miRTarBase - #MIRT726307 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMEM135   
Synonyms PMP52
Description transmembrane protein 135
Transcript NM_001168724   
Other Transcripts NM_022918   
Expression
Putative miRNA Targets on TMEM135
3'UTR of TMEM135
(miRNA target sites are highlighted)
>TMEM135|NM_001168724|3'UTR
   1 AGATGACTGTAACTTATTAATGTGACTAAATGTTTCATCTTGAAGAGTTAATTATGTTGAACACAAAGGAGGGGGCCCAA
  81 GCTCGAACTTCAGTGTTATTTCAGTTAGAGATACTCTTTTCATTTGTTTTGTTTTTCTTATGAATCAGAAATTCAGAAGC
 161 TTTTTAGGAAGATGTTGCTTAATAATTAAGCTTCCTCCATAGCCAGAATAAGATTCTGGATCACTGTAGTGACTGACATT
 241 ATATATTATTGATCAAATTATGTCCACAAGCAATATTATATAATCTACGTAGAAGTGTAATAACAAACAAGAGTACACTT
 321 AAAATTACTTTAAAAGATGTCTTTAGTTCATTCCAATATAATTCTTGATTAAAATTAGGATTATTTCTACATTTTAGGAT
 401 TTACAAAGGATCACGGGTACATGGATTTGGTCTATATATTTTTTTAAAGTTTTGAATTGGTATCTGTAGTAGTGGAATGT
 481 TATAGATTTGAAGTAACTCTCCACGGACAGTGCTGCTTTCGTGTAGAGCAATTTAATTGGAGAAGTGGCCATTCTTACTT
 561 CAGGGATGCAAAGATGGGTCTCATACCATTTGGATAAATGTCGTGGTATCCATGCTTTTTTTCAACTAATAACATCATCT
 641 CTCTTCATGACCAGTTAATTGGGCTATTTGGCAGCCCAGTGAACCTATGTACTAATGGCAAGTTAGGGGCAAATGGAAAT
 721 GGACACATCCGATAAAGTTGAAATGTATGTTTTAATCTTTCACAGAAGTATTACACTTGAATATTTAAAAACAAAACTTT
 801 TAAACTTCCTATAGGTTTATGATGTTTGTTTTCATTTATATGGACATAATCCTTCATAGCTCAGTTTATATGCCATTGTT
 881 GTATTAGAAGGGATCAAAATCCTATGGAACAAAGTAGTCTTGGCAAGTTGGCAGTTTGTGTCCTCTCAGCTGTTTAACTT
 961 ATGTAATGGATGTTTTGCACCTGAAAACACTATAAAAATCCAGTGGTTGTTTAAAAAGTCCATTTGTCACTAATTCCATT
1041 CAGGTTCTCCAACCTTCTTCTTGAATATCATTGTCACCATTTTTACTGTTAGAATAAAGAGGTGACACCATAAAGTCCTG
1121 CTGATAATGAGAGTAGTTCAGGACAGCTGTGATTGAAATATGGTCGCTATTTACAGTTTTTCAGGGAAAAGTTATACTTT
1201 TCTATGTTAATAAAGAGCTGAAGTGGTCTACAGTTAATGTGACATGTAGGGATGATGATATTTTTAAAATACATTTTGTT
1281 GCTAAAAAGTTTTTAGGCCAGTGCAAATTATGCAGTAGAACTTGTGTTGCAAAAGGAATTATAACCCATACTTTAAAAAT
1361 GCTTAATCCCTCATATTCAATTTCATCAAGCCTTGTATACTTCTGCTTAAATGTAATTCAATCCTTGGTTGTTATGGCAA
1441 ACAGAAACCCAACAAAAAGACAGACTCTGGTACTATGGTAACAGAGCCACTTTATCATTTGGTCAAAATTTGGCATTATG
1521 ATTAGCTTTGTAGAACTGACCTGTTTATTTGGCAATGCTGTTAAAGGATCATTTCGGTTTCAGACTTCAAAGTTGATTAA
1601 TAAATTTAATCTTAACTTTTTATTCACTGGAATCAAAACGATGGTTGGTACTGTGTTTACTGTTTAAAATGAAGTACTAA
1681 AGCCCTGAGAACTGCACCTCATTTTCTTTATCCAGAAATTGTGCTTATATATTTTCCTGTCAGGTTTAAAAAGATGTTTT
1761 AATTCATAAATTATTGTTTTCATTGACATTAAAAGACTGTGATATTGAAAGATGAATTACGAAATTTGCTGAGATTGTTT
1841 AGTAAAATTTTGCTGGTCAAAAAGGTGTATTTCTACAATTTACCTTTTCATTTTTATAAATTGCAGTCATTTTTTTAAAT
1921 TTTATGTAAAATGTAAAATGAAATAGCTATCATGAAGCAGAATACAATGATGAATGTATAGGTTGAGTGAATAACCAATT
2001 TGCAGTGGTGGATTGAGAAGTCCAGTTTGATTTCATTGGGACAGACTGCAAAGTGTAGTTGTTTGAGCAAACACAAAGAA
2081 ACTTTGTGTTTTTGAAGACAATCAGAATGATTACCTTTCTACCTCTAACTAATCAGGTATTGATTGACAACTTTTTGGCA
2161 TTATAAATAAAGTAAAATAGATCTCTGCATTCCAAAATATGTTTTTTAGTTTATTTATATCCTGAAGAAATGGTAAGTTT
2241 TCACTGGAACTGATTACAGTAAACAATAATATGTCCCCTTAGTCTTTCTGACATTTTTATATAGATTGAGATTGAAAAAC
2321 CGTGCATTTGGGGCAGTGGTATTATGGTCATTTCGTTGCTATTTTCTGTTTTAATAAAATCCTAGAACTAGTAGCAACCG
2401 AGTAAAGATTGAGTTTGCAAGATAACAGATTGTCTCAAATCTATTCAATTCTCAGCAGTTTTTCATCAAATAATTTCAGG
2481 ATCCATTTTATTACTCATTTTTGAAGTAACACCTTTGGTTTAGTTTTATTTTCCCATAAATTCTGCTTTTGCTTCTGTAA
2561 CTTTTTTCTTGAACTATAAGCATAGTCATCACTCAGTTGATATCTAGTTTATTTTTTGCCTTCATTCGTTGTTTAGTCAG
2641 TTGTTATTTAATTTAGAATTTTATATTTTTTTGGCTCTCAGATTTTATAATGAACTTTTATTAGACTGAACATGTATGTT
2721 TTTGATGGAATCCAAACTGAGCAAATGTCACACAGTATTTTCTTGTTGTGCTCGAGTGTTCGTCTCCTTGTAGATTGTAT
2801 CTAGGCTAACATTTCATTTAGTTGTTAATGCTGACGTAATTGTTTCCTGCTTATATTTTATCATATCCCTGAGCTTCTGT
2881 GTGCTCTACATTTCATAGGTAATGAAAAGCAATGTCCTTTACTCTCAGGGAGCTTCGTCCACTTGCCTGTGTCACAACCT
2961 CTCCCTTGGTGCTAATTAGGAAGCTTCTTGTGGGACTGAAGGGAACTGACCACTGGAGCAATGGCCCAAATGTTGTTTTT
3041 GGAGCAGAGAAATTATTAGCCCAGAGATTCCTTAAATTCTCCGTGTGATTTATTTTTTTATTTTTTGAGTTGAGGTCTAG
3121 CTCTGTTGCCCGGGTTGGAGTACAGTGGTGCAATCATAGCTCATTGAAACCTCAAATTCCTTGGTTCAAGCAATTATTTC
3201 CCCTCAGTCTCTAATAGCTGGGACAACAGGCATGTGCCACCATGCCTGGCTAATATTTATTTTATTTATTTTTTTTTTGT
3281 AGAAACAAGGTGTTGCTATGTTGTCCAGGCTGGTCTTAAACTCCTGGCCTCAAGTGATCCTCTTGGGTTGGCCTCCCGGG
3361 ACTCTGGGATTCCAGGTGTGAGCCACGGTACCTAGCCATATTTTTATTTGTATGAGTATTAAGTAGTTTGACACAGCAAC
3441 AAAGTTGTCCTTTGTTTCCCAAAGGCAAAAGTATACATTTCTTACTAAGATATCTTATAAACATTCTCTCTCCTAACACC
3521 TCCTTCTAGTAATCATTTTCACATAGTAGAATACTTCACTCAGCTGAAAATGAGTGGCCAAGAAAAAAATACAAGAAAAG
3601 GAATAAGAAGTGATTATTTTCTTTAGGGCTGCACTTTGAATGTGATGAGTAATAAGGTTACCTTCATTGTGGAGGTGATG
3681 TTTACAATTGCCTCCAGCCCTTTACTATTGGTGCTGAAGCCACCATTGGTGCCAGCTCTATAATTTCTTCTTCTTGTGGA
3761 ATTAACAAAGAAAGGAGTGTCAAGGACTGAGATGACCCTCAGATTGGGGGGCTGTCTTAGATTCTAGGGCTTTGTAGTAC
3841 TATGTTTCTGTTTAAAGTAGTGGCCTCAGGTGACTTTGTAATAGCCCTGTAGTTGCAAAAAGGGTAACTACAAAGAAATG
3921 AAACTGACTCTAGTGTGTGTGACTTCTGGAAACAGAAGTGGGGCAGTAAGTTGGCCATGATATAGCTAGTGTCATAGGAC
4001 TACAGCAGAGTAGTGAGTGAATGGCCTTAAGCTTACAGCTGTGGTGAATAAGAATGTGTGCTATTTTACACACAGAAGAA
4081 AATGATTGACTTTTGGTTGGAGGAAAGAATTTATATCTGGTCTTTTGGAAATTATTCTGTTGCTGTTTTATGTGGGCTCT
4161 CTCTCTCTCCCTCTCTCTCTCTCTCTGTCTGTCTCTCTTGCTGCTCCCTCTCCCTGCCACCTTGTCCATTCTCTGCTTGC
4241 TGGTGTTACTTTATGTTAACTAGTCTCCTTGGACTTCATTGCAACCTTTTAAGCCAGCCGTTCAAGTGAGAGGCTCTGGA
4321 GTGATCATAACGGTGATAACAATGGAGTAAACATTTCCAGAGACACTGATTTTTTTTTTATATGCTCTGTTTTTCTTAGG
4401 CAGGATGATGTAGAAGATAATTGCACAGATATGGAAGGAGATGTTTCTCTGTATGTGAAGCCTTTAAATCCAGAACAATT
4481 AATTTCTTCTCTTCTTAAAACCCCGTAACATCACTTGACTCTGGAATTTCCTATTTTCTTTTACTTTCTCCATTTTTTTT
4561 CCATCTGTCCCTCCTACGAATATGTTTTACATGAAATAATGTATTGGGTTTTATCTTTTGTCCCAGCAGACCTGAAAATC
4641 CCAGTATATTACCACAGACACACATACCATCTGGTCACCAACAGGGACATCAGGGCCAAGAGCAGTTTATACTTCTTTCT
4721 TTAGCTCACAAACTACTATAGCTTGCCTGTTCAGTTTTTTTTTTTTTTAATATTCAGTTTTGTGCCATACTCTCCCCCAC
4801 CCCCAGCCTGCTGCCTCTGCAGAGCATAACATTCTAATCTTGTCAGACCGTGGATAATAGGATGTTCCCTGGTCTTGGCA
4881 TAGAGGCCATAGGCATACAACATGCTTTATCTGCCTTGCTTAGACTCAGCATCCCTTTCTGTCTTGAGAGATTCAGGCTT
4961 CCATAAAGTAGACCTGTAGACCTATGTTGGCTGAGGTCACCCTGCATTACTACTTTCCTCCATCCCTGAACTAGGACCAG
5041 TTAATTTTCGAAGTCTAGTTCTTCAGTGTCTATTAAACTTTTTCCAGTAGTTAATCGATCTCTTAAATTAATTTTCTTTT
5121 CAGATTATTTTTGGTCACCTAAGAGGACCCTGAAGCTATAGTGCCAAAGGTTTAAAGCATGAAGTACATTCTGTGGTTGG
