miRTarBase - #MIRT726367 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TBC1D20   
Synonyms C20orf140, WARBM4
Description TBC1 domain family member 20
Transcript NM_144628   
Expression
Putative miRNA Targets on TBC1D20
3'UTR of TBC1D20
(miRNA target sites are highlighted)
>TBC1D20|NM_144628|3'UTR
   1 AAGCCAGAGAAGACCTTCCTCTTACATCACATTAAGGTCTCACCCTTCCATGGAAGGATTGGGAGGGGTGGAATTTCCTT
  81 TATTAAAAGGGTTTCTGTCCAGAGTTTTTTATTCCTGCCACCCTGCCCTGCCCGTTTGTGTTTGCCTTTACTTCAGAGGC
 161 CAGTAGCAGAGCCTACCTGACACAGAGGGGACCTGGGGGCCTGGCACAGAATCTTATGCCTCTCCCAGTGGGCTTTTGGA
 241 TGGGCTCTCTGCCACCTCCCTGGTGTTGGAGGAAGTGGGTTTCTGAAGCTTGCAGCTGCTTTTGCAACCTGCTGGGCCTG
 321 GGCTGCCCTAGTTACCGGGAACCTCCTAGTCACCCCATAGAAGGTGAACTGGAACATGGGATGCCCTCTTACTGCTCCTG
 401 CTTGCCTGCATCAGATGGACACAGAAGGAGGGGGCTGCTGCTGAAGGAGTCAGGCTTGGGATGGAGAGCAAGAGGCCAAA
 481 GGACTCGTCTGGGAGCATGATCGGCCCCTCTTACTAGCAGCTCCATCAGCTGATCAGAAATCAGAGACAGAAGGGAACTA
 561 GGTTACTCGTTAAATCCTACCTATTTTCAGCCTAGAAATCACATGGGCGTTTCCAGTCAAGTGGGAAGGAAGCTCATTTT
 641 TAGGGCCTAGACCTAGACTAGTTTTGCCTGCCTTTTTTTCCTCCCTGCTTTCTTCTACAAGCCACACAACATTGCTTATA
 721 AAAGGTACTTTTATTACTATTTTTAGAATATATACACCCCATATGTAAATTACCCTCACTTTTAAAGTAATAATAGTTCC
 801 TTCACGGAAAAAAAAATAGTTCTCATCAGAAGGATGAGCTTCTAAGATCCTGAATTTTACTTTCTACTTGATTAACATTT
 881 TCGCTTTAGCCAGAGTTGCTATTTGCAAACAGCTTTCCACTTCCAAAGTGCCACTTTCTGACCGGTTTTTCTTCCTGTTT
 961 TCCTCAAATCATCCTACTCCCAAATAGGCACCCACTCACTACCTTGGCGTCGTTTTTTGGGTCTGACTTGACTCGTCAAC
1041 TGCTGGTCTCTCCCACCTGGTTGGAAATGTCGTTGGAAACTTGCAAAGACTCTCCAGACCTTAGGGAACAAGAGGCATCA
1121 CTCAGTCCTTCTGGGACAGCTTCCCTGTAAGCAAAGCCAGGTTTGTTTTAGATTCACTCTGGCCTGAAAAAAAAAGTGCC
1201 TTTTGCTGCTTTAAAGAATTGGGGTATATGGTATGAAGCAGCCATGTACTTGTATTTTCCTGGTCTTTCCTGGGCACTCT
1281 TCTCTCTTGGCAGATGTTTTCTTAAAGTGAACACACCAGAAGCACTCTACCCCACCATATCCAGTCCTCTTTGCATGCCT
1361 GTTGTGTGCAGGGTGGAGGGTGTCCCACGTGCCAGAGCAGCTGGGAGCCCTGTCCGCTGAGTTACACTAAGCACTTTATT
1441 TTTATTTATTTTATTATTATTTTCTTTTTTCTGAGATGGAGTCTCACTCTGTTGCCCAGGCTGGAGTGCAGTGGTGCAGT
1521 CTCAGCTCACTGCAACCTCCGCCTCCCAAGTTCAGGCAATTCTCGCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGC
1601 ACCTGCTACCACGCCTGACTAATTTTTGTATTTTTAGTAGAGATGGGGTTTCGCCACGTTGGCCAGGCTGGTCTCGAACT
1681 CCTGACCTCAGGTGATCTGCCCGTCTCGTCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCACGCCCAGCCACCAC
1761 TACGCACTTTAAAACCAAAAAAAGCTCAAAGGGATGGATCATTGTCCATGGCTCAGGAGCCCCACTGTGGGGTAAGTGTG
