGAAATAGTATGCAAGTCATAAGCACAGTTTCAATAAAACACG
3921 TATTCTGGAGGTGCGTGGAACTTTGTATTATTTGTAGTTGAGAAAGGCAAACTTTGCTGACAAACCAGTACCTATCACAA
4001 ACGAACACAAAAAGTAGCTGTTACTGTGCAGGCTGTCTTTAACTTTCATTTCATAAAGGGTACATTATTGTTAAACTCTA
4081 CTACATGGTTTGGGGAGAAATCCAGTGGTTTTATTTAAATGAACACTCTCACACTGCCTTTTGATCAACTTTCAAAGTAT
4161 TTTGCAGATGCATTTTGAGCATGACCATTTTTTTCCCCAAGTAAAAACAATTGTGCGTGGCCTCCATATAACTCAGAAAG
4241 CATGCTCTTACTACCTATGCAAGCAAACAATAAAACATATAGACATGAAATGTTAAGTCTTAAAAAAAAAAGGCAACAAT
4321 TATGGAGCTCTATTTTTAAATTTGTGATTTTCAAAATATGGCTTACTCATCATTGTGTAGAAGAGCATGAATGCGATTTC
4401 TTGTTTTGCTCTGCATATATTTCTCTGCTGTTTTTCTGATCATTGGCGAGATTGTAAAGTATTTTGCAAGCAGAAGTGGA
4481 ATTGGATATGTTGAACACACATCATTGGTGTACATACTGTATTTAGCCTGAAGACTTTCCTAAAGTGTTTTGTTCTAAAA
4561 ATAACCTGCCATTTTCTATAGATTTTAATTTTTTATATCTTCAAGGGTTCTATTTTGGTCACAAGGAAAGAATGTGGCTT
4641 CTAATAGTGCTAAGAATTAAAAGATGCTTTTATAGAGACTTAGAGCTATTTTGAAAAGCTTTGGGGCTTCCCAGCCACTG
4721 ATCACAATTAGACTAAGCCCATGGAATTTCTGGGAGTGTTGTGCAGTGGATTCGGTTCTAGATCCATCTTACATTTGTTT
4801 AGTGTTTCCCAATTTTTGGGAGAAGGGGTGCACAGCAAATTTGAGAGACTTTTTTGAATCTCACACATGTATTTTCCTCA
4881 AGATTCTTTTAAGCCTCTTCTGAATGACTTGTCTGAGATAGTGAAGACCCACATTAACTAGAATCAGCTGGGGAACTTTA
4961 AAAAATACAGTGCCTGGGTCCCAGTCCCTAGCTTTTGATCTAATTCATGTAGGGGTGGGATCCAGGAATTACCATGTATT
5041 TTAAAAGCTTCTGGGTGTTTCTAATTTGCAGACAGATTGAGAACCACTATGATACGTCATCCCTTTACTGAGAATTATGG
5121 CGAGAATCACTGCCATTTGAATTACTCAGGAGTGACTGATTCCTCAGTTGTGTAGGAGAAGCAGAAAAAATAAGAATAAA
5201 AAGAATTGAGAGATACTGATATCAAACTCCCATTTGAAATACAAGGGCCCTTCTGATTCAAGGCCCAGTTGGGGAGCTTG
5281 GACCATGTTGTGAATGGCCTAGCACTCGCCAGTCTGGTGGAAATTGGTGGTCTTAGTTGCTGGAGCAGGCTGAGTGTCCC
5361 CGCGGGGTTTGCATCTGTCCCCAGAACCTTTTCCCCAGGCCCGTGGGGGAATAGGGAAGTCACTCTGAGCTAGAAATTGT
5441 CGAAGAAGAAAAGAAACAACCTTCCTAGCCTTGGAAAGCCTGTCCCTGCTTTTGATAGAATTATTGCCTTTTTGTAGGAA
5521 TTACAGTAGCAAACCCCAGGCTGCCGCTGAATTTCCTACTTTTGCTCATTCTCTAGGATAGTTCTTATCCAGAATGTGGT
5601 TTCAGGAATTCTTTTTTTTAGTTTGAAAATGAATGTGAAACATTTTCTTTGGTGTCTTTTTTTTAAAAAAAAAAAACCCT
5681 TATTGCTATTTTTTCGTGTTTTTGTTTTGTTTTGTTTTTTGTTTGTTTTACCATTAAGTAATACACATCCCAGAATTTGG
5761 CACTCTGTGTTAACTGTGGAGGCAAATAAAATTTAGTTTTAATCTGTGGTGAGCTGAATGCACTACAACACCTTCGAAGT
5841 AATCTGATGGTTTCATTCTGTCGAGCCTCATGCTGCCTACAAAACACCACAATTTACCTGGTGTTTTCAACATTTTAAGG
5921 AATGAAGATACAAGTAGACATGCAAGTTGGAAATGTTTCTTTAGAAAGGCCATCCAGAATAATGATATCTGTTGCAGTCG
6001 TCCAAATGCAATATGAAATTTCCTAGGTGCTATTATAAACGGTGTGGTGTCATACCAAATGCAAAAGCAGTTACAGTATT
6081 TCCGAAGTTGGAGTTCTCTTTGTAGGCCTTTCAAATACGTGTTTGCATTCCATAGAGGTCTGCTCACCAACTGTGCCTCT
6161 CACCACTGGTTAAAATTGAATTTAAGCCTCATTGACATAAGTCGTTTCTTGATTGAACTCTTCAGTTTTTACACTGGAAT
6241 TTCTGTAGTTGTCTTGAAAGCTGCATGTCACATCACTGTACACAAAGTGCTTTGGTATTACTCATGCACCGTGGATAGTG
6321 ATTTCTGTGTCGTTTTCATTTTCAGTTGTACAGTAATATGGAAGGCAGGATGTCTTTCCTAGAGGCTGGAAGAAAAGTGT
6401 ATCGTACATTTTAAATTTATTTTAGAACAAGTGCATGAGATGTGTCACTGATTTCTGTTATTTATTTGTATGTTTTATTA
6481 TTCAAAGTGTATGCACTTTTAAGAAGCAGAATTTATATTTTTACGTTTGAAACGTTTTATTTCTGAAACAGCGTTGATTA
6561 TATAGTATACAGTTGGAATTAAGAGAAAAGTGGAAAATGTAACAAAATACAATAAATTTATTACAAGATGTCCTCTTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAU-ACACGACGAu 5'
              |||: ||| | ||||||| 
Target 5' acttAACT-TTATTTTGCTGCTa 3'
1675 - 1696 157.00 -11.80
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            || |:  || | |||||:| 
Target 5' tgCATATATTTCTCTGCTGTTt 3'
4412 - 4433 140.00 -8.90
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            |:|:|| | |  ||||||  
Target 5' gtCGAGCC-TCA--TGCTGCct 3'
5860 - 5878 131.00 -12.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31507719 6 COSMIC
COSN19768725 14 COSMIC
COSN30502475 26 COSMIC
COSN27004363 54 COSMIC
COSN31504258 57 COSMIC
COSN30471257 60 COSMIC
COSN30475888 82 COSMIC
COSN30525323 84 COSMIC
COSN31498982 91 COSMIC
COSN31513173 107 COSMIC
COSN18723366 115 COSMIC
COSN18723365 116 COSMIC
COSN20112751 116 COSMIC
COSN28049677 118 COSMIC
COSN22604085 158 COSMIC
COSN19671774 179 COSMIC
COSN9644348 431 COSMIC
COSN31539199 456 COSMIC
COSN31547566 487 COSMIC
COSN28692075 721 COSMIC
COSN28815883 756 COSMIC
COSN18835747 819 COSMIC
COSN17246351 1271 COSMIC
COSN32092568 1327 COSMIC
COSN28926368 1377 COSMIC
COSN25277090 1569 COSMIC
COSN31538248 1618 COSMIC
COSN28780670 1619 COSMIC
COSN24305722 1703 COSMIC
COSN26297875 1712 COSMIC
COSN19531032 1863 COSMIC
COSN18723774 2335 COSMIC
COSN29014933 2336 COSMIC
COSN31585795 2530 COSMIC
COSN20112750 2706 COSMIC
COSN18922464 2707 COSMIC
COSN6081840 2947 COSMIC
COSN20112746 3206 COSMIC
COSN20112745 3438 COSMIC
COSN8495061 3512 COSMIC
COSN17708537 3726 COSMIC
COSN32058688 3782 COSMIC
COSN5176067 3866 COSMIC
COSN28721228 3998 COSMIC
COSN20112742 4301 COSMIC
COSN31528891 4394 COSMIC
COSN16068284 4548 COSMIC
COSN6081839 5028 COSMIC
COSN31531094 5168 COSMIC
COSN31606806 5194 COSMIC
COSN31570985 5202 COSMIC
COSN31535290 5203 COSMIC
COSN26469986 5272 COSMIC
COSN31566450 5498 COSMIC
COSN31521620 5605 COSMIC
COSN31555863 5611 COSMIC
COSN16851640 5647 COSMIC
COSN20112739 5657 COSMIC
COSN20093105 5662 COSMIC
COSN20112738 5664 COSMIC
COSN19657057 5665 COSMIC
COSN5865571 5665 COSMIC
COSN1695137 5749 COSMIC
COSN22329532 5765 COSMIC
COSN30545136 5854 COSMIC
COSN31565983 6015 COSMIC
COSN26554299 6096 COSMIC
COSN16169010 6222 COSMIC
COSN31565196 6425 COSMIC
COSN31544907 6576 COSMIC
COSN31534846 6635 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs202051674 3 dbSNP