5201 TCATTATGGGATTGGATGCCAAAAGGAATGGGAGAGAAGAGACTATAAACATATTTTAAGCCTTATCTCTTTTCTCCTAT
5281 TCTTTTCTTTACCTTTCCTGGCCCATGCTTTCCTGCCATATCTTTGCTATGTATTTCTTCATCTTGAGCTCTCAAGGGAA
5361 AAAACAGGAGTCCTTATTTTTCTATTTATTTCAGGGAAAATTGAAGGTAAATAATATCTGCAAAGCTTCAGGAAGAAATT
5441 CAGTTGCATCTGAATCTGAGTCGGCAGTTTTTGATAGCCTGTCACTGCTCAGGGATAGCACTAAGGCTCTCTTCAGAACC
5521 AAAGGGCAGGATAAATAAATCTATGAAACTAGAGGCATCATTGAATCATCTGAGGACCTTTTTTTTTTTTTTTTTTTCAC
5601 TAAAACGCTTCCTATAACTTGGATTAAAATTCAAAAATGGGATTGCAGTCATTGTTAATTGCTCAACTAGTGGCAGTTTT
5681 TCCTTGCTGAGGGAACACTGATGTTGTTTAAGACAGTTACATGCCTAGCCCCAGGGATGAATCATAATTGTTCTAGGCCT
5761 TTCATGTCTTTCCTTTCTTCTTGTCCAGATACTTTTCCAACCAGCCTTTACTCGGAGGTGTTCATGTGACCCTGTTTTGG
5841 CCAATAAAATGTAATGGAAAATCTGGGAAACACTTGGGAAAAATCTTCCCTCTCTGCTTAAAGGAAAGTTCTTTTTACCT
5921 CTTTTTCTCTTGTTCAAGGTATTAGTATTAGTCAGTAGGGTCTGAATCTGTGGCAGCAATCTTGCAGACATGAAATGAAA
6001 AGTACAAACATGAAAAACCAGCATATTAAAGATGCCAGGTCAGAAAAATAGAAAGAACCTGCTTCTGTGAGCCACTGAAT
6081 GGTGCCATTAACCATCTGCATTTGAGCATTTTGAGAAAATAAACCTCTATTTCTTAAAGTTCTGTATCAGTCAGGGTTTC
6161 CCAGAGAGGCAGAACAATAGGGATAGAGAGATACATAGAGAGAGATATGAGAGGGATAGAGAGAGACACAGAGAGAGATA
6241 TGAGAGGGGATTAAGGGAGTTGGCTCATGTGATTGTGGAGGCTGAGAAACCCCACCACAGGCCATTCATAACCTGGAGAC
6321 CTTGGGATGCTGGTGGTCTGGCTCAGTACAAGTCCAAAAGCCTTGGAACCAGGGAAACTGATGGTGTAATTCTCAGTCCA
6401 AGGCTGAATTTTCAAGTCTGAGAACCTGGGGGTGGGATGGGGGAGTGATAGTTTTAAGTCCTGGAGTCCCAAGGTTAGAG
6481 GATCTGGGGTCCTAATGTCCATGGGCAGTTGGAGAAGAGTGTATCCCTGCTGCAGGGGAGAGAGAGAAGCCAATTCTCCT
6561 TTCTTCTGTTTTTATTCTACCCAGGCCTCCAGTGGATTGGAGGTGCCTGCCCATATTGAGGGCAGATCTTCTCTGCCTAG
6641 TCCACGCTAACTCACATGCCAATCTCCTCTGGAAACACCCTCACAGACACACCCCAAAATAATGCCTTACCAGTTCTCTA
6721 GATATTCCTTAATCCAGTCAAGTTGATGCCTAAAATTAACCATCACAGGCTTTATGGCTCTATTACCCAAGAATTCTGTT
6801 ACTTTCAGCTGAAAACATTTCTAATGGACATATTCCAATTCTGTATAGATCAGATCTCAGTTTCATTTCCCATTATATCC
6881 TTCTCTCTCTTGATTTAGAATTCTCTTTTTCTCCACTCTTCTGTGTATGCTAAAATACTGTCAATCTCGTCTTTGAAGGT
6961 TTTGCTCATCTTTAAAAAATCTTAGTTGATTATGTTTTATGTGTCATTTAATTAAGGAATGAATTTGCTTATTTTTATTT
7041 CAGTAGCTTTTGGGGTACAAGTGGTTTTTGGTTGCATGGATGAATTGTATATTGGTGAAGTCTGAAATTTTAGTGCACCT
7121 GTCACCAGAATAGTGTGCATTGTACCCAATATATAGCTTTTTATTCCTTCCCCTTCTGAGTCTCCATAGTCCATTATATC
7201 ACTCTGTATACCCTTGTGTATCCATAGCTTAGCTCCCACTTACAGTTGAGAACATACAGAATTTGATTTTCTATTCCGGA
7281 GTTACTTTACTTAGAATAATGGCCTCCAGCTCCATCCAAGATGCTGCAAAAGACATTATTTCATCTTTTATTTTTTATGG
7361 CTGAGTAGTATTCCATGGTGCATATATACCACATTTTCTTTATCCACTCATTGGTCTATGGGCACTTTGGTTGATTCTGT
7441 ATCTTTGCAATTGTGAACTGTGTTAACAATAAAAATATATATACGAGTGTCTTTTATGGTAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUAC-ACGACGAu 5'
             |||::||| || |||||:| 
Target 5' tggAAATTATTCTGTTGCTGTTt 3'
4126 - 4148 155.00 -13.00
2
miRNA  3' guguuugguaauaCACGACGAu 5'
                       |||||||| 
Target 5' ctctccacggacaGTGCTGCTt 3'
497 - 518 145.00 -18.00
3
miRNA  3' gugUUUG-GUAAUACACGACGAu 5'
             |||: |||| | ||:|||| 
Target 5' ttaAAATACATT-T-TGTTGCTa 3'
1264 - 1284 141.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30121020 11 COSMIC
COSN17037575 41 COSMIC
COSN24462592 81 COSMIC
COSN30505888 84 COSMIC
COSN30541793 85 COSMIC
COSN30452428 136 COSMIC
COSN31486671 138 COSMIC
COSN30107559 230 COSMIC
COSN22464796 316 COSMIC
COSN30110344 497 COSMIC
COSN28735448 506 COSMIC
COSN31541744 623 COSMIC
COSN30540049 707 COSMIC
COSN16408429 788 COSMIC
COSN15718704 812 COSMIC
COSN29513768 993 COSMIC
COSN17677720 1183 COSMIC
COSN5311196 1274 COSMIC
COSN29513403 1331 COSMIC
COSN25421112 1481 COSMIC
COSN5311197 1575 COSMIC
COSN15662848 1628 COSMIC
COSN17734551 1631 COSMIC
COSN15895230 1751 COSMIC
COSN30169944 1821 COSMIC
COSN29513326 1859 COSMIC
COSN1547705 2233 COSMIC
COSN30244597 2237 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs199579363 5 dbSNP
rs373624774 6 dbSNP
rs778201175 8 dbSNP
rs1010243911 9 dbSNP
rs1478739288 14 dbSNP
rs568644283 17 dbSNP
rs747544835 18 dbSNP
rs1393066036 22 dbSNP
rs1403154939 24 dbSNP
rs1325105913 25 dbSNP
rs771228515 29 dbSNP
rs1429602264 30 dbSNP
rs1296681525 38 dbSNP
rs1035864928 39 dbSNP
rs1219753605 40 dbSNP
rs781664142 49 dbSNP
rs746073759 56 dbSNP
rs1230165915 57 dbSNP
rs1290689575 60 dbSNP
rs770098986 63 dbSNP
rs763080911 64 dbSNP
rs768891106 69 dbSNP
rs1489175993 71 dbSNP
rs1194279740 75 dbSNP
rs1417158765 76 dbSNP
rs1471770940 77 dbSNP
rs1164426069 79 dbSNP
rs774360861 81 dbSNP
rs1399719089 82 dbSNP
rs761853070 83 dbSNP
rs767199540 85 dbSNP
rs760213621 86 dbSNP
rs1022154831 89 dbSNP
rs766104909 93 dbSNP
rs753509045 94 dbSNP
rs778409450 100 dbSNP
rs968727355 105 dbSNP
rs752050869 112 dbSNP
rs77659895 115 dbSNP
rs746295843 120 dbSNP
rs770081920 122 dbSNP
rs150716719 126 dbSNP
rs1424834470 128 dbSNP
rs749527932 130 dbSNP
rs1256556511 132 dbSNP
rs1282709580 141 dbSNP
rs1320230630 143 dbSNP
rs768794990 147 dbSNP
rs774628463 153 dbSNP
rs1485075735 160 dbSNP
rs1237524207 161 dbSNP
rs907503442 169 dbSNP
rs761834377 175 dbSNP
rs1156448016 183 dbSNP
rs1381858273 186 dbSNP
rs1419936658 194 dbSNP
rs1173344664 195 dbSNP
rs1400544296 198 dbSNP
rs1416624701 200 dbSNP
rs918436905 205 dbSNP
rs549025928 210 dbSNP
rs1444738630 219 dbSNP
rs1311559018 220 dbSNP
rs1377848779 232 dbSNP
rs186460395 233 dbSNP
rs568065871 238 dbSNP
rs1196682163 244 dbSNP
rs1342665092 261 dbSNP
rs1329771315 270 dbSNP
rs755853608 271 dbSNP
rs760470027 273 dbSNP
rs1436721259 274 dbSNP
rs1442847310 276 dbSNP
rs766116809 280 dbSNP
rs1239482164 281 dbSNP
rs1439873792 282 dbSNP
rs1186576530 283 dbSNP
rs1462314490 284 dbSNP
rs1420599041 285 dbSNP
rs1163452490 288 dbSNP
rs538672202 289 dbSNP
rs17821399 290 dbSNP
rs1479241993 296 dbSNP
rs939255878 298 dbSNP
rs565996959 301 dbSNP
rs1173664003 304 dbSNP
rs1003147250 305 dbSNP
rs1478586975 309 dbSNP
rs995876659 309 dbSNP
rs764725112 314 dbSNP
rs1333389785 315 dbSNP
rs1401159396 317 dbSNP
rs1440403010 329 dbSNP
rs370119863 337 dbSNP
rs534581593 338 dbSNP
rs1232665139 339 dbSNP
rs752245078 344 dbSNP
rs745854079 345 dbSNP
rs891948508 355 dbSNP
rs753712537 357 dbSNP
rs1463552416 359 dbSNP
rs1259385703 363 dbSNP
rs1328470822 366 dbSNP