1841 ATGTCGATGGATTAATTTAGACAGTGGTGTATTCATCAGGGCAAAGGAAATTCTTCCAGAGGTGATGATGCGGCAGATAT
1921 TCCCAGTGCTCTCCCAAAGCAAGCTGGCCCTCTTGTCATCCTCTCAGTGGGCGGCACCAGCTGCCCCTCCTTCCACAAGT
2001 ACTCAAGCCTGTTTGTAAATACTGAAGGAATTGATGGGGTTGAGGAAAGGAGGTGCATGTGACCAGGGTCCCAAGGCCAC
2081 AGCTTTTCAGATCCTAGGAAGCAAGTGGCATTTGCTTGAGTTGTGGCCTCGGAAGGAGAATGTTTATCTGTTTTCTAACT
2161 TTGCTGACACCAGGATTCTCCCTGTCATTGAGAAGAAAGCATTATCTAATTACCTTCAGGTGGTTTACTTATTCTGTAAA
2241 GAATATGTGTAAATATTTTGTACAGAGCCCTGTATCAAATAAACAGCCATATGTGGTTACTAATCACCTCTTCTGTCATT
2321 CCGTCCTTGGCCACCGCTCAGTGGGAATGGTCTCTGATCTGGATGCTCCCACCTTCCATGTCAGGCCCAGAACTGTGCCA
2401 TGGTCTGTGGACTCCTGGTCAGCCTTGACTGGCTAGGAGACCTTGGGCAGTACCTACAGTCTTGCTGTTTCTGTTTCATC
2481 TGCAAGAATTATGACCCACACACTCCAGCTGCAGCCCAGGGCACTGTGATATTTTATACGTGTGTAGATGTTTTTGTCCA
2561 CAGTTCCTGGTTCATCACTCCCATAACCCTTTGTTATAATGTTGGGACACTGCAGGCCTCAGAAAACGGAATCTCTGTCT
2641 GTGACCTTCTCCTGCCCCATTTCACTTGCTCAACACCAGACTTTAATCTGACTGTAGCTCATAAGACCCTCATTCCAGAG
2721 AGGGTGCTGCCCCATACCCGGAAGGAGGAACGCTGCACAGAGAGGCCAAGAAGCATCTGGACAGACAGGCCTTGCTGGGT
2801 TTAGACCTTATGCTTTTTGTCCAGTTTCATCTCAACACAGCTGCCATGCTTCAGCCATGCCTATCCAATGACGTCTCCAT
2881 AAAAGGCCCAGGAACACGGGAGCTTCTGAAGAGCTGAACATGTGGAGGGAGGGGAACGAGAACTTGTCCATGTGCCAAGA
2961 GGGTGGCGCACCCCCACTCCATGGGGACAGAAGCTCCAGCATTTGCCCAGGACCCGTCCAGACCTCACCCTGTGTGTATC
3041 TTCATCTGGCTGTTTACTTATTTGTATCCTTTTCTAATAATGTTTGTAATAAACTGGTAAACATAAGTTAAAAAAAAAAA
3121 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUU---GGUAAUACACGACGAu 5'
             |||   || ||   ||||||| 
Target 5' aaaAAAGTGCCTTT---TGCTGCTt 3'
1190 - 1211 148.00 -9.80
2
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' cagaaggagggggcTGCTGCTg 3'
422 - 443 140.00 -11.60
3
miRNA  3' guGUU-UG---GUAAUACACGACGAu 5'
            ||: ||   || | | |||||:| 
Target 5' ggCAGTACCTACAGTCT-TGCTGTTt 3'
2446 - 2470 131.00 -10.34
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1186630 247 ClinVar
COSN8610966 41 COSMIC
COSN31507321 53 COSMIC
COSN31592395 56 COSMIC
COSN30486364 75 COSMIC
COSN20848508 285 COSMIC
COSN21865292 431 COSMIC
COSN31581758 681 COSMIC
COSN24307054 740 COSMIC
COSN31526917 805 COSMIC
COSN26568013 806 COSMIC
COSN27584149 807 COSMIC
COSN31543309 822 COSMIC
COSN30543066 852 COSMIC
COSN30162101 882 COSMIC
COSN31581073 885 COSMIC
COSN21403659 944 COSMIC
COSN31558912 1015 COSMIC
COSN30540756 1032 COSMIC