rs377098979 11 dbSNP
rs775295684 12 dbSNP
rs8047644 14 dbSNP
rs1179279917 15 dbSNP
rs777900144 16 dbSNP
rs368133756 17 dbSNP
rs185541020 18 dbSNP
rs1372190479 20 dbSNP
rs1410130476 30 dbSNP
rs3751846 40 dbSNP
rs750371523 41 dbSNP
rs1453373407 44 dbSNP
rs771802455 49 dbSNP
rs1329226772 54 dbSNP
rs1288457093 56 dbSNP
rs1241278965 60 dbSNP
rs1014426388 69 dbSNP
rs775961971 74 dbSNP
rs1226482924 75 dbSNP
rs1276959045 77 dbSNP
rs1353444896 80 dbSNP
rs896060460 86 dbSNP
rs1343358521 87 dbSNP
rs966159273 89 dbSNP
rs1221427690 93 dbSNP
rs1017654802 94 dbSNP
rs1265936794 96 dbSNP
rs986204094 107 dbSNP
rs1055946275 108 dbSNP
rs770328536 113 dbSNP
rs1403854943 114 dbSNP
rs58496725 117 dbSNP
rs1022752780 118 dbSNP
rs1162664954 122 dbSNP
rs1009536843 124 dbSNP
rs1299655560 126 dbSNP
rs1407004714 131 dbSNP
rs1420017807 132 dbSNP
rs1491352343 132 dbSNP
rs113946424 133 dbSNP
rs1203374944 133 dbSNP
rs1491322575 133 dbSNP
rs892382853 133 dbSNP
rs904930784 134 dbSNP
rs1003392644 135 dbSNP
rs905057716 135 dbSNP
rs1186649055 137 dbSNP
rs182140309 141 dbSNP
rs537705793 142 dbSNP
rs1156747274 146 dbSNP
rs1434805712 148 dbSNP
rs1387757509 152 dbSNP
rs1473619262 152 dbSNP
rs546360844 152 dbSNP
rs1455759173 158 dbSNP
rs1322610004 164 dbSNP
rs888193318 166 dbSNP
rs908240056 167 dbSNP
rs146461244 170 dbSNP
rs933855677 173 dbSNP
rs922527547 175 dbSNP
rs561920833 178 dbSNP
rs765723262 179 dbSNP
rs541860459 180 dbSNP
rs919519972 181 dbSNP
rs567126561 182 dbSNP
rs976274629 186 dbSNP
rs1464911649 195 dbSNP
rs572769958 196 dbSNP
rs1443953265 202 dbSNP
rs1265528266 206 dbSNP
rs1411208909 208 dbSNP
rs141365213 209 dbSNP
rs1471564599 209 dbSNP
rs189980627 214 dbSNP
rs548738469 218 dbSNP
rs545873886 227 dbSNP
rs114768889 230 dbSNP
rs1301347621 234 dbSNP
rs896042898 237 dbSNP
rs1397025507 242 dbSNP
rs1328565161 245 dbSNP
rs1349245386 246 dbSNP
rs114028930 257 dbSNP
rs770292707 264 dbSNP
rs538010694 266 dbSNP
rs569228154 269 dbSNP
rs1231831008 280 dbSNP
rs915292768 283 dbSNP
rs1484013372 286 dbSNP
rs746518631 287 dbSNP
rs557735529 299 dbSNP
rs1200895007 300 dbSNP
rs1001694756 301 dbSNP
rs555614675 302 dbSNP
rs1184262347 304 dbSNP
rs1252396199 308 dbSNP
rs1432694207 316 dbSNP
rs1174014441 322 dbSNP
rs1035007513 324 dbSNP
rs1003483307 326 dbSNP
rs535487984 332 dbSNP
rs1023505993 334 dbSNP
rs1279602896 344 dbSNP
rs1400222868 355 dbSNP
rs1412022885 361 dbSNP
rs941052805 369 dbSNP
rs1005348900 370 dbSNP
rs1309197525 372 dbSNP
rs888195858 373 dbSNP
rs1046786775 374 dbSNP
rs717633 377 dbSNP
rs566845139 382 dbSNP
rs185802607 388 dbSNP
rs1175625495 391 dbSNP
rs144025480 398 dbSNP
rs1479464473 427 dbSNP
rs1339839044 433 dbSNP
rs1040686554 437 dbSNP
rs933663293 443 dbSNP
rs1488098805 456 dbSNP
rs1189613707 457 dbSNP
rs755353788 467 dbSNP
rs72772501 468 dbSNP
rs1188202570 469 dbSNP
rs1388502210 470 dbSNP
rs910770996 472 dbSNP
rs1050556312 476 dbSNP
rs749954482 477 dbSNP
rs566473558 478 dbSNP
rs942541977 482 dbSNP
rs1295738394 484 dbSNP
rs148424291 487 dbSNP
rs1440949773 502 dbSNP
rs368627127 504 dbSNP
rs78738509 510 dbSNP
rs1362550648 515 dbSNP
rs193071789 517 dbSNP
rs528108587 518 dbSNP
rs1320830423 521 dbSNP
rs371346680 526 dbSNP
rs1267100504 527 dbSNP
rs992777537 530 dbSNP
rs927989065 531 dbSNP
rs1259393918 536 dbSNP
rs559299049 541 dbSNP
rs74899914 543 dbSNP
rs576882626 547 dbSNP
rs532830009 548 dbSNP
rs1422367080 559 dbSNP
rs1167571269 560 dbSNP
rs767402090 564 dbSNP
rs1397493293 567 dbSNP
rs1379640864 570 dbSNP
rs717632 571 dbSNP
rs1350929042 573 dbSNP
rs1002225442 574 dbSNP
rs1461555073 580 dbSNP
rs190498757 581 dbSNP
rs750576093 591 dbSNP
rs1005071348 596 dbSNP
rs1005816222 597 dbSNP
rs1378210526 600 dbSNP
rs767792010 601 dbSNP
rs952546933 605 dbSNP
rs1335357436 606 dbSNP
rs1227932798 607 dbSNP
rs1266297834 611 dbSNP
rs1466261311 615 dbSNP
rs1461567439 618 dbSNP
rs886827518 622 dbSNP
rs1237083179 623 dbSNP
rs1482495871 627 dbSNP
rs578253568 629 dbSNP
rs1046875875 630 dbSNP
rs1025886070 631 dbSNP
rs1415208120 638 dbSNP
rs993971886 645 dbSNP
rs144455467 648 dbSNP
rs779352883 650 dbSNP
rs900874766 658 dbSNP
rs1458320876 659 dbSNP
rs374279393 660 dbSNP
rs575412710 671 dbSNP
rs1358192446 672 dbSNP
rs751654487 681 dbSNP
rs1304361849 682 dbSNP
rs1356071476 685 dbSNP
rs942573729 698 dbSNP
rs774115931 702 dbSNP
rs889386804 707 dbSNP
rs764116177 708 dbSNP
rs1331358673 712 dbSNP
rs945914406 722 dbSNP
rs913302414 726 dbSNP
rs1278250663 728 dbSNP
rs1050673838 742 dbSNP
rs915438382 751 dbSNP
rs779545469 758 dbSNP
rs1180688206 763 dbSNP
rs993363384 768 dbSNP
rs1473314246 775 dbSNP
rs1158606235 781 dbSNP
rs1424108867 787 dbSNP
rs1177710104 788 dbSNP
rs763528487 789 dbSNP
rs1459465175 795 dbSNP
rs1408954342 797 dbSNP
rs1306134157 802 dbSNP
rs183708372 806 dbSNP
rs982109277 808 dbSNP
rs948011731 814 dbSNP
rs1221169235 819 dbSNP
rs916513545 819 dbSNP
rs980126913 819 dbSNP
rs536140479 821 dbSNP
rs573200951 824 dbSNP
rs1277443216 825 dbSNP
rs1438892607 829 dbSNP
rs1181973885 832 dbSNP
rs1245634896 844 dbSNP
rs117936945 848 dbSNP
rs1359794334 849 dbSNP
rs1016537622 855 dbSNP
rs759994619 856 dbSNP
rs1314075545 859 dbSNP
rs1450249349 862 dbSNP
rs1395262265 866 dbSNP
rs1378962651 867 dbSNP
rs1005040289 872 dbSNP
rs191108932 879 dbSNP
rs1166453596 886 dbSNP