rs1457855755 367 dbSNP
rs1442055727 377 dbSNP
rs1397206121 382 dbSNP
rs1208856644 391 dbSNP
rs1021706746 398 dbSNP
rs904637343 399 dbSNP
rs1199951760 400 dbSNP
rs1372889767 401 dbSNP
rs374929859 407 dbSNP
rs138995847 410 dbSNP
rs1424403771 413 dbSNP
rs1193933159 415 dbSNP
rs1395849482 415 dbSNP
rs904628853 416 dbSNP
rs1292000051 418 dbSNP
rs1393068632 429 dbSNP
rs996683781 431 dbSNP
rs1006810974 433 dbSNP
rs1339629948 435 dbSNP
rs1206930493 436 dbSNP
rs1216690914 438 dbSNP
rs774583055 439 dbSNP
rs1317993580 441 dbSNP
rs1243350284 446 dbSNP
rs1279165713 455 dbSNP
rs1263181990 456 dbSNP
rs1489227260 459 dbSNP
rs1210090264 461 dbSNP
rs1235371703 472 dbSNP
rs1262878842 473 dbSNP
rs1301630960 476 dbSNP
rs117494877 479 dbSNP
rs1487539092 480 dbSNP
rs756034043 484 dbSNP
rs965241668 485 dbSNP
rs1320904102 489 dbSNP
rs1423752713 492 dbSNP
rs1398434239 494 dbSNP
rs1162702795 496 dbSNP
rs1370292965 500 dbSNP
rs149879606 505 dbSNP
rs1158253687 506 dbSNP
rs1359639855 520 dbSNP
rs749505327 521 dbSNP
rs755314580 522 dbSNP
rs1340987645 523 dbSNP
rs1026007098 524 dbSNP
rs1436121550 525 dbSNP
rs1395404246 537 dbSNP
rs1309905742 538 dbSNP
rs1323038621 549 dbSNP
rs951244517 551 dbSNP
rs1392889061 558 dbSNP
rs1245034867 567 dbSNP
rs555918047 572 dbSNP
rs571553440 576 dbSNP
rs1219170249 577 dbSNP
rs1287211802 580 dbSNP
rs1483182386 581 dbSNP
rs1180658236 589 dbSNP
rs577257782 589 dbSNP
rs1243744035 595 dbSNP
rs1190994209 596 dbSNP
rs546214472 604 dbSNP
rs1424523982 605 dbSNP
rs772213612 607 dbSNP
rs772066847 615 dbSNP
rs79607065 616 dbSNP
rs1160181868 617 dbSNP
rs1272422291 618 dbSNP
rs969143876 623 dbSNP
rs878973326 626 dbSNP
rs1301063976 629 dbSNP
rs533629042 631 dbSNP
rs1396176823 633 dbSNP
rs746923971 637 dbSNP
rs1416110079 638 dbSNP
rs770747196 638 dbSNP
rs1177565245 642 dbSNP
rs1374131045 643 dbSNP
rs1241904756 645 dbSNP
rs1172667645 646 dbSNP
rs559468116 649 dbSNP
rs947800587 653 dbSNP
rs776478732 655 dbSNP
rs1166083981 657 dbSNP
rs1208614445 659 dbSNP
rs939185046 660 dbSNP
rs528805595 661 dbSNP
rs1483866791 664 dbSNP
rs878916294 667 dbSNP
rs542509671 669 dbSNP
rs759157581 673 dbSNP
rs1441731107 675 dbSNP
rs764919866 680 dbSNP
rs927628970 683 dbSNP
rs1432438995 686 dbSNP
rs1486718792 688 dbSNP
rs1173866277 690 dbSNP
rs988016640 691 dbSNP
rs1360762199 697 dbSNP
rs939025720 699 dbSNP
rs1470271510 700 dbSNP
rs1330035346 703 dbSNP
rs1397542139 710 dbSNP
rs1338709859 712 dbSNP
rs1057377841 714 dbSNP
rs913855632 723 dbSNP
rs1309597716 726 dbSNP
rs772474737 729 dbSNP
rs537676002 732 dbSNP
rs115427812 733 dbSNP
rs190987562 739 dbSNP
rs1313248449 742 dbSNP
rs750887182 745 dbSNP
rs1256199881 746 dbSNP
rs1459180289 748 dbSNP
rs1311881015 762 dbSNP
rs1199491044 764 dbSNP
rs1246410706 765 dbSNP
rs1006946581 767 dbSNP
rs1189187862 769 dbSNP
rs1355657064 771 dbSNP
rs1355923014 775 dbSNP
rs1326552517 777 dbSNP
rs1409189284 778 dbSNP
rs1427040981 780 dbSNP
rs1050942407 782 dbSNP
rs1217055248 792 dbSNP
rs569771450 796 dbSNP
rs532091547 799 dbSNP
rs776890698 800 dbSNP
rs1420805957 801 dbSNP
rs553778523 805 dbSNP
rs779826838 806 dbSNP
rs1329118403 808 dbSNP
rs1181362766 812 dbSNP
rs552176538 817 dbSNP
rs183618999 820 dbSNP
rs1433876428 837 dbSNP
rs1018201664 839 dbSNP
rs1202814177 842 dbSNP
rs1368792855 843 dbSNP
rs186868127 850 dbSNP
rs1218535167 857 dbSNP
rs554402703 863 dbSNP
rs1235737281 869 dbSNP
rs1320085051 872 dbSNP
rs1332025546 875 dbSNP
rs1219260340 879 dbSNP
rs1009102507 882 dbSNP
rs1277453565 885 dbSNP
rs1320096046 888 dbSNP
rs1224095721 891 dbSNP
rs1248212119 892 dbSNP
rs760038853 893 dbSNP
rs1395023501 902 dbSNP
rs1015169162 903 dbSNP
rs754291537 904 dbSNP
rs765675071 905 dbSNP
rs1478769266 906 dbSNP
rs1167939748 911 dbSNP
rs1175749192 923 dbSNP
rs1412483720 925 dbSNP
rs1403213186 927 dbSNP
rs755225024 928 dbSNP
rs779228312 930 dbSNP
rs748349008 946 dbSNP
rs1432026151 948 dbSNP
rs758434660 963 dbSNP
rs1342873644 971 dbSNP
rs571901495 972 dbSNP
rs1420763685 973 dbSNP
rs200012727 978 dbSNP
rs777728046 980 dbSNP
rs536887158 985 dbSNP
rs1230218170 986 dbSNP
rs1290932737 988 dbSNP
rs1359883921 993 dbSNP
rs746962682 999 dbSNP
rs1283647672 1002 dbSNP
rs770897277 1004 dbSNP
rs1371287825 1007 dbSNP
rs1193860199 1014 dbSNP
rs1305289760 1018 dbSNP
rs1236361418 1019 dbSNP
rs1471555092 1022 dbSNP
rs1025552113 1023 dbSNP
rs1183231505 1024 dbSNP
rs1385397607 1031 dbSNP
rs951383275 1036 dbSNP
rs1418731103 1037 dbSNP
rs746681512 1040 dbSNP
rs1289410172 1042 dbSNP
rs1157184202 1043 dbSNP
rs1362883101 1045 dbSNP
rs1001923718 1050 dbSNP
rs1419256476 1052 dbSNP
rs191455780 1053 dbSNP
rs372586912 1054 dbSNP
rs960520913 1054 dbSNP
rs1334141944 1066 dbSNP
rs1390120616 1071 dbSNP
rs1385140021 1081 dbSNP
rs1338763977 1087 dbSNP
rs1450378444 1089 dbSNP
rs1027718637 1096 dbSNP
rs1187677176 1097 dbSNP
rs776388860 1101 dbSNP
rs1238285783 1102 dbSNP
rs1306768128 1103 dbSNP
rs1352634533 1105 dbSNP
rs1205629748 1107 dbSNP
rs1348099243 1111 dbSNP
rs987964153 1116 dbSNP
rs1277907353 1117 dbSNP
rs78033894 1118 dbSNP
rs1211541770 1123 dbSNP
rs769612020 1126 dbSNP
rs1438655329 1130 dbSNP
rs1176442275 1132 dbSNP
rs1382538302 1143 dbSNP
rs1017200935 1144 dbSNP
rs1311437329 1147 dbSNP
rs969098726 1162 dbSNP
rs1400612921 1166 dbSNP
rs775058515 1167 dbSNP
rs762529122 1175 dbSNP
rs542719644 1181 dbSNP
rs1359784589 1184 dbSNP
rs1444808109 1186 dbSNP
rs763643560 1191 dbSNP
rs1337301573 1193 dbSNP
rs545954144 1194 dbSNP
rs932012879 1196 dbSNP
rs1433234184 1205 dbSNP
rs1050523103 1209 dbSNP
rs774995646 1213 dbSNP
rs1342728870 1216 dbSNP
rs1171571057 1222 dbSNP
rs1265606944 1224 dbSNP
rs1225309435 1226 dbSNP
rs762616721 1229 dbSNP
rs1430757571 1231 dbSNP
rs911991095 1238 dbSNP
rs1192259429 1243 dbSNP
rs1263188534 1243 dbSNP
rs12275018 1245 dbSNP
rs1211274191 1246 dbSNP
rs1208357618 1247 dbSNP
rs1196350960 1250 dbSNP
rs1482803976 1251 dbSNP
rs763822666 1253 dbSNP
rs913449000 1259 dbSNP
rs1036510736 1262 dbSNP
rs1229359730 1271 dbSNP
rs1239693239 1272 dbSNP
rs761279084 1273 dbSNP
rs770242708 1273 dbSNP