COSN7093203 1216 COSMIC
COSN31532498 1415 COSMIC
COSN22336198 1568 COSMIC
COSN16598275 1652 COSMIC
COSN31562662 1665 COSMIC
COSN31564296 1685 COSMIC
COSN30159947 1738 COSMIC
COSN8610964 1751 COSMIC
COSN31537437 1753 COSMIC
COSN9129340 1823 COSMIC
COSN31582732 1911 COSMIC
COSN28689456 1947 COSMIC
COSN31483607 1965 COSMIC
COSN23015537 1975 COSMIC
COSN31487437 2033 COSMIC
COSN30543286 2200 COSMIC
COSN22702302 2265 COSMIC
COSN30343141 2291 COSMIC
COSN28006144 2322 COSMIC
COSN4970167 2335 COSMIC
COSN14966759 2525 COSMIC
COSN31559507 3000 COSMIC
COSN31590792 3015 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs148265517 3 dbSNP
rs1443639637 7 dbSNP
rs772928874 9 dbSNP
rs878867723 10 dbSNP
rs991480551 12 dbSNP
rs772445851 14 dbSNP
rs771870364 16 dbSNP
rs1458256363 18 dbSNP
rs748070163 21 dbSNP
rs1250241260 24 dbSNP
rs1203121528 25 dbSNP
rs1309714910 26 dbSNP
rs1201085220 27 dbSNP
rs765811146 27 dbSNP
rs200090125 32 dbSNP
rs1404682967 34 dbSNP
rs1357581054 35 dbSNP
rs958334870 41 dbSNP
rs1317489384 43 dbSNP
rs111371173 44 dbSNP
rs1396794560 45 dbSNP
rs558796959 51 dbSNP
rs538993511 57 dbSNP
rs927693928 61 dbSNP
rs566730520 62 dbSNP
rs759975278 64 dbSNP
rs1471563441 65 dbSNP
rs1163742485 77 dbSNP
rs1243476054 80 dbSNP
rs553366070 86 dbSNP
rs1466673655 87 dbSNP
rs1296412504 95 dbSNP
rs967101273 96 dbSNP
rs1396512500 115 dbSNP
rs1487816231 116 dbSNP
rs1335979757 117 dbSNP
rs1260794644 119 dbSNP
rs576139200 133 dbSNP
rs939662400 134 dbSNP
rs774839571 136 dbSNP
rs772087328 146 dbSNP
rs1318698803 150 dbSNP
rs1289138818 158 dbSNP
rs1220496698 160 dbSNP
rs3746794 163 dbSNP
rs1201528723 164 dbSNP
rs1354345088 167 dbSNP
rs567666344 173 dbSNP
rs1186790586 174 dbSNP
rs1423848601 175 dbSNP
rs1050340369 183 dbSNP
rs931571747 185 dbSNP
rs1167763993 187 dbSNP
rs921393003 203 dbSNP
rs1466548875 204 dbSNP
rs996064213 207 dbSNP
rs1340244843 212 dbSNP
rs1296716285 216 dbSNP
rs191068852 217 dbSNP
rs1341419102 219 dbSNP
rs747679560 221 dbSNP
rs531020849 246 dbSNP
rs6107330 247 dbSNP
rs1020103898 249 dbSNP
rs552009976 251 dbSNP
rs6107329 256 dbSNP
rs34317263 261 dbSNP
rs1346208197 266 dbSNP
rs41306794 268 dbSNP
rs779937515 270 dbSNP
rs1489089392 279 dbSNP
rs1170886540 286 dbSNP
rs1260496971 304 dbSNP
rs1477278265 308 dbSNP
rs1178141794 321 dbSNP
rs916751118 328 dbSNP
rs991040156 336 dbSNP
rs1159073589 337 dbSNP