rs1331997976 898 dbSNP
rs1410453667 900 dbSNP
rs1329422922 902 dbSNP
rs570971428 902 dbSNP
rs952718545 903 dbSNP
rs1390832592 905 dbSNP
rs535269568 906 dbSNP
rs1226735157 907 dbSNP
rs1394404691 907 dbSNP
rs1165136232 911 dbSNP
rs1340420631 914 dbSNP
rs1209770210 932 dbSNP
rs777197583 933 dbSNP
rs187051878 935 dbSNP
rs1214996674 937 dbSNP
rs1253286018 944 dbSNP
rs950884395 946 dbSNP
rs1448498672 950 dbSNP
rs1186507880 951 dbSNP
rs1025396186 952 dbSNP
rs1475581596 955 dbSNP
rs1458573279 959 dbSNP
rs998309814 966 dbSNP
rs1384900670 967 dbSNP
rs1006526732 970 dbSNP
rs1441962468 971 dbSNP
rs900923559 971 dbSNP
rs1239248814 972 dbSNP
rs4968046 978 dbSNP
rs1327416814 979 dbSNP
rs1436639598 979 dbSNP
rs1244461408 980 dbSNP
rs1247798856 980 dbSNP
rs1282998550 984 dbSNP
rs1211154686 987 dbSNP
rs1021692418 988 dbSNP
rs568245386 991 dbSNP
rs548550717 992 dbSNP
rs894039691 993 dbSNP
rs528390413 995 dbSNP
rs1243450315 1000 dbSNP
rs1447412866 1002 dbSNP
rs1186540127 1006 dbSNP
rs904437948 1009 dbSNP
rs1476138579 1010 dbSNP
rs1165483960 1011 dbSNP
rs1411331045 1013 dbSNP
rs1042979806 1015 dbSNP
rs1355593913 1017 dbSNP
rs1385923226 1020 dbSNP
rs559345403 1028 dbSNP
rs552168038 1037 dbSNP
rs1342846137 1040 dbSNP
rs1241315700 1044 dbSNP
rs1415953131 1045 dbSNP
rs1288201503 1050 dbSNP
rs1327901147 1059 dbSNP
rs1226015206 1062 dbSNP
rs906634403 1064 dbSNP
rs1350935574 1065 dbSNP
rs1199720200 1066 dbSNP
rs1253831536 1067 dbSNP
rs531986169 1073 dbSNP
rs913104289 1074 dbSNP
rs1250919076 1079 dbSNP
rs1056971698 1082 dbSNP
rs938723122 1083 dbSNP
rs1325583080 1084 dbSNP
rs1161346007 1087 dbSNP
rs927417999 1096 dbSNP
rs1364669387 1104 dbSNP
rs980479901 1105 dbSNP
rs532017337 1106 dbSNP
rs948104937 1107 dbSNP
rs1377658332 1110 dbSNP
rs909445103 1119 dbSNP
rs1307986807 1123 dbSNP
rs983743181 1125 dbSNP
rs1407533550 1127 dbSNP
rs772757508 1129 dbSNP
rs1308501120 1130 dbSNP
rs1335773002 1157 dbSNP
rs1232079476 1160 dbSNP
rs950853910 1164 dbSNP
rs1030877818 1176 dbSNP
rs976296112 1177 dbSNP
rs1381300920 1181 dbSNP
rs563073532 1183 dbSNP
rs1469027397 1192 dbSNP
rs1179085268 1200 dbSNP
rs972559239 1202 dbSNP
rs749020962 1208 dbSNP
rs965473506 1211 dbSNP
rs1018053759 1213 dbSNP
rs1197066741 1214 dbSNP
rs1397067735 1217 dbSNP
rs965157711 1225 dbSNP
rs1006950793 1233 dbSNP
rs904238558 1239 dbSNP
rs771505010 1242 dbSNP
rs756963219 1243 dbSNP
rs891715190 1244 dbSNP
rs953796199 1248 dbSNP
rs1396627737 1249 dbSNP
rs1300861661 1258 dbSNP
rs1057343069 1260 dbSNP
rs1021323371 1281 dbSNP
rs938539839 1283 dbSNP
rs905929200 1287 dbSNP
rs1031644643 1293 dbSNP
rs1251779175 1293 dbSNP
rs894057469 1293 dbSNP
rs1208115788 1294 dbSNP
rs1255200519 1296 dbSNP
rs940160178 1299 dbSNP
rs182500667 1301 dbSNP
rs1388710729 1307 dbSNP
rs1430620294 1311 dbSNP
rs1489103222 1312 dbSNP
rs1368374195 1327 dbSNP
rs1044509385 1335 dbSNP
rs778828436 1340 dbSNP
rs1284655912 1344 dbSNP
rs906727827 1345 dbSNP
rs1441200269 1348 dbSNP
rs942007248 1358 dbSNP
rs561485505 1359 dbSNP
rs1359645210 1361 dbSNP
rs575476466 1375 dbSNP
rs1276574935 1378 dbSNP
rs1216057795 1386 dbSNP
rs1296270347 1387 dbSNP
rs769435086 1387 dbSNP
rs948157007 1387 dbSNP
rs1224127613 1395 dbSNP
rs1275142318 1396 dbSNP
rs1468917777 1397 dbSNP
rs564455693 1398 dbSNP
rs1208376548 1401 dbSNP
rs1246363855 1404 dbSNP
rs895188439 1405 dbSNP
rs1187438380 1415 dbSNP
rs193180813 1417 dbSNP
rs1422571822 1418 dbSNP
rs765894956 1421 dbSNP
rs1167663567 1424 dbSNP
rs866973488 1426 dbSNP
rs542008140 1434 dbSNP
rs1402074853 1436 dbSNP
rs1157993498 1443 dbSNP
rs1343052871 1447 dbSNP
rs931283206 1448 dbSNP
rs923559325 1449 dbSNP
rs1036941232 1451 dbSNP
rs1412863629 1466 dbSNP
rs1295008038 1467 dbSNP
rs1346057019 1485 dbSNP
rs1227834326 1486 dbSNP
rs1318049525 1487 dbSNP
rs976642190 1493 dbSNP
rs1217031548 1498 dbSNP
rs1276849733 1499 dbSNP
rs964929554 1504 dbSNP
rs1404933451 1510 dbSNP
rs1177797332 1511 dbSNP
rs1258772253 1514 dbSNP
rs781351715 1516 dbSNP
rs1018436849 1517 dbSNP
rs1405427420 1519 dbSNP
rs985208286 1520 dbSNP
rs1159291762 1521 dbSNP
rs374849669 1537 dbSNP
rs1432575584 1538 dbSNP
rs1314706200 1539 dbSNP
rs573488983 1541 dbSNP
rs1355974117 1546 dbSNP
rs985254116 1550 dbSNP
rs1196697280 1564 dbSNP
rs1277843969 1565 dbSNP
rs968445290 1566 dbSNP
rs1278140229 1573 dbSNP
rs373206287 1577 dbSNP
rs149243625 1578 dbSNP
rs779778901 1579 dbSNP
rs955866719 1580 dbSNP
rs891680257 1582 dbSNP
rs539841421 1583 dbSNP
rs1035641769 1584 dbSNP
rs1230680861 1584 dbSNP
rs757470469 1585 dbSNP
rs543281643 1586 dbSNP
rs546377420 1587 dbSNP
rs751773681 1588 dbSNP
rs1044867023 1590 dbSNP
rs942059528 1592 dbSNP
rs887879845 1607 dbSNP
rs970965212 1609 dbSNP
rs1025156831 1614 dbSNP
rs113391539 1619 dbSNP
rs200184383 1619 dbSNP
rs3812996 1619 dbSNP
rs1261304463 1620 dbSNP
rs1237050488 1628 dbSNP
rs1274535977 1628 dbSNP
rs1442963512 1628 dbSNP
rs895250450 1628 dbSNP
rs929320287 1631 dbSNP
rs923498280 1634 dbSNP
rs1040667031 1635 dbSNP
rs1275661575 1636 dbSNP
rs202153136 1641 dbSNP
rs1204564231 1644 dbSNP
rs1252061296 1652 dbSNP
rs1466845709 1667 dbSNP
rs943523705 1672 dbSNP
rs910684131 1673 dbSNP
rs1337874972 1676 dbSNP
rs1469706955 1679 dbSNP
rs368621618 1680 dbSNP
rs1166113536 1684 dbSNP
rs1404595273 1684 dbSNP
rs979575739 1688 dbSNP
rs1410643303 1693 dbSNP
rs557524342 1694 dbSNP