rs1438053997 1284 dbSNP
rs1198531778 1285 dbSNP
rs1376313848 1287 dbSNP
rs1479271353 1290 dbSNP
rs764789189 1292 dbSNP
rs995056187 1297 dbSNP
rs946293504 1298 dbSNP
rs761208379 1300 dbSNP
rs767038969 1302 dbSNP
rs1397404849 1303 dbSNP
rs1043207238 1304 dbSNP
rs1386443103 1307 dbSNP
rs573116805 1312 dbSNP
rs1329178976 1315 dbSNP
rs1475243367 1317 dbSNP
rs1406676603 1327 dbSNP
rs1283918438 1343 dbSNP
rs1034764203 1349 dbSNP
rs960468599 1352 dbSNP
rs751301527 1356 dbSNP
rs1216180179 1364 dbSNP
rs1197292636 1366 dbSNP
rs183367818 1367 dbSNP
rs1339604590 1368 dbSNP
rs1208910373 1373 dbSNP
rs1265677528 1374 dbSNP
rs1214317530 1376 dbSNP
rs1490959481 1381 dbSNP
rs1200777878 1383 dbSNP
rs754418329 1384 dbSNP
rs77270381 1386 dbSNP
rs952029036 1388 dbSNP
rs921212114 1391 dbSNP
rs1393484469 1392 dbSNP
rs953389659 1393 dbSNP
rs1398636959 1396 dbSNP
rs1333418684 1397 dbSNP
rs1172842811 1398 dbSNP
rs1401059324 1400 dbSNP
rs1331258026 1401 dbSNP
rs1462364617 1409 dbSNP
rs1397342414 1411 dbSNP
rs765698912 1419 dbSNP
rs986558951 1422 dbSNP
rs1161732250 1427 dbSNP
rs901300452 1430 dbSNP
rs796329733 1431 dbSNP
rs1388297574 1432 dbSNP
rs998108153 1436 dbSNP
rs1426388053 1440 dbSNP
rs1047508688 1443 dbSNP
rs186843684 1448 dbSNP
rs544852504 1452 dbSNP
rs1339693969 1460 dbSNP
rs1417075465 1462 dbSNP
rs761673365 1463 dbSNP
rs1398098757 1464 dbSNP
rs1297054532 1466 dbSNP
rs1326552066 1467 dbSNP
rs1243592865 1468 dbSNP
rs1330514881 1471 dbSNP
rs553388568 1499 dbSNP
rs1361156664 1501 dbSNP
rs1223609815 1505 dbSNP
rs1016882407 1507 dbSNP
rs1487570308 1514 dbSNP
rs969190234 1516 dbSNP
rs1002075410 1522 dbSNP
rs1208101544 1529 dbSNP
rs1423379604 1537 dbSNP
rs1355797510 1540 dbSNP
rs1185685923 1544 dbSNP
rs796118260 1546 dbSNP
rs1445486987 1547 dbSNP
rs1163931417 1555 dbSNP
rs960450292 1556 dbSNP
rs758615554 1559 dbSNP
rs1308913720 1561 dbSNP
rs1442129173 1566 dbSNP
rs1290616500 1567 dbSNP
rs1322191597 1568 dbSNP
rs1385041077 1569 dbSNP
rs1060174 1576 dbSNP
rs1309971485 1577 dbSNP
rs1159798670 1591 dbSNP
rs1384479142 1594 dbSNP
rs1246298014 1597 dbSNP
rs750210576 1599 dbSNP
rs1352027087 1605 dbSNP
rs913576477 1607 dbSNP
rs1218544352 1612 dbSNP
rs1379323869 1614 dbSNP
rs1261894833 1616 dbSNP
rs967626377 1617 dbSNP
rs1455449829 1622 dbSNP
rs34021269 1628 dbSNP
rs1060182 1640 dbSNP
rs1445425675 1641 dbSNP
rs781071527 1642 dbSNP
rs1379435669 1643 dbSNP
rs752770715 1644 dbSNP
rs1413401810 1646 dbSNP
rs1474361553 1647 dbSNP
rs745812292 1649 dbSNP
rs1039856065 1651 dbSNP
rs1009231839 1656 dbSNP
rs1364251033 1659 dbSNP
rs573099306 1666 dbSNP
rs922649333 1670 dbSNP
rs79930427 1677 dbSNP
rs563061668 1679 dbSNP
rs1452890385 1684 dbSNP
rs1047032012 1686 dbSNP
rs1330331792 1687 dbSNP
rs1375142987 1688 dbSNP
rs1225764744 1689 dbSNP
rs779774785 1693 dbSNP
rs1312077203 1696 dbSNP
rs1231749771 1697 dbSNP
rs528031849 1700 dbSNP
rs1265050913 1701 dbSNP
rs903686271 1708 dbSNP
rs777949247 1713 dbSNP
rs1005576805 1714 dbSNP
rs1038688431 1720 dbSNP
rs1178674492 1721 dbSNP
rs1251011171 1726 dbSNP
rs1432493522 1729 dbSNP
rs905142879 1730 dbSNP
rs143937755 1733 dbSNP
rs1378114113 1737 dbSNP
rs191324489 1740 dbSNP
rs1430772315 1741 dbSNP
rs1469928672 1754 dbSNP
rs568048971 1754 dbSNP
rs1034852142 1757 dbSNP
rs1169346353 1760 dbSNP
rs1352350525 1763 dbSNP
rs1443956553 1765 dbSNP
rs1299065504 1766 dbSNP
rs1367396628 1774 dbSNP
rs960420839 1776 dbSNP
rs1475669134 1784 dbSNP
rs11235098 1788 dbSNP
rs550774371 1790 dbSNP
rs1262717351 1798 dbSNP
rs1487373020 1798 dbSNP
rs1218025064 1799 dbSNP
rs774762774 1800 dbSNP
rs1256261753 1804 dbSNP
rs1020730942 1808 dbSNP
rs1309442874 1814 dbSNP
rs1205538874 1816 dbSNP
rs773887505 1820 dbSNP
rs376556339 1821 dbSNP
rs771738578 1822 dbSNP
rs866703755 1835 dbSNP
rs1480730686 1837 dbSNP
rs771079750 1843 dbSNP
rs1192248256 1844 dbSNP
rs1272469058 1845 dbSNP
rs1216225082 1849 dbSNP
rs777210022 1856 dbSNP
rs1411268369 1858 dbSNP
rs1313110460 1859 dbSNP
rs926174982 1865 dbSNP
rs760133424 1866 dbSNP
rs1357087587 1868 dbSNP
rs1349656654 1876 dbSNP
rs964266539 1879 dbSNP
rs765682490 1890 dbSNP
rs1305350343 1895 dbSNP
rs1346637497 1897 dbSNP
rs975530019 1903 dbSNP
rs1276350716 1909 dbSNP
rs570521785 1917 dbSNP
rs759355054 1920 dbSNP
rs1289519260 1924 dbSNP
rs1320148367 1925 dbSNP
rs1219905862 1926 dbSNP
rs1293704220 1934 dbSNP
rs1490482887 1936 dbSNP
rs763212745 1938 dbSNP
rs934207170 1941 dbSNP
rs1239843591 1944 dbSNP
rs764175476 1947 dbSNP
rs1484855965 1948 dbSNP
rs578227885 1952 dbSNP
rs76695320 1953 dbSNP
rs1412543069 1954 dbSNP
rs1442417223 1961 dbSNP
rs938227580 1964 dbSNP
rs1165818295 1965 dbSNP
rs908662897 1970 dbSNP
rs1188760691 1977 dbSNP
rs1366625161 1979 dbSNP
rs1419602134 1981 dbSNP
rs757263370 1983 dbSNP
rs1347037027 1984 dbSNP
rs1473869627 1985 dbSNP
rs941349454 1986 dbSNP
rs1038385047 1988 dbSNP
rs1283688917 1989 dbSNP
rs781264620 1996 dbSNP
rs1248487905 1998 dbSNP
rs1316857623 1999 dbSNP
rs1197380231 2003 dbSNP
rs1317850900 2005 dbSNP
rs182179078 2011 dbSNP
rs1234622289 2021 dbSNP
rs1376468255 2030 dbSNP
rs905069259 2037 dbSNP
rs1281978912 2044 dbSNP
rs1448672794 2048 dbSNP
rs937929368 2049 dbSNP
rs1215815885 2050 dbSNP
rs896153034 2051 dbSNP
rs1056281460 2052 dbSNP
rs896305712 2054 dbSNP
rs1185104203 2056 dbSNP
rs553148265 2059 dbSNP
rs1439540254 2065 dbSNP
rs140420534 2071 dbSNP
rs1410729434 2075 dbSNP
rs1401819601 2082 dbSNP
rs1333548422 2083 dbSNP
rs1404056488 2085 dbSNP
rs1454763904 2086 dbSNP
rs1337712053 2087 dbSNP
rs1376441580 2090 dbSNP
rs1432573393 2091 dbSNP
rs1237981714 2093 dbSNP
rs779864126 2094 dbSNP
rs1352699233 2099 dbSNP
rs1224309267 2100 dbSNP
rs1261941766 2101 dbSNP
rs1320869740 2102 dbSNP
rs1470712340 2110 dbSNP
rs1240345578 2117 dbSNP
rs1205170214 2120 dbSNP
rs1243303671 2121 dbSNP
rs1457053429 2125 dbSNP
rs1177179054 2130 dbSNP
rs1180046943 2130 dbSNP
rs1234993915 2131 dbSNP
rs1457674500 2133 dbSNP
rs11543040 2143 dbSNP
rs1172560973 2145 dbSNP
rs1427278163 2147 dbSNP
rs903633943 2152 dbSNP
rs1471037143 2159 dbSNP