rs758273697 341 dbSNP
rs925548351 343 dbSNP
rs1287274055 344 dbSNP
rs143193401 348 dbSNP
rs978421221 351 dbSNP
rs1306301777 357 dbSNP
rs1369488702 361 dbSNP
rs149339513 363 dbSNP
rs1449893835 366 dbSNP
rs1275239355 368 dbSNP
rs967070204 369 dbSNP
rs1287270305 370 dbSNP
rs1213230768 376 dbSNP
rs561173018 378 dbSNP
rs1259712094 381 dbSNP
rs544385169 388 dbSNP
rs1488538605 395 dbSNP
rs62189970 398 dbSNP
rs1317491136 410 dbSNP
rs1192377442 414 dbSNP
rs893731805 415 dbSNP
rs1276617472 419 dbSNP
rs1453793765 419 dbSNP
rs1381954339 422 dbSNP
rs1033627890 430 dbSNP
rs750311447 447 dbSNP
rs1002023155 450 dbSNP
rs6076535 453 dbSNP
rs1344782949 455 dbSNP
rs1458586087 468 dbSNP
rs1328048841 471 dbSNP
rs796973034 475 dbSNP
rs1293387571 478 dbSNP
rs1434975051 486 dbSNP
rs373756064 487 dbSNP
rs1046546597 493 dbSNP
rs1331395863 498 dbSNP
rs987645797 502 dbSNP
rs1305877628 503 dbSNP
rs1420999235 507 dbSNP
rs1178156294 509 dbSNP
rs1321993100 514 dbSNP
rs1268561515 521 dbSNP
rs939798712 523 dbSNP
rs954541380 533 dbSNP
rs886741041 535 dbSNP
rs1433482992 546 dbSNP
rs1467592461 548 dbSNP
rs1048051105 553 dbSNP
rs1199203936 555 dbSNP
rs1029230749 558 dbSNP
rs1424237191 562 dbSNP
rs931018596 568 dbSNP
rs1471109812 569 dbSNP
rs921509477 576 dbSNP
rs899086772 583 dbSNP
rs1424681274 589 dbSNP
rs1167350834 594 dbSNP
rs1199349086 596 dbSNP
rs975667297 603 dbSNP
rs138722554 608 dbSNP
rs558743316 609 dbSNP
rs1298034024 613 dbSNP
rs1205813747 618 dbSNP
rs977882910 622 dbSNP
rs1380335953 631 dbSNP
rs1234763149 642 dbSNP
rs1290986467 650 dbSNP
rs1333565962 654 dbSNP
rs1218664126 657 dbSNP
rs967497496 659 dbSNP
rs1313108849 665 dbSNP
rs1300990983 689 dbSNP
rs1203724249 698 dbSNP
rs1237897123 705 dbSNP
rs114084434 706 dbSNP
rs990140661 711 dbSNP
rs1046455107 712 dbSNP
rs1171534197 724 dbSNP
rs1445322464 731 dbSNP
rs753927860 745 dbSNP
rs1338245682 749 dbSNP
rs1360114209 752 dbSNP
rs1416970572 756 dbSNP
rs1310722655 758 dbSNP
rs1354484735 761 dbSNP
rs895261563 766 dbSNP
rs1033575410 769 dbSNP
rs1336862076 771 dbSNP
rs1002137664 772 dbSNP
rs1279153397 774 dbSNP
rs1055282859 778 dbSNP
rs1358272481 790 dbSNP
rs376992557 800 dbSNP
rs754244906 801 dbSNP
rs1485489495 802 dbSNP
rs573328018 805 dbSNP
rs150217971 806 dbSNP
rs886858635 815 dbSNP
rs536250582 817 dbSNP
rs978342578 817 dbSNP
rs553816000 818 dbSNP
rs142474672 822 dbSNP