rs537532327 1696 dbSNP
rs1326779376 1701 dbSNP
rs16976044 1702 dbSNP
rs943993102 1703 dbSNP
rs988424385 1704 dbSNP
rs1166976331 1705 dbSNP
rs183508668 1711 dbSNP
rs534485367 1712 dbSNP
rs753200289 1713 dbSNP
rs1331947153 1717 dbSNP
rs932450877 1720 dbSNP
rs1253192384 1721 dbSNP
rs970388092 1722 dbSNP
rs1446266730 1726 dbSNP
rs914338112 1730 dbSNP
rs565988586 1735 dbSNP
rs1243843149 1743 dbSNP
rs990334020 1747 dbSNP
rs1022780377 1748 dbSNP
rs1006070688 1749 dbSNP
rs887848476 1751 dbSNP
rs1415808040 1773 dbSNP
rs1463032852 1781 dbSNP
rs955797825 1788 dbSNP
rs1184014833 1789 dbSNP
rs1460800936 1795 dbSNP
rs1320676563 1796 dbSNP
rs1241223741 1799 dbSNP
rs758911998 1803 dbSNP
rs1047866128 1813 dbSNP
rs1234575199 1816 dbSNP
rs1200564258 1823 dbSNP
rs1308160434 1825 dbSNP
rs1273471292 1826 dbSNP
rs1272495097 1827 dbSNP
rs1213016940 1832 dbSNP
rs1358784252 1840 dbSNP
rs1316137889 1842 dbSNP
rs1286104128 1844 dbSNP
rs1447321209 1847 dbSNP
rs780734186 1861 dbSNP
rs1476251035 1863 dbSNP
rs1188735671 1865 dbSNP
rs1363494722 1866 dbSNP
rs552167289 1870 dbSNP
rs1268819350 1872 dbSNP
rs1333955078 1873 dbSNP
rs1160444065 1876 dbSNP
rs554017610 1879 dbSNP
rs943592130 1881 dbSNP
rs11867044 1883 dbSNP
rs1416163409 1884 dbSNP
rs959836598 1884 dbSNP
rs1407826705 1885 dbSNP
rs192024852 1887 dbSNP
rs946917180 1888 dbSNP
rs1236438415 1889 dbSNP
rs914306416 1894 dbSNP
rs1443814720 1902 dbSNP
rs897231927 1907 dbSNP
rs1209849276 1908 dbSNP
rs1178895936 1924 dbSNP
rs1480954051 1943 dbSNP
rs1278190984 1944 dbSNP
rs1486601540 1945 dbSNP
rs529739966 1949 dbSNP
rs1202576406 1957 dbSNP
rs1249912920 1960 dbSNP
rs1037003601 1962 dbSNP
rs1292816282 1963 dbSNP
rs1364580670 1964 dbSNP
rs1454142979 1965 dbSNP
rs1172158818 1974 dbSNP
rs1008142739 1979 dbSNP
rs1245613888 1980 dbSNP
rs1435900667 1983 dbSNP
rs1298041854 1993 dbSNP
rs891058993 1994 dbSNP
rs1049601404 2001 dbSNP
rs932570350 2007 dbSNP
rs1311994672 2010 dbSNP
rs1300995665 2012 dbSNP
rs1045195 2016 dbSNP
rs1054292611 2019 dbSNP
rs1250645100 2020 dbSNP
rs1479728991 2020 dbSNP
rs928287725 2022 dbSNP
rs1403637079 2025 dbSNP
rs1373302265 2035 dbSNP
rs981516763 2036 dbSNP
rs186291095 2038 dbSNP
rs139430924 2041 dbSNP
rs867821228 2050 dbSNP
rs1371813704 2053 dbSNP
rs560021255 2054 dbSNP
rs182330988 2055 dbSNP
rs1323426852 2056 dbSNP
rs1372943598 2057 dbSNP
rs993559767 2067 dbSNP
rs1423702445 2075 dbSNP
rs974236776 2077 dbSNP
rs1161109219 2081 dbSNP
rs1305694607 2087 dbSNP
rs537769754 2092 dbSNP
rs1334165223 2093 dbSNP
rs961442116 2098 dbSNP
rs1255097173 2106 dbSNP
rs1469221296 2108 dbSNP
rs1186288820 2109 dbSNP
rs1015606269 2112 dbSNP
rs901924885 2119 dbSNP
rs1040354164 2121 dbSNP
rs1171647218 2122 dbSNP
rs1481460448 2125 dbSNP
rs577349980 2126 dbSNP
rs747669560 2137 dbSNP
rs1222006062 2142 dbSNP
rs4968045 2143 dbSNP
rs997205111 2147 dbSNP
rs1043980958 2151 dbSNP
rs1288058573 2163 dbSNP
rs543799090 2170 dbSNP
rs893044756 2186 dbSNP
rs1217017206 2194 dbSNP
rs1054703101 2195 dbSNP
rs575003557 2207 dbSNP
rs892670665 2208 dbSNP
rs1052560104 2210 dbSNP
rs1346867647 2221 dbSNP
rs1259338015 2223 dbSNP
rs1487030203 2227 dbSNP
rs1283437862 2233 dbSNP
rs1187636043 2234 dbSNP
rs1257410013 2236 dbSNP
rs554739080 2238 dbSNP
rs1343303152 2256 dbSNP
rs577151877 2260 dbSNP
rs1419653046 2270 dbSNP
rs1405614696 2276 dbSNP
rs1157834478 2280 dbSNP
rs1343251858 2290 dbSNP
rs1455110697 2290 dbSNP
rs949764395 2298 dbSNP
rs928386365 2300 dbSNP
rs981116357 2302 dbSNP
rs534849164 2304 dbSNP
rs915621003 2306 dbSNP
rs1305074131 2309 dbSNP
rs565723154 2320 dbSNP
rs749263232 2321 dbSNP
rs1280324767 2328 dbSNP
rs1484970159 2329 dbSNP
rs558855588 2333 dbSNP
rs72772500 2336 dbSNP
rs1198840084 2337 dbSNP
rs1176292903 2338 dbSNP
rs1405321674 2341 dbSNP
rs1420721779 2344 dbSNP
rs951948524 2345 dbSNP
rs974663649 2346 dbSNP
rs1015699720 2347 dbSNP
rs1026111734 2347 dbSNP
rs1314602699 2347 dbSNP
rs1359838224 2347 dbSNP
rs1432786311 2347 dbSNP
rs961494288 2347 dbSNP
rs986868067 2347 dbSNP
rs374188935 2348 dbSNP
rs569565512 2354 dbSNP
rs549373430 2355 dbSNP
rs1019478314 2358 dbSNP
rs1028775949 2361 dbSNP
rs1007542158 2364 dbSNP
rs1230876033 2367 dbSNP
rs150893487 2368 dbSNP
rs1032900421 2377 dbSNP
rs1394284518 2381 dbSNP
rs756336600 2382 dbSNP
rs1324977028 2390 dbSNP
rs1011080115 2402 dbSNP
rs1263188635 2404 dbSNP
rs892723147 2408 dbSNP
rs567375075 2410 dbSNP
rs1425745326 2414 dbSNP
rs750561441 2419 dbSNP
rs998760730 2421 dbSNP
rs867936682 2424 dbSNP
rs533794914 2429 dbSNP
rs1052592212 2435 dbSNP
rs74485710 2437 dbSNP
rs752823971 2440 dbSNP
rs906932249 2453 dbSNP
rs1045927716 2458 dbSNP
rs1297278007 2463 dbSNP
rs185878722 2469 dbSNP
rs948404673 2472 dbSNP
rs551198230 2476 dbSNP
rs761580575 2476 dbSNP
rs1382515328 2482 dbSNP
rs894198720 2490 dbSNP
rs1339285971 2495 dbSNP
rs1213262799 2500 dbSNP
rs1270274362 2506 dbSNP
rs1319331097 2515 dbSNP
rs1198908447 2517 dbSNP
rs1251964242 2521 dbSNP
rs1467001128 2530 dbSNP
rs1200726210 2536 dbSNP
rs1247278699 2542 dbSNP
rs532998581 2549 dbSNP
rs779177569 2550 dbSNP
rs559681435 2560 dbSNP
rs1454481777 2563 dbSNP
rs371419555 2566 dbSNP
rs113830356 2578 dbSNP
rs1164546452 2582 dbSNP
rs1175742765 2589 dbSNP
rs568895637 2590 dbSNP
rs1324627903 2591 dbSNP
rs1326143672 2597 dbSNP
rs1429273045 2600 dbSNP
rs1272383555 2608 dbSNP