rs903611765 2164 dbSNP
rs1399766143 2167 dbSNP
rs1288686290 2168 dbSNP
rs1340709239 2169 dbSNP
rs1000899941 2175 dbSNP
rs12290079 2186 dbSNP
rs1000638058 2190 dbSNP
rs1017243116 2201 dbSNP
rs1326567281 2204 dbSNP
rs1337361201 2210 dbSNP
rs187944620 2214 dbSNP
rs1282636405 2216 dbSNP
rs1321338447 2218 dbSNP
rs1371597991 2220 dbSNP
rs1224754974 2221 dbSNP
rs975626411 2222 dbSNP
rs1369047163 2227 dbSNP
rs916687004 2229 dbSNP
rs1029895027 2230 dbSNP
rs1338298936 2231 dbSNP
rs775916266 2238 dbSNP
rs1008524200 2246 dbSNP
rs1164182514 2250 dbSNP
rs1278465137 2254 dbSNP
rs1019584377 2255 dbSNP
rs1275532186 2258 dbSNP
rs1346237221 2262 dbSNP
rs1438816144 2263 dbSNP
rs1198775053 2267 dbSNP
rs1254154449 2273 dbSNP
rs983003563 2275 dbSNP
rs908583862 2278 dbSNP
rs1193485944 2279 dbSNP
rs966029279 2284 dbSNP
rs1481716866 2293 dbSNP
rs1219242779 2299 dbSNP
rs1200179492 2302 dbSNP
rs1215913429 2303 dbSNP
rs1287060546 2304 dbSNP
rs1423052841 2305 dbSNP
rs1460637343 2306 dbSNP
rs1169926203 2309 dbSNP
rs1239128729 2312 dbSNP
rs972088369 2315 dbSNP
rs768515830 2321 dbSNP
rs2212616 2322 dbSNP
rs747805162 2323 dbSNP
rs1343514950 2325 dbSNP
rs1406730178 2330 dbSNP
rs974044183 2333 dbSNP
rs771650737 2336 dbSNP
rs1325399942 2337 dbSNP
rs1224779232 2342 dbSNP
rs1271641730 2345 dbSNP
rs984907887 2346 dbSNP
rs926622941 2347 dbSNP
rs1339667268 2354 dbSNP
rs867908062 2355 dbSNP
rs544549524 2356 dbSNP
rs1490973822 2359 dbSNP
rs368714151 2361 dbSNP
rs1396134644 2362 dbSNP
rs1261113634 2363 dbSNP
rs938231345 2374 dbSNP
rs992362314 2376 dbSNP
rs938021207 2377 dbSNP
rs1373801179 2383 dbSNP
rs1472605583 2385 dbSNP
rs1162654058 2386 dbSNP
rs1215524104 2390 dbSNP
rs1485795120 2395 dbSNP
rs145528412 2396 dbSNP
rs1230826155 2398 dbSNP
rs896441672 2400 dbSNP
rs1303751095 2401 dbSNP
rs1383618273 2415 dbSNP
rs772915101 2418 dbSNP
rs545886033 2420 dbSNP
rs1326607425 2421 dbSNP
rs945169785 2428 dbSNP
rs1244839891 2433 dbSNP
rs1313340521 2435 dbSNP
rs1219304186 2437 dbSNP
rs1362110990 2440 dbSNP
rs193232367 2449 dbSNP
rs1042010986 2450 dbSNP
rs528159593 2455 dbSNP
rs1485185892 2456 dbSNP
rs1304917876 2466 dbSNP
rs1206924545 2468 dbSNP
rs185305615 2470 dbSNP
rs1351128687 2472 dbSNP
rs936385510 2475 dbSNP
rs1182033278 2481 dbSNP
rs561321152 2482 dbSNP
rs1475304665 2491 dbSNP
rs1383144743 2504 dbSNP
rs74542118 2506 dbSNP
rs1163990435 2512 dbSNP
rs1482834998 2517 dbSNP
rs1363103487 2522 dbSNP
rs1049497049 2527 dbSNP
rs1000634850 2531 dbSNP
rs889617873 2533 dbSNP
rs1290079453 2537 dbSNP
rs1303402934 2542 dbSNP
rs1385107148 2547 dbSNP
rs1315997396 2561 dbSNP
rs1276330782 2562 dbSNP
rs1017337824 2568 dbSNP
rs1451441305 2572 dbSNP
rs1334360684 2573 dbSNP
rs1341261939 2576 dbSNP
rs763189611 2577 dbSNP
rs1315164334 2580 dbSNP
rs1453760947 2584 dbSNP
rs190301130 2586 dbSNP
rs1008100731 2591 dbSNP
rs1310477722 2593 dbSNP
rs1467587367 2604 dbSNP
rs1315614158 2611 dbSNP
rs539955852 2621 dbSNP
rs1398772998 2624 dbSNP
rs1261363797 2628 dbSNP
rs1029863834 2629 dbSNP
rs1369820665 2632 dbSNP
rs1202007699 2636 dbSNP
rs1203621292 2639 dbSNP
rs766143854 2640 dbSNP
rs1245129097 2643 dbSNP
rs1461953225 2644 dbSNP
rs374254506 2648 dbSNP
rs1456352879 2655 dbSNP
rs1249600342 2656 dbSNP
rs1257386297 2661 dbSNP
rs1417211055 2666 dbSNP
rs1357211947 2667 dbSNP
rs1267447841 2671 dbSNP
rs983314600 2673 dbSNP
rs192846979 2687 dbSNP
rs1321362411 2688 dbSNP
rs1412057682 2690 dbSNP
rs1468769068 2694 dbSNP
rs1173651809 2707 dbSNP
rs1449512276 2707 dbSNP
rs1407781899 2712 dbSNP
rs994104548 2714 dbSNP
rs1470024442 2716 dbSNP
rs767584139 2720 dbSNP
rs1252347646 2721 dbSNP
rs1371694030 2723 dbSNP
rs1160955251 2724 dbSNP
rs963088636 2727 dbSNP
rs1308425861 2728 dbSNP
rs74933096 2742 dbSNP
rs1437647183 2744 dbSNP
rs1345441864 2745 dbSNP
rs1221707679 2747 dbSNP
rs750537679 2748 dbSNP
rs1324498457 2755 dbSNP
rs1204146212 2763 dbSNP
rs926718001 2766 dbSNP
rs959358076 2767 dbSNP
rs992168226 2772 dbSNP
rs1252373538 2774 dbSNP
rs1480082272 2775 dbSNP
rs917788215 2777 dbSNP
rs945332550 2782 dbSNP
rs373482704 2783 dbSNP
rs925130100 2789 dbSNP
rs936533951 2791 dbSNP
rs1352041587 2796 dbSNP
rs1033803152 2798 dbSNP
rs147730741 2800 dbSNP
rs1309035613 2801 dbSNP
rs1365456170 2805 dbSNP
rs767093131 2807 dbSNP
rs1403677024 2811 dbSNP
rs117848575 2818 dbSNP
rs1346291963 2821 dbSNP
rs918101490 2823 dbSNP
rs1332555781 2828 dbSNP
rs1293614716 2835 dbSNP
rs4636701 2836 dbSNP
rs1051438832 2837 dbSNP
rs1275125374 2840 dbSNP
rs1286246795 2840 dbSNP
rs924903119 2841 dbSNP
rs1220226983 2843 dbSNP
rs113976566 2844 dbSNP
rs142628212 2848 dbSNP
rs1185439294 2850 dbSNP
rs1004480222 2851 dbSNP
rs1416880217 2852 dbSNP
rs1429957125 2855 dbSNP
rs538539674 2861 dbSNP
rs1285685034 2863 dbSNP
rs1201413629 2865 dbSNP
rs1271378090 2866 dbSNP
rs1385054377 2869 dbSNP
rs1423273489 2870 dbSNP
rs1347715791 2872 dbSNP
rs1273631962 2877 dbSNP
rs1305557367 2880 dbSNP
rs1350977239 2884 dbSNP
rs1430036422 2899 dbSNP
rs1287212755 2900 dbSNP
rs558120403 2901 dbSNP
rs369650318 2909 dbSNP
rs995713603 2918 dbSNP
rs1359520241 2923 dbSNP
rs1298033600 2925 dbSNP
rs1334515133 2927 dbSNP
rs1416002218 2928 dbSNP
rs1358538996 2929 dbSNP
rs1243680099 2930 dbSNP
rs1238697983 2933 dbSNP
rs1293773222 2934 dbSNP
rs184185340 2937 dbSNP
rs758441267 2938 dbSNP
rs1239894995 2941 dbSNP
rs1480150273 2942 dbSNP
rs1486628708 2946 dbSNP
rs1188867092 2947 dbSNP
rs994051812 2948 dbSNP
rs1048344657 2954 dbSNP
rs887766403 2958 dbSNP
rs142434402 2960 dbSNP
rs75326447 2961 dbSNP
rs1400669321 2969 dbSNP
rs1156974868 2979 dbSNP
rs967143107 2983 dbSNP
rs1013635130 2993 dbSNP
rs978017796 2994 dbSNP
rs1025062936 2995 dbSNP
rs1436072050 3002 dbSNP
rs751651705 3004 dbSNP
rs1336400719 3012 dbSNP
rs1380865120 3015 dbSNP
rs1259372189 3019 dbSNP
rs966854021 3022 dbSNP
rs1450118812 3025 dbSNP
rs925233104 3030 dbSNP
rs1285760062 3036 dbSNP
rs770507791 3040 dbSNP
rs572624115 3045 dbSNP
rs867258857 3061 dbSNP
rs757064392 3062 dbSNP
rs1038853129 3067 dbSNP
rs1208811913 3068 dbSNP
rs1333272135 3073 dbSNP