rs1039909641 824 dbSNP
rs1375219809 857 dbSNP
rs1236468552 866 dbSNP
rs1454403146 873 dbSNP
rs372318594 882 dbSNP
rs1275387631 883 dbSNP
rs6115983 896 dbSNP
rs190938161 899 dbSNP
rs1208442325 905 dbSNP
rs1356306433 911 dbSNP
rs1354081085 917 dbSNP
rs1205948316 919 dbSNP
rs1287283447 922 dbSNP
rs1286560401 927 dbSNP
rs1445377947 933 dbSNP
rs1240097171 939 dbSNP
rs1041893978 941 dbSNP
rs1316512002 942 dbSNP
rs571728387 943 dbSNP
rs946248264 944 dbSNP
rs551987596 945 dbSNP
rs1394868005 954 dbSNP
rs1470676230 955 dbSNP
rs6052008 963 dbSNP
rs1016097702 965 dbSNP
rs1323688767 974 dbSNP
rs1396026380 975 dbSNP
rs1438643729 976 dbSNP
rs1302506136 989 dbSNP
rs1377404506 1001 dbSNP
rs990255097 1003 dbSNP
rs759885324 1007 dbSNP
rs958669837 1008 dbSNP
rs927290783 1009 dbSNP
rs147714826 1012 dbSNP
rs774751797 1014 dbSNP
rs1273957520 1019 dbSNP
rs1157935701 1024 dbSNP
rs3746793 1031 dbSNP
rs1013613125 1034 dbSNP
rs529726264 1035 dbSNP
rs1004041399 1039 dbSNP
rs867772193 1042 dbSNP
rs904040195 1043 dbSNP
rs866093995 1052 dbSNP
rs776165139 1055 dbSNP
rs186489946 1069 dbSNP
rs550870181 1071 dbSNP
rs147094815 1072 dbSNP
rs933034055 1073 dbSNP
rs1264373335 1082 dbSNP
rs1216400706 1092 dbSNP
rs1352113613 1102 dbSNP
rs564920806 1104 dbSNP
rs545234138 1105 dbSNP
rs1267825630 1108 dbSNP
rs921649759 1110 dbSNP
rs1320607470 1111 dbSNP
rs1294060027 1115 dbSNP
rs974464933 1123 dbSNP
rs1231473794 1124 dbSNP
rs1272602020 1126 dbSNP
rs573210930 1134 dbSNP
rs963160665 1137 dbSNP
rs768806058 1139 dbSNP
rs983335254 1141 dbSNP
rs950675323 1144 dbSNP
rs1340845473 1151 dbSNP
rs746608099 1158 dbSNP
rs1297321022 1159 dbSNP
rs1474009248 1167 dbSNP
rs1163639951 1169 dbSNP
rs1042389241 1177 dbSNP
rs1463516916 1180 dbSNP
rs113929943 1188 dbSNP
rs1166032651 1191 dbSNP
rs946215952 1193 dbSNP
rs1013996969 1196 dbSNP
rs1415124499 1196 dbSNP
rs537799332 1208 dbSNP
rs542579379 1224 dbSNP
rs1413131536 1229 dbSNP
rs1054513944 1231 dbSNP
rs1308136621 1241 dbSNP
rs1294056818 1247 dbSNP
rs1230270452 1248 dbSNP
rs1000963658 1249 dbSNP
rs568997751 1266 dbSNP
rs1042560041 1268 dbSNP
rs927238828 1273 dbSNP
rs1484526544 1279 dbSNP
rs1009775935 1292 dbSNP
rs141778418 1309 dbSNP
rs1429702695 1313 dbSNP
rs1367995823 1314 dbSNP
rs891362721 1316 dbSNP
rs1162883336 1328 dbSNP
rs981461942 1330 dbSNP
rs1435230515 1334 dbSNP
rs1478910940 1341 dbSNP