rs764178320 2620 dbSNP
rs1218675499 2622 dbSNP
rs1272225472 2624 dbSNP
rs755524223 2627 dbSNP
rs919191799 2644 dbSNP
rs971912267 2652 dbSNP
rs1428204653 2653 dbSNP
rs1446173724 2664 dbSNP
rs1260086062 2667 dbSNP
rs1185858548 2668 dbSNP
rs966296685 2669 dbSNP
rs1415691540 2674 dbSNP
rs146581801 2677 dbSNP
rs1164005382 2678 dbSNP
rs986655296 2680 dbSNP
rs1202410205 2693 dbSNP
rs1384723432 2694 dbSNP
rs879863170 2697 dbSNP
rs543861225 2701 dbSNP
rs1400139559 2705 dbSNP
rs766769758 2705 dbSNP
rs1292151440 2706 dbSNP
rs200627344 2706 dbSNP
rs371681823 2707 dbSNP
rs1227697281 2709 dbSNP
rs574865361 2710 dbSNP
rs1349755166 2711 dbSNP
rs555082675 2711 dbSNP
rs541158862 2713 dbSNP
rs1488582379 2723 dbSNP
rs1255528072 2724 dbSNP
rs1468984751 2724 dbSNP
rs575145264 2724 dbSNP
rs763182578 2724 dbSNP
rs879204205 2724 dbSNP
rs955464407 2724 dbSNP
rs868478080 2725 dbSNP
rs975832515 2726 dbSNP
rs1311552304 2730 dbSNP
rs1373117750 2735 dbSNP
rs1397251433 2739 dbSNP
rs957423120 2741 dbSNP
rs1033409427 2749 dbSNP
rs1236692776 2750 dbSNP
rs1311187437 2754 dbSNP
rs953472363 2755 dbSNP
rs1450469530 2757 dbSNP
rs1233497409 2759 dbSNP
rs572254852 2764 dbSNP
rs1398713667 2771 dbSNP
rs1298888977 2776 dbSNP
rs1484300050 2777 dbSNP
rs1461646564 2779 dbSNP
rs1022214382 2780 dbSNP
rs558479398 2782 dbSNP
rs1010880485 2791 dbSNP
rs377736315 2794 dbSNP
rs1180672143 2795 dbSNP
rs956939349 2811 dbSNP
rs1165814054 2812 dbSNP
rs1031693622 2824 dbSNP
rs967281488 2835 dbSNP
rs1467196375 2848 dbSNP
rs1385090419 2852 dbSNP
rs1024155065 2854 dbSNP
rs1444160539 2863 dbSNP
rs1003710989 2864 dbSNP
rs1377423184 2866 dbSNP
rs1182269217 2874 dbSNP
rs1301245255 2875 dbSNP
rs538402548 2877 dbSNP
rs1440121161 2878 dbSNP
rs1233808857 2880 dbSNP
rs1250835746 2887 dbSNP
rs1045242394 2892 dbSNP
rs1337487539 2908 dbSNP
rs894237455 2915 dbSNP
rs1012631054 2916 dbSNP
rs1252007185 2920 dbSNP
rs1195922965 2946 dbSNP
rs894246040 2956 dbSNP
rs10492790 2957 dbSNP
rs1270173122 2960 dbSNP
rs1434271223 2972 dbSNP
rs28472316 2977 dbSNP
rs1372021238 2978 dbSNP
rs1463583127 2980 dbSNP
rs919166024 2981 dbSNP
rs561599573 2992 dbSNP
rs1036728468 2996 dbSNP
rs1172419677 2998 dbSNP
rs1400569912 3005 dbSNP
rs181203306 3007 dbSNP
rs1035982663 3009 dbSNP
rs1369376223 3013 dbSNP
rs1359907369 3016 dbSNP
rs1294712561 3021 dbSNP
rs1338584444 3029 dbSNP
rs567134385 3034 dbSNP
rs761727850 3036 dbSNP
rs1220516015 3038 dbSNP
rs1279159511 3041 dbSNP
rs750036172 3042 dbSNP
rs1211998426 3043 dbSNP
rs1267636316 3044 dbSNP
rs148835238 3045 dbSNP
rs1488981755 3047 dbSNP
rs148112957 3059 dbSNP
rs985985431 3060 dbSNP
rs190376953 3065 dbSNP
rs915340030 3067 dbSNP
rs1423651539 3070 dbSNP
rs77863751 3074 dbSNP
rs3812997 3075 dbSNP
rs1031243007 3085 dbSNP
rs78091431 3103 dbSNP
rs545173919 3107 dbSNP
rs1278937091 3111 dbSNP
rs1354830775 3112 dbSNP
rs1425597812 3114 dbSNP
rs1226840097 3115 dbSNP
rs1315075937 3117 dbSNP
rs1365333190 3119 dbSNP
rs1322738106 3129 dbSNP
rs1238771120 3130 dbSNP
rs1489563169 3131 dbSNP
rs1217903312 3132 dbSNP
rs977386625 3140 dbSNP
rs1485030947 3146 dbSNP
rs775317404 3147 dbSNP
rs1024207466 3163 dbSNP
rs1012431827 3166 dbSNP
rs1424247784 3166 dbSNP
rs894218586 3172 dbSNP
rs1158089573 3173 dbSNP
rs143678712 3176 dbSNP
rs1421451294 3180 dbSNP
rs958592433 3187 dbSNP
rs994503688 3188 dbSNP
rs78739154 3190 dbSNP
rs1181854004 3191 dbSNP
rs897519919 3192 dbSNP
rs3169494 3195 dbSNP
rs556154630 3198 dbSNP
rs944583321 3200 dbSNP
rs1304877379 3206 dbSNP
rs1380144450 3208 dbSNP
rs1249093247 3209 dbSNP
rs3841243 3210 dbSNP
rs397855750 3210 dbSNP
rs1490431473 3213 dbSNP
rs1290723296 3217 dbSNP
rs573694177 3222 dbSNP
rs186817441 3226 dbSNP
rs1311149426 3228 dbSNP
rs561124636 3229 dbSNP
rs1051318039 3236 dbSNP
rs934219240 3240 dbSNP
rs931839825 3242 dbSNP
rs915323753 3243 dbSNP
rs989556906 3244 dbSNP
rs956819882 3261 dbSNP
rs1345168825 3271 dbSNP
rs1412894249 3273 dbSNP
rs1178339523 3278 dbSNP
rs1321934049 3281 dbSNP
rs1402838561 3298 dbSNP
rs923897362 3300 dbSNP
rs1441793913 3304 dbSNP
rs925992800 3313 dbSNP
rs1379641778 3322 dbSNP
rs1222232939 3328 dbSNP
rs541372228 3332 dbSNP
rs572454765 3340 dbSNP
rs565344087 3343 dbSNP
rs1221382009 3348 dbSNP
rs544823149 3355 dbSNP
rs181707116 3359 dbSNP
rs772395949 3364 dbSNP
rs917238664 3364 dbSNP
rs952899157 3373 dbSNP
rs1027399826 3375 dbSNP
rs1452316056 3375 dbSNP
rs748434987 3378 dbSNP
rs1201039220 3379 dbSNP
rs556070919 3383 dbSNP
rs897576486 3387 dbSNP
rs1014982075 3388 dbSNP
rs1004518574 3397 dbSNP
rs779087411 3403 dbSNP
rs1284757964 3404 dbSNP
rs536130149 3406 dbSNP
rs369229622 3408 dbSNP
rs1348435266 3411 dbSNP
rs1265068337 3412 dbSNP
rs1224219900 3416 dbSNP
rs375270478 3417 dbSNP
rs1367738087 3422 dbSNP
rs1273329614 3423 dbSNP
rs747199684 3429 dbSNP
rs772475758 3440 dbSNP
rs1319568015 3442 dbSNP
rs1198808621 3443 dbSNP
rs931808697 3444 dbSNP
rs1449608255 3446 dbSNP
rs893606076 3452 dbSNP
rs1053552230 3454 dbSNP
rs1247185089 3455 dbSNP
rs573627246 3458 dbSNP
rs1191584054 3479 dbSNP
rs1425796369 3482 dbSNP
rs189346217 3487 dbSNP
rs1478275523 3490 dbSNP
rs1164432860 3494 dbSNP
rs924060860 3507 dbSNP
rs576094689 3508 dbSNP
rs1039877958 3511 dbSNP
rs1407398621 3513 dbSNP
rs754305255 3514 dbSNP
rs936146587 3515 dbSNP
rs1345099309 3519 dbSNP
rs1177891930 3526 dbSNP