rs1242078394 3080 dbSNP
rs1232015315 3081 dbSNP
rs1402402019 3083 dbSNP
rs921645168 3083 dbSNP
rs112021061 3084 dbSNP
rs1185767870 3088 dbSNP
rs1238452733 3090 dbSNP
rs1470054473 3092 dbSNP
rs1176045287 3093 dbSNP
rs1410247794 3095 dbSNP
rs1466683130 3097 dbSNP
rs1457777106 3098 dbSNP
rs76614749 3100 dbSNP
rs377704171 3108 dbSNP
rs1183386549 3113 dbSNP
rs1404121209 3114 dbSNP
rs1471098459 3116 dbSNP
rs1458572479 3118 dbSNP
rs985166315 3126 dbSNP
rs1196189426 3131 dbSNP
rs781333557 3132 dbSNP
rs886092290 3133 dbSNP
rs1004978810 3135 dbSNP
rs1277628766 3136 dbSNP
rs1352267988 3139 dbSNP
rs777054859 3141 dbSNP
rs774768143 3143 dbSNP
rs1040825551 3145 dbSNP
rs188512938 3149 dbSNP
rs1291604231 3150 dbSNP
rs1329295384 3152 dbSNP
rs1320931238 3153 dbSNP
rs1205230465 3156 dbSNP
rs1279768895 3157 dbSNP
rs1437682518 3159 dbSNP
rs1353941903 3160 dbSNP
rs1320165958 3161 dbSNP
rs1165588181 3165 dbSNP
rs1180116559 3167 dbSNP
rs1235048585 3176 dbSNP
rs1411933839 3177 dbSNP
rs1473219223 3182 dbSNP
rs898782499 3185 dbSNP
rs751335358 3188 dbSNP
rs1481531339 3190 dbSNP
rs1440747968 3192 dbSNP
rs761988408 3193 dbSNP
rs1396041872 3200 dbSNP
rs1409092979 3206 dbSNP
rs746228144 3216 dbSNP
rs1372285356 3219 dbSNP
rs550544350 3224 dbSNP
rs564267567 3228 dbSNP
rs929828080 3235 dbSNP
rs1480596840 3236 dbSNP
rs371307326 3237 dbSNP
rs760628613 3238 dbSNP
rs1449476445 3243 dbSNP
rs1234955381 3246 dbSNP
rs1013663746 3250 dbSNP
rs1025505165 3251 dbSNP
rs546507876 3254 dbSNP
rs888393150 3257 dbSNP
rs1338360557 3259 dbSNP
rs1306812555 3262 dbSNP
rs1223086562 3263 dbSNP
rs766483625 3264 dbSNP
rs754905361 3269 dbSNP
rs767533670 3269 dbSNP
rs966735192 3269 dbSNP
rs1277255295 3270 dbSNP
rs1442720904 3272 dbSNP
rs538929945 3273 dbSNP
rs1222469310 3274 dbSNP
rs529424437 3278 dbSNP
rs1382488499 3280 dbSNP
rs755000551 3281 dbSNP
rs1025054837 3282 dbSNP
rs637734 3286 dbSNP
rs1199686247 3289 dbSNP
rs1372668204 3291 dbSNP
rs902683857 3299 dbSNP
rs1474566473 3300 dbSNP
rs1032228516 3307 dbSNP
rs775371066 3307 dbSNP
rs1165906821 3309 dbSNP
rs1391833537 3313 dbSNP
rs764935516 3314 dbSNP
rs181014749 3319 dbSNP
rs1363644679 3321 dbSNP
rs1387948355 3322 dbSNP
rs958291493 3323 dbSNP
rs752589187 3324 dbSNP
rs1283557305 3329 dbSNP
rs778876268 3335 dbSNP
rs1224840474 3338 dbSNP
rs1460942839 3340 dbSNP
rs1300246551 3342 dbSNP
rs1343395142 3343 dbSNP
rs1303379696 3344 dbSNP
rs986129821 3345 dbSNP
rs549459759 3348 dbSNP
rs1245701008 3349 dbSNP
rs1290143768 3352 dbSNP
rs1017906814 3358 dbSNP
rs749776274 3359 dbSNP
rs1210464295 3367 dbSNP
rs1261174899 3368 dbSNP
rs547336780 3370 dbSNP
rs1445472023 3372 dbSNP
rs921780140 3376 dbSNP
rs933181862 3381 dbSNP
rs1400781659 3386 dbSNP
rs976489504 3387 dbSNP
rs918367495 3388 dbSNP
rs1449919589 3389 dbSNP
rs1162681005 3395 dbSNP
rs185292733 3396 dbSNP
rs1178944386 3401 dbSNP
rs1459349078 3401 dbSNP
rs1163364367 3408 dbSNP
rs1383550178 3409 dbSNP
rs777529034 3412 dbSNP
rs1322055821 3413 dbSNP
rs760462728 3414 dbSNP
rs1365461618 3428 dbSNP
rs537900012 3432 dbSNP
rs1313335468 3434 dbSNP
rs1324063736 3437 dbSNP
rs1193780775 3443 dbSNP
rs1246108581 3445 dbSNP
rs1260234659 3446 dbSNP
rs746665122 3448 dbSNP
rs2847353 3454 dbSNP
rs1260637499 3466 dbSNP
rs1210667286 3468 dbSNP
rs1269072189 3469 dbSNP
rs1461020863 3474 dbSNP
rs750372084 3476 dbSNP
rs756667695 3477 dbSNP
rs1205309546 3486 dbSNP
rs909718557 3490 dbSNP
rs1425505755 3491 dbSNP
rs558116778 3492 dbSNP
rs1201717231 3494 dbSNP
rs1362709606 3498 dbSNP
rs937238030 3499 dbSNP
rs1342578032 3500 dbSNP
rs1037781440 3509 dbSNP
rs895149687 3512 dbSNP
rs1160717711 3513 dbSNP
rs780815531 3518 dbSNP
rs1468650920 3520 dbSNP
rs1468932014 3521 dbSNP
rs1335169790 3522 dbSNP
rs1406026969 3523 dbSNP
rs749758302 3529 dbSNP
rs1397127128 3544 dbSNP
rs1466775995 3545 dbSNP
rs769249720 3547 dbSNP
rs1334494160 3548 dbSNP
rs1230362505 3552 dbSNP
rs1268816236 3558 dbSNP
rs571874773 3560 dbSNP
rs1169387673 3562 dbSNP
rs949423544 3573 dbSNP
rs1201950046 3576 dbSNP
rs1179922530 3579 dbSNP
rs752732285 3582 dbSNP
rs36024875 3583 dbSNP
rs773943858 3583 dbSNP
rs77844837 3584 dbSNP
rs79534416 3585 dbSNP
rs1249796103 3593 dbSNP
rs772454356 3596 dbSNP
rs1183758704 3598 dbSNP
rs1411998975 3601 dbSNP
rs1479914386 3602 dbSNP
rs773352717 3610 dbSNP
rs1226895065 3614 dbSNP
rs1388582199 3622 dbSNP
rs1194596727 3625 dbSNP
rs1360533797 3626 dbSNP
rs573853200 3629 dbSNP
rs151326632 3635 dbSNP
rs1395015825 3639 dbSNP
rs1382665297 3642 dbSNP
rs1233361379 3649 dbSNP
rs1412175452 3652 dbSNP
rs1032482679 3654 dbSNP
rs1393610575 3661 dbSNP
rs1344896117 3666 dbSNP
rs1458054225 3667 dbSNP
rs1369869902 3668 dbSNP
rs776837191 3670 dbSNP
rs1161413753 3675 dbSNP
rs759359498 3684 dbSNP
rs1443834897 3685 dbSNP
rs368128077 3688 dbSNP
rs1233761810 3704 dbSNP
rs576243460 3706 dbSNP
rs752713716 3708 dbSNP
rs1025051852 3710 dbSNP
rs1259768040 3715 dbSNP
rs1207142941 3717 dbSNP
rs1251916424 3724 dbSNP
rs10898668 3727 dbSNP
rs1267507311 3729 dbSNP
rs1211075809 3741 dbSNP
rs1188938593 3745 dbSNP
rs976437784 3749 dbSNP
rs1310452034 3750 dbSNP
rs1192261474 3754 dbSNP
rs1433377503 3757 dbSNP
rs1334534719 3779 dbSNP
rs1170226604 3781 dbSNP
rs763996527 3790 dbSNP
rs564089430 3793 dbSNP
rs1386884220 3803 dbSNP
rs533100467 3805 dbSNP
rs71654493 3806 dbSNP
rs1032321365 3807 dbSNP
rs550273747 3807 dbSNP
rs1468498191 3810 dbSNP
rs200140015 3811 dbSNP
rs879368887 3812 dbSNP
rs957918752 3816 dbSNP
rs1433903008 3821 dbSNP
rs984283757 3823 dbSNP
rs1295335808 3829 dbSNP
rs776432393 3831 dbSNP
rs1368614678 3836 dbSNP
rs1381818479 3837 dbSNP
rs1220446990 3841 dbSNP
rs759410749 3843 dbSNP
rs1339729186 3845 dbSNP
rs1287131606 3846 dbSNP
rs909675457 3848 dbSNP
rs974616762 3853 dbSNP
rs1279541331 3859 dbSNP
rs1294172740 3861 dbSNP
rs1233327268 3869 dbSNP
rs1393773384 3879 dbSNP
rs567770067 3881 dbSNP
rs1358615029 3883 dbSNP
rs1218792522 3885 dbSNP
rs991415979 3890 dbSNP
rs1403897498 3891 dbSNP
rs1378907590 3901 dbSNP
rs1247904049 3903 dbSNP
rs560399015 3904 dbSNP
rs1488615115 3909 dbSNP