rs552217398 1343 dbSNP
rs917829808 1355 dbSNP
rs532717465 1357 dbSNP
rs983129086 1360 dbSNP
rs1270027930 1364 dbSNP
rs1365157198 1370 dbSNP
rs1235666679 1373 dbSNP
rs1306169315 1378 dbSNP
rs1346102789 1381 dbSNP
rs1210964487 1384 dbSNP
rs771908706 1388 dbSNP
rs181363863 1389 dbSNP
rs745639871 1392 dbSNP
rs1202900925 1396 dbSNP
rs188369081 1400 dbSNP
rs1018481316 1402 dbSNP
rs1454707949 1406 dbSNP
rs1195410234 1410 dbSNP
rs578227044 1415 dbSNP
rs757180602 1416 dbSNP
rs908991839 1419 dbSNP
rs983688449 1420 dbSNP
rs1287259254 1421 dbSNP
rs1387984219 1425 dbSNP
rs776596565 1426 dbSNP
rs1369278030 1454 dbSNP
rs558067395 1460 dbSNP
rs950614349 1464 dbSNP
rs1216508019 1477 dbSNP
rs184378999 1478 dbSNP
rs1332612305 1479 dbSNP
rs893273079 1485 dbSNP
rs566536262 1487 dbSNP
rs1301841898 1489 dbSNP
rs1259689241 1499 dbSNP
rs1386158851 1508 dbSNP
rs1388550214 1510 dbSNP
rs7508969 1512 dbSNP
rs576757189 1517 dbSNP
rs1467312421 1524 dbSNP
rs1467959532 1531 dbSNP
rs181429715 1540 dbSNP
rs1170257467 1541 dbSNP
rs536378871 1548 dbSNP
rs1421170017 1559 dbSNP
rs1046263174 1561 dbSNP
rs950062947 1564 dbSNP
rs1033666937 1565 dbSNP
rs796550202 1569 dbSNP
rs189411648 1570 dbSNP
rs929903709 1572 dbSNP
rs1021071444 1575 dbSNP
rs1010113148 1576 dbSNP
rs919723154 1580 dbSNP
rs1030301931 1581 dbSNP
rs151317850 1586 dbSNP
rs530710974 1591 dbSNP
rs374994411 1593 dbSNP
rs571003499 1595 dbSNP
rs941740933 1596 dbSNP
rs887521495 1598 dbSNP
rs1205123615 1600 dbSNP
rs1234411148 1602 dbSNP
rs1047481853 1606 dbSNP
rs752836148 1607 dbSNP
rs1175737662 1611 dbSNP
rs551247373 1612 dbSNP
rs929091931 1613 dbSNP
rs6052005 1618 dbSNP
rs1415760454 1627 dbSNP
rs559394249 1628 dbSNP
rs1329272898 1636 dbSNP
rs1311449204 1649 dbSNP
rs761492621 1652 dbSNP
rs1020377209 1653 dbSNP
rs542690871 1655 dbSNP
rs1330886084 1657 dbSNP
rs1307785230 1658 dbSNP
rs573832513 1660 dbSNP
rs1416241278 1667 dbSNP
rs979418047 1669 dbSNP
rs893389357 1675 dbSNP
rs543699631 1681 dbSNP
rs755242034 1683 dbSNP
rs1404683141 1690 dbSNP
rs1173494875 1696 dbSNP
rs1021415816 1698 dbSNP
rs1305577239 1700 dbSNP
rs563335870 1702 dbSNP
rs543848368 1703 dbSNP
rs1280737549 1707 dbSNP
rs1045793401 1708 dbSNP
rs751889268 1711 dbSNP
rs1181056935 1721 dbSNP
rs1439731262 1725 dbSNP
rs41301842 1731 dbSNP
rs1235817981 1734 dbSNP
rs763467566 1744 dbSNP
rs1048197524 1746 dbSNP