rs1295814412 3531 dbSNP
rs1341790684 3535 dbSNP
rs1218885293 3542 dbSNP
rs1469869442 3550 dbSNP
rs533748049 3563 dbSNP
rs571277388 3566 dbSNP
rs946093511 3568 dbSNP
rs1290580228 3571 dbSNP
rs563889705 3584 dbSNP
rs551481192 3585 dbSNP
rs756700932 3586 dbSNP
rs993228561 3587 dbSNP
rs1192279052 3604 dbSNP
rs952949778 3606 dbSNP
rs750748250 3610 dbSNP
rs1474009643 3612 dbSNP
rs1027117216 3618 dbSNP
rs138647104 3624 dbSNP
rs184560028 3630 dbSNP
rs1361956134 3632 dbSNP
rs761432097 3634 dbSNP
rs1333171496 3636 dbSNP
rs1338322886 3641 dbSNP
rs1008977182 3642 dbSNP
rs1449695009 3643 dbSNP
rs1284575300 3645 dbSNP
rs776112373 3646 dbSNP
rs550543838 3653 dbSNP
rs1216515456 3655 dbSNP
rs1028622781 3665 dbSNP
rs530332825 3672 dbSNP
rs1354584389 3674 dbSNP
rs1199923786 3676 dbSNP
rs996008887 3677 dbSNP
rs2010 3678 dbSNP
rs1385525894 3679 dbSNP
rs763550767 3682 dbSNP
rs1438196878 3685 dbSNP
rs1452617460 3689 dbSNP
rs935204831 3694 dbSNP
rs1331708361 3696 dbSNP
rs1411286228 3697 dbSNP
rs762371568 3704 dbSNP
rs779366735 3706 dbSNP
rs1171500125 3708 dbSNP
rs1415854116 3711 dbSNP
rs1334350910 3717 dbSNP
rs144857225 3718 dbSNP
rs1415815216 3720 dbSNP
rs1447468322 3731 dbSNP
rs769616709 3736 dbSNP
rs141029338 3737 dbSNP
rs1254365296 3751 dbSNP
rs1402661756 3752 dbSNP
rs916552579 3753 dbSNP
rs1201292627 3755 dbSNP
rs1257628205 3756 dbSNP
rs1460845299 3756 dbSNP
rs1000441233 3759 dbSNP
rs904713065 3764 dbSNP
rs759561271 3767 dbSNP
rs1010357574 3768 dbSNP
rs1375452736 3773 dbSNP
rs565065058 3778 dbSNP
rs1362019730 3781 dbSNP
rs1057134031 3782 dbSNP
rs1396889554 3787 dbSNP
rs776549653 3793 dbSNP
rs770876213 3794 dbSNP
rs927244920 3796 dbSNP
rs1038051669 3801 dbSNP
rs1277869342 3802 dbSNP
rs191448440 3809 dbSNP
rs1200687029 3810 dbSNP
rs575874900 3815 dbSNP
rs1488333319 3820 dbSNP
rs1443749246 3827 dbSNP
rs1270061493 3832 dbSNP
rs1354713366 3834 dbSNP
rs1307051518 3835 dbSNP
rs907609333 3835 dbSNP
rs907749216 3843 dbSNP
rs1422198170 3850 dbSNP
rs552572118 3858 dbSNP
rs1476652082 3866 dbSNP
rs1373479595 3875 dbSNP
rs983215542 3877 dbSNP
rs1291781812 3883 dbSNP
rs954465777 3884 dbSNP
rs562341092 3886 dbSNP
rs1297664290 3887 dbSNP
rs1338472425 3889 dbSNP
rs748341181 3889 dbSNP
rs923002231 3891 dbSNP
rs1164044884 3893 dbSNP
rs987204472 3897 dbSNP
rs1321539982 3909 dbSNP
rs1243068452 3911 dbSNP
rs1423159399 3912 dbSNP
rs954463924 3913 dbSNP
rs1178953900 3916 dbSNP
rs964763336 3917 dbSNP
rs774720450 3919 dbSNP
rs1487005801 3920 dbSNP
rs768724545 3920 dbSNP
rs1251244120 3922 dbSNP
rs1180255230 3927 dbSNP
rs1261980819 3927 dbSNP
rs1031985355 3934 dbSNP
rs1162437895 3938 dbSNP
rs1000891881 3944 dbSNP
rs1490922208 3945 dbSNP
rs968949652 3945 dbSNP
rs1358744007 3947 dbSNP
rs1401895811 3947 dbSNP
rs1289725856 3954 dbSNP
rs1378709386 3954 dbSNP
rs1292946219 3967 dbSNP
rs1360571239 3970 dbSNP
rs1240116461 3973 dbSNP
rs995810585 3975 dbSNP
rs1350945521 3976 dbSNP
rs542367194 3984 dbSNP
rs1320376072 3986 dbSNP
rs1286994165 3990 dbSNP
rs7195736 3998 dbSNP
rs1010368080 3999 dbSNP
rs554006491 4002 dbSNP
rs999762342 4003 dbSNP
rs533579743 4008 dbSNP
rs766737719 4017 dbSNP
rs1177990558 4018 dbSNP
rs1378387871 4018 dbSNP
rs146497747 4023 dbSNP
rs1376078374 4028 dbSNP
rs1347068188 4031 dbSNP
rs1464764027 4032 dbSNP
rs1304780443 4037 dbSNP
rs1384058968 4041 dbSNP
rs895251353 4042 dbSNP
rs1307801247 4046 dbSNP
rs905898329 4047 dbSNP
rs1055101605 4059 dbSNP
rs1037700254 4060 dbSNP
rs72772497 4061 dbSNP
rs1264591836 4062 dbSNP
rs920158019 4063 dbSNP
rs1461645923 4064 dbSNP
rs548646099 4064 dbSNP
rs756545915 4067 dbSNP
rs1441495810 4072 dbSNP
rs907759249 4074 dbSNP
rs1047574537 4076 dbSNP
rs1431491307 4079 dbSNP
rs531053439 4080 dbSNP
rs933127966 4083 dbSNP
rs568923812 4085 dbSNP
rs1329746750 4093 dbSNP
rs1401263289 4100 dbSNP
rs7195244 4108 dbSNP
rs1180182877 4122 dbSNP
rs1274743835 4124 dbSNP
rs943127655 4127 dbSNP
rs1269877421 4128 dbSNP
rs1491187330 4130 dbSNP
rs1491326973 4131 dbSNP
rs1323809170 4135 dbSNP
rs773759402 4135 dbSNP
rs1217570754 4139 dbSNP
rs924973383 4143 dbSNP
rs781482285 4148 dbSNP
rs113737332 4152 dbSNP
rs1246044301 4155 dbSNP
rs987392450 4167 dbSNP
rs1192998039 4172 dbSNP
rs1244242836 4176 dbSNP
rs954430366 4178 dbSNP
rs1316911836 4181 dbSNP
rs1168743355 4183 dbSNP
rs1266922010 4195 dbSNP
rs1410856400 4195 dbSNP
rs372142279 4197 dbSNP
rs1020524128 4198 dbSNP
rs1439137603 4199 dbSNP
rs567889099 4205 dbSNP
rs757649475 4211 dbSNP
rs960223008 4213 dbSNP
rs756392667 4216 dbSNP
rs548049670 4217 dbSNP
rs527721721 4220 dbSNP
rs1214940348 4224 dbSNP
rs1385960729 4226 dbSNP
rs1319870540 4239 dbSNP
rs1365190871 4241 dbSNP
rs1224567927 4242 dbSNP
rs7194893 4243 dbSNP
rs967033701 4247 dbSNP
rs1244044596 4249 dbSNP
rs1024788203 4250 dbSNP
rs1475982958 4251 dbSNP
rs151166366 4253 dbSNP
rs1013439302 4254 dbSNP
rs1411998288 4255 dbSNP
rs751144580 4255 dbSNP
rs763748257 4264 dbSNP
rs531696295 4265 dbSNP
rs1407592642 4267 dbSNP
rs895219265 4270 dbSNP
rs886373307 4274 dbSNP
rs1365716973 4275 dbSNP
rs1398837564 4278 dbSNP
rs758139418 4279 dbSNP
rs995504917 4280 dbSNP
rs1327838067 4282 dbSNP
rs933222772 4283 dbSNP
rs1471016408 4285 dbSNP
rs901710522 4287 dbSNP
rs142065284 4291 dbSNP
rs1037441587 4299 dbSNP
rs1248133959 4302 dbSNP
rs1292378683 4306 dbSNP
rs940262653 4307 dbSNP
rs1431700459 4308 dbSNP