rs750003194 3911 dbSNP
rs1246576211 3913 dbSNP
rs917195884 3917 dbSNP
rs987744087 3920 dbSNP
rs1398780645 3921 dbSNP
rs1169604417 3927 dbSNP
rs1385207650 3931 dbSNP
rs1173156473 3933 dbSNP
rs1391754239 3933 dbSNP
rs1404058733 3934 dbSNP
rs907583272 3940 dbSNP
rs1046360867 3941 dbSNP
rs940453970 3944 dbSNP
rs973063573 3949 dbSNP
rs1264222385 3954 dbSNP
rs1350485676 3961 dbSNP
rs1195752941 3965 dbSNP
rs920245989 3975 dbSNP
rs765162307 3979 dbSNP
rs1430286314 3984 dbSNP
rs1318865439 3986 dbSNP
rs1284181226 3987 dbSNP
rs1367605330 3994 dbSNP
rs751631694 3996 dbSNP
rs1298022622 3997 dbSNP
rs140430696 3998 dbSNP
rs1226485590 4004 dbSNP
rs1212390077 4009 dbSNP
rs1291418344 4020 dbSNP
rs150406790 4027 dbSNP
rs1214450407 4040 dbSNP
rs949548658 4043 dbSNP
rs1325567091 4054 dbSNP
rs1428380384 4054 dbSNP
rs1334579465 4058 dbSNP
rs1397664538 4063 dbSNP
rs111462945 4064 dbSNP
rs1174327418 4064 dbSNP
rs1265913383 4070 dbSNP
rs1176980701 4074 dbSNP
rs1007498578 4076 dbSNP
rs1465955325 4077 dbSNP
rs1189651114 4084 dbSNP
rs1039960463 4085 dbSNP
rs901401929 4086 dbSNP
rs567276415 4091 dbSNP
rs1047005834 4104 dbSNP
rs1459923418 4109 dbSNP
rs12800828 4116 dbSNP
rs1241880656 4119 dbSNP
rs1202465676 4123 dbSNP
rs998451711 4126 dbSNP
rs1400254710 4137 dbSNP
rs1157007195 4146 dbSNP
rs1391159374 4154 dbSNP
rs764657800 4156 dbSNP
rs1338368433 4157 dbSNP
rs746245515 4157 dbSNP
rs1321002051 4158 dbSNP
rs1284530820 4159 dbSNP
rs902570318 4160 dbSNP
rs201223619 4168 dbSNP
rs1000029158 4169 dbSNP
rs779350096 4170 dbSNP
rs142700961 4171 dbSNP
rs202102436 4171 dbSNP
rs750970800 4171 dbSNP
rs775950156 4171 dbSNP
rs781764219 4171 dbSNP
rs867018805 4171 dbSNP
rs61911675 4172 dbSNP
rs61911676 4173 dbSNP
rs1408381184 4174 dbSNP
rs1227294457 4176 dbSNP
rs369020875 4179 dbSNP
rs1164174151 4180 dbSNP
rs138302647 4182 dbSNP
rs1330800600 4184 dbSNP
rs1297408389 4185 dbSNP
rs893789182 4186 dbSNP
rs996171206 4188 dbSNP
rs373190016 4192 dbSNP
rs1028858315 4194 dbSNP
rs954794956 4198 dbSNP
rs1212671536 4201 dbSNP
rs991307691 4205 dbSNP
rs1238606931 4206 dbSNP
rs1470046467 4213 dbSNP
rs1290208082 4214 dbSNP
rs1247882865 4215 dbSNP
rs1180144947 4218 dbSNP
rs1414212780 4227 dbSNP
rs1473047698 4228 dbSNP
rs750648167 4231 dbSNP
rs1400326373 4233 dbSNP
rs1015184987 4237 dbSNP
rs1335909846 4240 dbSNP
rs1359709081 4243 dbSNP
rs961933648 4244 dbSNP
rs917101216 4246 dbSNP
rs1305660019 4249 dbSNP
rs1043225433 4250 dbSNP
rs1351729318 4251 dbSNP
rs1230890003 4252 dbSNP
rs1440173397 4254 dbSNP
rs531809474 4261 dbSNP
rs1273942125 4276 dbSNP
rs920383648 4280 dbSNP
rs1221334786 4281 dbSNP
rs17149940 4282 dbSNP
rs1250012036 4289 dbSNP
rs1437782718 4295 dbSNP
rs1203555207 4297 dbSNP
rs571581982 4300 dbSNP
rs1483459843 4301 dbSNP
rs915334269 4306 dbSNP
rs1474306807 4307 dbSNP
rs1376178663 4314 dbSNP
rs1479109136 4317 dbSNP
rs1290701224 4327 dbSNP
rs7936013 4328 dbSNP
rs1425541567 4331 dbSNP
rs567613345 4332 dbSNP
rs1166716962 4333 dbSNP
rs1372317312 4336 dbSNP
rs1409958538 4341 dbSNP
rs1322272779 4347 dbSNP
rs1046527601 4350 dbSNP
rs1284015817 4369 dbSNP
rs11308630 4370 dbSNP
rs1302895050 4370 dbSNP
rs762621838 4370 dbSNP
rs1438105393 4373 dbSNP
rs1352566728 4375 dbSNP
rs1157642293 4380 dbSNP
rs1436330457 4380 dbSNP
rs1275825084 4381 dbSNP
rs775512178 4383 dbSNP
rs1226642101 4385 dbSNP
rs1277463116 4386 dbSNP
rs935535248 4387 dbSNP
rs1343467322 4388 dbSNP
rs1209356646 4390 dbSNP
rs763044276 4391 dbSNP
rs1453558775 4394 dbSNP
rs1199774374 4396 dbSNP
rs141312875 4401 dbSNP
rs751414793 4405 dbSNP
rs10898669 4410 dbSNP
rs7936130 4418 dbSNP
rs750071231 4423 dbSNP
rs1162152580 4427 dbSNP
rs958677187 4433 dbSNP
rs1387878666 4442 dbSNP
rs890349725 4450 dbSNP
rs1009217649 4452 dbSNP
rs1323879917 4454 dbSNP
rs1012632992 4456 dbSNP
rs1312724526 4461 dbSNP
rs1263787420 4462 dbSNP
rs755552251 4463 dbSNP
rs747682955 4464 dbSNP
rs1321647452 4468 dbSNP
rs1366594365 4472 dbSNP
rs1244631044 4473 dbSNP
rs1263768924 4476 dbSNP
rs1014867333 4478 dbSNP
rs1364445371 4481 dbSNP
rs1210499405 4483 dbSNP
rs1267796338 4487 dbSNP
rs1430587032 4490 dbSNP
rs1314352105 4495 dbSNP
rs1024060175 4497 dbSNP
rs1212041146 4502 dbSNP
rs962184140 4504 dbSNP
rs1249613844 4505 dbSNP
rs779550129 4506 dbSNP
rs1259340522 4511 dbSNP
rs994708275 4517 dbSNP
rs753187481 4519 dbSNP
rs1027374662 4524 dbSNP
rs144775611 4527 dbSNP
rs991131913 4528 dbSNP
rs758969471 4530 dbSNP
rs1205630574 4534 dbSNP
rs557486521 4534 dbSNP
rs1460089334 4538 dbSNP
rs1455278591 4543 dbSNP
rs1322989455 4544 dbSNP
rs116844093 4545 dbSNP
rs1228359345 4551 dbSNP
rs1242808511 4553 dbSNP
rs1349446119 4553 dbSNP
rs989861543 4553 dbSNP
rs75501654 4554 dbSNP
rs771231015 4555 dbSNP
rs538686986 4561 dbSNP
rs1185908671 4562 dbSNP
rs1245665486 4563 dbSNP
rs565100060 4570 dbSNP
rs1451100254 4571 dbSNP
rs1327372828 4573 dbSNP
rs1298272090 4576 dbSNP
rs1210762695 4577 dbSNP
rs866775758 4578 dbSNP
rs532176432 4579 dbSNP
rs1387009869 4580 dbSNP
rs1424237817 4580 dbSNP
rs1181609727 4582 dbSNP
rs1460827749 4583 dbSNP
rs1199649372 4585 dbSNP
rs1374559634 4589 dbSNP
rs1196491666 4591 dbSNP
rs1254050524 4592 dbSNP
rs540537784 4594 dbSNP
rs1204258695 4596 dbSNP
rs1188081292 4604 dbSNP
rs560477406 4608 dbSNP
rs1317623832 4624 dbSNP
rs1471410056 4626 dbSNP
rs1244351827 4628 dbSNP
rs76114532 4633 dbSNP
rs1412241795 4638 dbSNP
rs769982214 4642 dbSNP
rs1050499509 4643 dbSNP
rs776341194 4647 dbSNP
rs1287702931 4649 dbSNP
rs542871871 4653 dbSNP
rs1397074659 4670 dbSNP
rs1297320373 4673 dbSNP
rs1303136527 4676 dbSNP
rs1424909749 4681 dbSNP
rs562673941 4683 dbSNP
rs1348637855 4687 dbSNP
rs1346120207 4688 dbSNP
rs1008938978 4692 dbSNP
rs1161471248 4694 dbSNP
rs1289282511 4695 dbSNP
rs768766399 4696 dbSNP
rs1232306492 4712 dbSNP
rs1182596292 4718 dbSNP
rs894152220 4721 dbSNP
rs759392388 4730 dbSNP
rs1176773352 4738 dbSNP
rs761625026 4745 dbSNP
rs189566335 4747 dbSNP
rs994634651 4753 dbSNP
rs998668348 4754 dbSNP
rs199909607 4755 dbSNP
rs762006965 4755 dbSNP
rs765979327 4755 dbSNP
rs1177697343 4757 dbSNP
rs1250850802 4759 dbSNP
rs1432195262 4760 dbSNP
rs551809652 4765 dbSNP
rs1379676992 4767 dbSNP
rs1301032233 4769 dbSNP
rs1394279820 4769 dbSNP
rs1435888680 4770 dbSNP
rs1168584901 4773 dbSNP
rs1369231646 4774 dbSNP
rs1411798728 4775 dbSNP
rs1308678508 4776 dbSNP
rs1367202946 4777 dbSNP
rs1395951841 4778 dbSNP
rs665084 4782 dbSNP
rs1385254282 4783 dbSNP
rs665086 4784 dbSNP
rs1298937072 4787 dbSNP
rs957485739 4791 dbSNP
rs1362081733 4793 dbSNP
rs1325764227 4797 dbSNP
rs1234736767 4799 dbSNP
rs894203767 4801 dbSNP
rs1369305390 4803 dbSNP
rs1444775443 4805 dbSNP
rs1280425480 4806 dbSNP
rs1490307636 4807 dbSNP
rs1339941629 4812 dbSNP
rs1206721020 4816 dbSNP
rs1251333912 4817 dbSNP
rs990089222 4819 dbSNP
rs1207351591 4822 dbSNP
rs1012656183 4823 dbSNP
rs1189030853 4827 dbSNP
rs12276145 4828 dbSNP
rs540647685 4830 dbSNP
rs964079927 4835 dbSNP
rs977147221 4837 dbSNP
rs1281050032 4842 dbSNP
rs371068801 4850 dbSNP
rs548252045 4851 dbSNP
rs956954176 4855 dbSNP
rs989584448 4859 dbSNP
rs547374989 4861 dbSNP
rs1456584333 4865 dbSNP
rs1295571693 4866 dbSNP
rs1214303269 4868 dbSNP
rs915397342 4869 dbSNP
rs1441424900 4871 dbSNP
rs567649574 4872 dbSNP
rs182309811 4873 dbSNP
rs621227 4877 dbSNP
rs1362972862 4878 dbSNP
rs1467025096 4879 dbSNP
rs934130542 4881 dbSNP
rs1273105266 4882 dbSNP
rs765868394 4887 dbSNP
rs1218725061 4889 dbSNP
rs1470377498 4891 dbSNP
rs1266890052 4893 dbSNP
rs116080913 4894 dbSNP
rs1208526666 4895 dbSNP
rs767478827 4897 dbSNP
rs912016031 4899 dbSNP
rs1451891548 4901 dbSNP
rs1187542615 4903 dbSNP
rs1174464454 4909 dbSNP
rs944671793 4914 dbSNP
rs1413690802 4915 dbSNP
rs17149955 4921 dbSNP
rs897715607 4924 dbSNP
rs1445747384 4931 dbSNP
rs1395538904 4936 dbSNP
rs1203741972 4937 dbSNP
rs930562563 4941 dbSNP
rs764622590 4945 dbSNP
rs1386099091 4958 dbSNP
rs894145181 4960 dbSNP
rs10501635 4964 dbSNP
rs757585660 4971 dbSNP
rs372321383 4974 dbSNP
rs558333070 4977 dbSNP
rs1412051706 4981 dbSNP
rs781470197 4982 dbSNP
rs1337385932 4986 dbSNP
rs1314196780 4988 dbSNP
rs1329982721 4993 dbSNP
rs746087415 4996 dbSNP
rs187089236 5007 dbSNP
rs998573492 5011 dbSNP
rs1466579517 5017 dbSNP
rs906958250 5018 dbSNP
rs998887188 5021 dbSNP
rs1169988243 5022 dbSNP
rs1237456272 5023 dbSNP
rs892970840 5024 dbSNP
rs1390101623 5025 dbSNP
rs1183697566 5026 dbSNP
rs1011905100 5031 dbSNP
rs1017555518 5034 dbSNP
rs138715081 5038 dbSNP
rs975436367 5040 dbSNP
rs761643398 5050 dbSNP
rs116834457 5051 dbSNP
rs1318689892 5054 dbSNP
rs1197415794 5056 dbSNP
rs191894163 5061 dbSNP
rs982895663 5065 dbSNP
rs1445662042 5071 dbSNP
rs1314187348 5073 dbSNP
rs1022542940 5076 dbSNP
rs1248018912 5079 dbSNP
rs1436966133 5081 dbSNP
rs1312975032 5082 dbSNP
rs1179283593 5084 dbSNP
rs774274535 5091 dbSNP
rs953540516 5092 dbSNP
rs372601204 5097 dbSNP
rs911927582 5098 dbSNP
rs1224721496 5104 dbSNP
rs764959845 5124 dbSNP
rs1383972879 5127 dbSNP
rs972448471 5128 dbSNP
rs1180755630 5137 dbSNP
rs750334588 5143 dbSNP
rs748046198 5147 dbSNP
rs1470257816 5148 dbSNP
rs1414943986 5153 dbSNP
rs1179154589 5159 dbSNP
rs1476675400 5163 dbSNP
rs754252924 5165 dbSNP
rs1224499268 5166 dbSNP
rs1357164262 5178 dbSNP
rs930652455 5183 dbSNP
rs1258823934 5185 dbSNP
rs377078686 5189 dbSNP
rs553787144 5190 dbSNP
rs7926724 5191 dbSNP
rs1470611680 5194 dbSNP
rs772944429 5200 dbSNP
rs779542136 5201 dbSNP
rs1052912773 5203 dbSNP
rs1412688585 5204 dbSNP
rs1175509814 5207 dbSNP
rs1407203008 5209 dbSNP
rs1375977943 5226 dbSNP
rs559564466 5231 dbSNP
rs1305603054 5239 dbSNP
rs562549358 5240 dbSNP
rs1337190486 5241 dbSNP
rs1442414551 5246 dbSNP
rs1164608196 5250 dbSNP
rs1414339847 5251 dbSNP
rs542911623 5252 dbSNP
rs1045570821 5266 dbSNP
rs1472043717 5269 dbSNP
rs906923465 5273 dbSNP
rs554547909 5277 dbSNP
rs1338549846 5278 dbSNP
rs766068641 5280 dbSNP
rs776288000 5292 dbSNP
rs1245920739 5299 dbSNP
rs1276803627 5303 dbSNP
rs1438621990 5305 dbSNP
rs12282551 5306 dbSNP
rs892801731 5309 dbSNP
rs1023876816 5312 dbSNP
rs1226701667 5314 dbSNP
rs565417160 5321 dbSNP
rs1476950609 5323 dbSNP
rs1195235147 5329 dbSNP
rs1254815803 5330 dbSNP
rs1406997264 5341 dbSNP
rs764668167 5342 dbSNP
rs1428976903 5343 dbSNP
rs1166193445 5349 dbSNP
rs1397927952 5356 dbSNP
rs527762593 5358 dbSNP
rs1456306022 5359 dbSNP
rs547413562 5359 dbSNP
rs955361419 5364 dbSNP
rs1373008715 5366 dbSNP
rs1322545917 5367 dbSNP
rs10898670 5369 dbSNP
rs1479262017 5371 dbSNP
rs1015714744 5385 dbSNP
rs953633635 5386 dbSNP
rs1008118538 5387 dbSNP
rs1365128640 5393 dbSNP
rs1226760678 5400 dbSNP
rs979923894 5402 dbSNP
rs1272001294 5406 dbSNP
rs1340225492 5412 dbSNP
rs1209301046 5413 dbSNP
rs1240340724 5417 dbSNP
rs963192908 5418 dbSNP
rs757773228 5422 dbSNP
rs767894704 5423 dbSNP
rs76180130 5424 dbSNP
rs756573378 5431 dbSNP
rs1448800901 5433 dbSNP
rs574912484 5435 dbSNP
rs1374712285 5436 dbSNP
rs1475485000 5440 dbSNP
rs780387517 5447 dbSNP
rs972157966 5448 dbSNP
rs1388168872 5457 dbSNP
rs970247939 5458 dbSNP
rs1327010251 5459 dbSNP
rs981660528 5461 dbSNP
rs1388279983 5463 dbSNP
rs1433338367 5464 dbSNP
rs1318976501 5467 dbSNP
rs1320916711 5474 dbSNP
rs1325772474 5482 dbSNP
rs919383202 5486 dbSNP
rs1296134457 5488 dbSNP
rs1226006700 5489 dbSNP
rs749521660 5492 dbSNP
rs1244200734 5493 dbSNP
rs1406108067 5495 dbSNP
rs1282453828 5498 dbSNP
rs532621161 5501 dbSNP
rs934378357 5502 dbSNP
rs776321068 5510 dbSNP
rs1053266961 5517 dbSNP
rs1170860611 5521 dbSNP
rs1267742563 5525 dbSNP
rs1464323280 5526 dbSNP
rs1203141482 5527 dbSNP
rs914350885 5531 dbSNP
rs1253857423 5539 dbSNP
rs1447468008 5541 dbSNP
rs149300750 5544 dbSNP
rs1414942212 5547 dbSNP
rs748110575 5551 dbSNP
rs1205695092 5554 dbSNP
rs757602006 5556 dbSNP
rs1410752424 5557 dbSNP
rs997395837 5562 dbSNP
rs956701396 5564 dbSNP
rs12808165 5569 dbSNP
rs12785881 5570 dbSNP
rs1051723912 5573 dbSNP
rs948684087 5578 dbSNP
rs11332885 5579 dbSNP
rs1405775775 5579 dbSNP
rs202144692 5579 dbSNP
rs55704652 5579 dbSNP
rs751903466 5579 dbSNP
rs753164221 5579 dbSNP
rs756445728 5579 dbSNP
rs757456442 5579 dbSNP