rs979110267 4311 dbSNP
rs1187040116 4312 dbSNP
rs141718430 4312 dbSNP
rs1447809008 4312 dbSNP
rs35955613 4312 dbSNP
rs397730874 4312 dbSNP
rs552653744 4312 dbSNP
rs558359128 4312 dbSNP
rs944994231 4312 dbSNP
rs1422090850 4313 dbSNP
rs913557378 4313 dbSNP
rs989086304 4317 dbSNP
rs1400964853 4318 dbSNP
rs867952267 4319 dbSNP
rs1338533848 4320 dbSNP
rs1464794637 4322 dbSNP
rs1315723920 4323 dbSNP
rs779472252 4332 dbSNP
rs912819552 4332 dbSNP
rs1051258346 4333 dbSNP
rs1206235570 4334 dbSNP
rs1200146538 4341 dbSNP
rs1462281564 4342 dbSNP
rs878875540 4347 dbSNP
rs932842082 4354 dbSNP
rs542478639 4359 dbSNP
rs974496305 4369 dbSNP
rs1232076710 4370 dbSNP
rs1237894483 4370 dbSNP
rs750662175 4374 dbSNP
rs767117890 4375 dbSNP
rs970566613 4386 dbSNP
rs1214950065 4394 dbSNP
rs555937740 4398 dbSNP
rs529061993 4400 dbSNP
rs1364322959 4403 dbSNP
rs188059302 4405 dbSNP
rs1399208958 4406 dbSNP
rs1330790849 4408 dbSNP
rs1444509370 4408 dbSNP
rs540510221 4409 dbSNP
rs966624614 4411 dbSNP
rs1336495148 4415 dbSNP
rs1232620514 4417 dbSNP
rs1454560620 4419 dbSNP
rs1325945560 4423 dbSNP
rs1224306280 4432 dbSNP
rs1406882408 4433 dbSNP
rs1302401222 4439 dbSNP
rs781210104 4442 dbSNP
rs759343127 4443 dbSNP
rs376063237 4447 dbSNP
rs1437971930 4448 dbSNP
rs1033519768 4453 dbSNP
rs557787665 4456 dbSNP
rs898593420 4460 dbSNP
rs1388800903 4462 dbSNP
rs1176651053 4464 dbSNP
rs1015565986 4466 dbSNP
rs1422700734 4482 dbSNP
rs1004648768 4506 dbSNP
rs1460268472 4506 dbSNP
rs1185938736 4522 dbSNP
rs891357503 4526 dbSNP
rs901728070 4528 dbSNP
rs367749403 4539 dbSNP
rs544184337 4542 dbSNP
rs1256229632 4545 dbSNP
rs148599139 4548 dbSNP
rs932812487 4550 dbSNP
rs1266184254 4552 dbSNP
rs1490687409 4555 dbSNP
rs766213503 4555 dbSNP
rs913609814 4562 dbSNP
rs1172290454 4568 dbSNP
rs1373385245 4570 dbSNP
rs1054556019 4571 dbSNP
rs56078428 4581 dbSNP
rs1482034498 4582 dbSNP
rs936403155 4588 dbSNP
rs925039044 4595 dbSNP
rs1425363805 4597 dbSNP
rs977772800 4607 dbSNP
rs1297890709 4608 dbSNP
rs928879342 4609 dbSNP
rs767634044 4612 dbSNP
rs1296765567 4621 dbSNP
rs1340203240 4623 dbSNP
rs945060546 4628 dbSNP
rs1341169028 4630 dbSNP
rs917839868 4632 dbSNP
rs760562874 4637 dbSNP
rs980689202 4637 dbSNP
rs1222594228 4646 dbSNP
rs555476072 4652 dbSNP
rs1484704011 4654 dbSNP
rs1187866260 4659 dbSNP
rs970279263 4663 dbSNP
rs909364305 4664 dbSNP
rs536476804 4665 dbSNP
rs1181738233 4667 dbSNP
rs984877652 4668 dbSNP
rs1445096002 4672 dbSNP
rs1158137253 4682 dbSNP
rs959277991 4686 dbSNP
rs950796794 4697 dbSNP
rs570156166 4701 dbSNP
rs1026283597 4707 dbSNP
rs1289634462 4708 dbSNP
rs550670967 4713 dbSNP
rs1312020460 4716 dbSNP
rs1450911888 4719 dbSNP
rs1317531605 4723 dbSNP
rs567834456 4725 dbSNP
rs554210235 4727 dbSNP
rs1384206622 4728 dbSNP
rs1240000359 4737 dbSNP
rs374878952 4741 dbSNP
rs773201437 4765 dbSNP
rs966376610 4766 dbSNP
rs1260935721 4784 dbSNP
rs1298982179 4792 dbSNP
rs1201539177 4797 dbSNP
rs1429400695 4801 dbSNP
rs1244683080 4808 dbSNP
rs1445187918 4810 dbSNP
rs1177884779 4811 dbSNP
rs1004211760 4816 dbSNP
rs571562294 4817 dbSNP
rs768753657 4827 dbSNP
rs1029624738 4832 dbSNP
rs1165931769 4834 dbSNP
rs1468379475 4843 dbSNP
rs997016988 4844 dbSNP
rs551371039 4847 dbSNP
rs1446749050 4849 dbSNP
rs900113096 4852 dbSNP
rs1368407329 4853 dbSNP
rs1186180270 4856 dbSNP
rs1054526133 4858 dbSNP
rs1322418044 4861 dbSNP
rs551338437 4862 dbSNP
rs936195851 4866 dbSNP
rs903708594 4867 dbSNP
rs1264801213 4868 dbSNP
rs531564163 4869 dbSNP
rs1482562882 4876 dbSNP
rs1289577887 4878 dbSNP
rs1042571586 4879 dbSNP
rs1177870662 4895 dbSNP
rs1266704857 4911 dbSNP
rs569037404 4911 dbSNP
rs1224461353 4916 dbSNP
rs1178813324 4921 dbSNP
rs1430490149 4923 dbSNP
rs549440126 4930 dbSNP
rs1169043651 4933 dbSNP
rs945054367 4935 dbSNP
rs4968044 4936 dbSNP
rs1009327781 4937 dbSNP
rs1056159058 4940 dbSNP
rs1344278928 4942 dbSNP
rs1242632906 4945 dbSNP
rs1402758554 4953 dbSNP
rs1284777541 4957 dbSNP
rs937882016 4957 dbSNP
rs185013160 4959 dbSNP
rs973882039 4965 dbSNP
rs1270554790 4966 dbSNP
rs1056159167 4978 dbSNP
rs1205092069 4980 dbSNP
rs962899489 4982 dbSNP
rs1337585217 4984 dbSNP
rs939000381 4990 dbSNP
rs540004423 4992 dbSNP
rs948980783 5004 dbSNP
rs1185155910 5008 dbSNP
rs1422033622 5009 dbSNP
rs533272805 5023 dbSNP
rs1164649366 5026 dbSNP
rs1364460515 5031 dbSNP
rs955488388 5034 dbSNP
rs1372063150 5038 dbSNP
rs950807047 5043 dbSNP
rs564335640 5044 dbSNP
rs192732591 5045 dbSNP
rs115972714 5048 dbSNP
rs769935466 5050 dbSNP
rs1390588244 5053 dbSNP
rs1033248509 5055 dbSNP
rs555207280 5062 dbSNP
rs1161957240 5063 dbSNP
rs903385323 5065 dbSNP
rs1357461808 5072 dbSNP
rs1224823868 5073 dbSNP
rs1041898749 5075 dbSNP
rs144891960 5079 dbSNP
rs1007515760 5088 dbSNP
rs549423137 5095 dbSNP
rs1056128960 5096 dbSNP
rs1244233322 5096 dbSNP
rs1183571632 5099 dbSNP
rs757559364 5101 dbSNP
rs1164959645 5102 dbSNP
rs892233053 5108 dbSNP
rs747358670 5114 dbSNP
rs1249167771 5115 dbSNP
rs1399798241 5118 dbSNP
rs1315765623 5121 dbSNP
rs1003684024 5122 dbSNP
rs1038327435 5129 dbSNP
rs1201262777 5130 dbSNP
rs1314025520 5141 dbSNP
rs72461119 5149 dbSNP
rs941294240 5149 dbSNP
rs762921859 5160 dbSNP
rs908331008 5160 dbSNP
rs1207951620 5161 dbSNP
rs1045115936 5162 dbSNP
rs77318048 5162 dbSNP
rs1203436857 5165 dbSNP
rs1241635429 5182 dbSNP
rs887993028 5189 dbSNP
rs1184723305 5190 dbSNP
rs201158039 5194 dbSNP
rs1156514930 5197 dbSNP
rs775585646 5197 dbSNP
rs1400871045 5200 dbSNP
rs919414112 5200 dbSNP
rs1335863887 5201 dbSNP
rs1468083622 5203 dbSNP
rs1403581141 5206 dbSNP
rs955615558 5208 dbSNP
rs1337286950 5211 dbSNP
rs1335305331 5212 dbSNP
rs922721189 5214 dbSNP
rs975366909 5216 dbSNP
rs1281286354 5220 dbSNP
rs1351686058 5222 dbSNP
rs976217465 5223 dbSNP
rs1261707801 5225 dbSNP
rs1326080832 5228 dbSNP
rs757967148 5232 dbSNP
rs554348078 5241 dbSNP
rs752418191 5252 dbSNP
rs369668216 5256 dbSNP
rs534086888 5262 dbSNP
rs1390034369 5267 dbSNP
rs1175223814 5269 dbSNP
rs1427002326 5274 dbSNP
rs1320560505 5276 dbSNP
rs986498044 5282 dbSNP
rs1173153653 5284 dbSNP
rs867687794 5285 dbSNP
rs1395685353 5288 dbSNP
rs1389543273 5294 dbSNP
rs967673805 5307 dbSNP
rs764612848 5308 dbSNP
rs1404622094 5309 dbSNP
rs1281602698 5312 dbSNP
rs577932692 5314 dbSNP
rs956547619 5321 dbSNP
rs11548754 5322 dbSNP
rs896218888 5323 dbSNP
rs754525201 5324 dbSNP
rs1198029192 5325 dbSNP
rs1003326780 5339 dbSNP
rs1376848225 5348 dbSNP
rs1001859641 5353 dbSNP
rs1198311482 5354 dbSNP
rs904824153 5361 dbSNP
rs1038041144 5362 dbSNP
rs1005154053 5363 dbSNP
rs1248605872 5364 dbSNP
rs888043950 5369 dbSNP
rs1460441844 5373 dbSNP
rs1463583039 5373 dbSNP
rs1371312253 5375 dbSNP
rs1424099227 5378 dbSNP
rs1301299386 5380 dbSNP
rs941253074 5384 dbSNP
rs1220033405 5388 dbSNP
rs1387518990 5393 dbSNP
rs1295353942 5397 dbSNP
rs759187094 5398 dbSNP
rs1230320040 5400 dbSNP
rs1047326178 5402 dbSNP
rs929543600 5406 dbSNP
rs1342340551 5409 dbSNP
rs368047435 5411 dbSNP
rs1040935763 5412 dbSNP
rs1288884387 5412 dbSNP
rs1210035109 5414 dbSNP
rs933853247 5416 dbSNP
rs1260840621 5417 dbSNP
rs1273381446 5421 dbSNP
rs944817377 5422 dbSNP
rs1230075473 5425 dbSNP
rs1161775944 5427 dbSNP
rs1366505965 5427 dbSNP
rs1297540496 5428 dbSNP
rs922686782 5439 dbSNP
rs1288485767 5440 dbSNP
rs910603031 5441 dbSNP
rs1433584231 5456 dbSNP
rs1384270154 5459 dbSNP
rs986161999 5460 dbSNP
rs1382713290 5463 dbSNP
rs537883027 5465 dbSNP
rs975504151 5468 dbSNP
rs1244354837 5474 dbSNP
rs1312314558 5483 dbSNP
rs1360950315 5484 dbSNP
rs547334172 5485 dbSNP
rs1414665514 5486 dbSNP
rs1484650934 5491 dbSNP
rs1401063610 5500 dbSNP
rs925917284 5504 dbSNP
rs1248363064 5513 dbSNP
rs1460841925 5516 dbSNP
rs549255672 5524 dbSNP
rs1387210785 5535 dbSNP
rs535946414 5536 dbSNP
rs766409438 5545 dbSNP
rs1158734729 5547 dbSNP
rs956599780 5551 dbSNP
rs375825696 5553 dbSNP
rs1321670122 5557 dbSNP
rs1476285706 5560 dbSNP
rs1451162147 5565 dbSNP
rs1339252714 5571 dbSNP
rs1380795296 5575 dbSNP
rs1396112674 5576 dbSNP
rs1305605689 5578 dbSNP
rs1390614970 5588 dbSNP
rs114868197 5590 dbSNP
rs993402510 5598 dbSNP
rs1268574113 5619 dbSNP
rs982316517 5620 dbSNP
rs1201754458 5621 dbSNP
rs749070578 5623 dbSNP
rs1244885986 5629 dbSNP
rs1245033027 5631 dbSNP
rs960226218 5634 dbSNP
rs1210931047 5641 dbSNP
rs1441990811 5642 dbSNP
rs1483496239 5643 dbSNP
rs1276810626 5647 dbSNP
rs1197873723 5648 dbSNP
rs1343292721 5652 dbSNP
rs1297372489 5654 dbSNP
rs1226825803 5656 dbSNP
rs1385693530 5658 dbSNP
rs969186339 5659 dbSNP
rs1159913078 5661 dbSNP
rs879146018 5661 dbSNP
rs1183604069 5662 dbSNP
rs371882119 5662 dbSNP
rs34770711 5663 dbSNP
rs8063453 5664 dbSNP
rs1360264731 5665 dbSNP
rs141087685 5665 dbSNP
rs1491508380 5665 dbSNP
rs200079116 5665 dbSNP
rs200154746 5665 dbSNP
rs34408168 5665 dbSNP
rs374673951 5665 dbSNP
rs71379663 5665 dbSNP
rs1221465446 5666 dbSNP
rs748536998 5666 dbSNP
rs760729743 5666 dbSNP
rs769250219 5666 dbSNP
rs888137145 5673 dbSNP
rs564403710 5674 dbSNP
rs898038732 5675 dbSNP
rs993745680 5675 dbSNP
rs1040565231 5676 dbSNP
rs1491146034 5676 dbSNP
rs1202077016 5677 dbSNP
rs1491111231 5677 dbSNP
rs1491550221 5677 dbSNP
rs1009451207 5678 dbSNP
rs1370937016 5678 dbSNP
rs1308039150 5680 dbSNP
rs1431096933 5680 dbSNP
rs1364584037 5682 dbSNP
rs1466561576 5682 dbSNP
rs889277123 5683 dbSNP
rs1050522006 5691 dbSNP
rs1368001655 5695 dbSNP
rs1213963264 5696 dbSNP
rs1034522603 5699 dbSNP
rs1344145383 5700 dbSNP
rs1205974888 5703 dbSNP
rs1415877060 5704 dbSNP
rs1489931221 5704 dbSNP
rs1001913299 5712 dbSNP
rs904959740 5714 dbSNP
rs946779418 5715 dbSNP
rs1185352775 5716 dbSNP
rs1422272961 5719 dbSNP
rs772230155 5719 dbSNP
rs915277767 5719 dbSNP
rs1472522035 5720 dbSNP
rs774657481 5721 dbSNP
rs1325087005 5725 dbSNP
rs935236570 5729 dbSNP
rs1016983873 5732 dbSNP
rs1184209308 5742 dbSNP
rs1005249074 5753 dbSNP
rs927849324 5759 dbSNP
rs1274347028 5763 dbSNP
rs981983503 5765 dbSNP
rs769013926 5766 dbSNP
rs1362174597 5769 dbSNP
rs560982485 5771 dbSNP
rs969657320 5772 dbSNP
rs887009349 5776 dbSNP
rs1355005502 5780 dbSNP
rs1047016642 5781 dbSNP
rs933818713 5786 dbSNP
rs1411263161 5792 dbSNP
rs900981052 5794 dbSNP
rs1183485012 5796 dbSNP
rs1307110229 5800 dbSNP
rs780605800 5809 dbSNP
rs1471515108 5821 dbSNP
rs1164421274 5824 dbSNP
rs983876040 5828 dbSNP
rs1156707215 5835 dbSNP
rs9929420 5836 dbSNP
rs542071713 5838 dbSNP
rs767391344 5839 dbSNP
rs530564489 5842 dbSNP
rs188138337 5845 dbSNP
rs1450299045 5854 dbSNP
rs1411708856 5855 dbSNP
rs1284793891 5862 dbSNP
rs1350252353 5865 dbSNP
rs1222233927 5867 dbSNP
rs962332784 5870 dbSNP
rs1330214336 5876 dbSNP
rs926088323 5877 dbSNP
rs1241829286 5879 dbSNP