rs185599165 1747 dbSNP
rs773598755 1748 dbSNP
rs1168422647 1751 dbSNP
rs765840597 1752 dbSNP
rs942511738 1756 dbSNP
rs1310628183 1761 dbSNP
rs562006197 1763 dbSNP
rs1199652986 1764 dbSNP
rs1271404529 1765 dbSNP
rs911057597 1769 dbSNP
rs148600036 1771 dbSNP
rs1303950635 1775 dbSNP
rs367641468 1776 dbSNP
rs1213294904 1783 dbSNP
rs1005809821 1784 dbSNP
rs1441938217 1794 dbSNP
rs1216641231 1795 dbSNP
rs1448265665 1799 dbSNP
rs1188423887 1801 dbSNP
rs1396077463 1806 dbSNP
rs1455826947 1809 dbSNP
rs887447522 1812 dbSNP
rs6115980 1816 dbSNP
rs78447043 1819 dbSNP
rs1354443283 1820 dbSNP
rs373105905 1821 dbSNP
rs1056297224 1822 dbSNP
rs1440166062 1826 dbSNP
rs937860710 1831 dbSNP
rs988466124 1837 dbSNP
rs144920397 1845 dbSNP
rs567414442 1846 dbSNP
rs541822608 1864 dbSNP
rs1335117403 1866 dbSNP
rs1395740768 1869 dbSNP
rs1436694381 1871 dbSNP
rs1374059081 1874 dbSNP
rs979344478 1878 dbSNP
rs1160920444 1880 dbSNP
rs1224529900 1894 dbSNP
rs73894922 1896 dbSNP
rs1286448596 1898 dbSNP
rs1463549547 1898 dbSNP
rs377120693 1904 dbSNP
rs913913922 1911 dbSNP
rs537059952 1912 dbSNP
rs771822534 1914 dbSNP
rs1377416943 1916 dbSNP
rs955468697 1924 dbSNP
rs1030200797 1935 dbSNP
rs1237639168 1950 dbSNP
rs1186411992 1958 dbSNP
rs975546465 1964 dbSNP
rs1024903225 1967 dbSNP
rs1165590468 1972 dbSNP
rs1396660518 1973 dbSNP
rs1438619426 1975 dbSNP
rs571417620 1976 dbSNP
rs964189096 1977 dbSNP
rs1440445275 1978 dbSNP
rs886521970 1984 dbSNP
rs1281452638 1986 dbSNP
rs1217132990 1989 dbSNP
rs1327196931 1990 dbSNP
rs1005777366 1999 dbSNP
rs1273860817 2007 dbSNP
rs531568451 2008 dbSNP
rs1283880764 2017 dbSNP
rs951746683 2019 dbSNP
rs1183574203 2031 dbSNP
rs1025961151 2035 dbSNP
rs994786283 2040 dbSNP
rs899188416 2055 dbSNP
rs762664412 2057 dbSNP
rs1284960498 2059 dbSNP
rs1456344018 2074 dbSNP
rs1038219320 2089 dbSNP
rs866367537 2095 dbSNP
rs1396990349 2098 dbSNP
rs1411403639 2101 dbSNP
rs942626994 2107 dbSNP
rs911016251 2109 dbSNP
rs1051367940 2114 dbSNP
rs1348911848 2115 dbSNP
rs896228900 2118 dbSNP
rs1300399686 2119 dbSNP
rs192463105 2120 dbSNP
rs912959545 2122 dbSNP
rs988582285 2125 dbSNP
rs957003663 2130 dbSNP
rs925623347 2131 dbSNP
rs980316686 2142 dbSNP
rs913834722 2149 dbSNP
rs1406538745 2150 dbSNP
rs1188151091 2157 dbSNP
rs1259013188 2164 dbSNP
rs1421502882 2171 dbSNP
rs1052445853 2173 dbSNP
rs1373627003 2187 dbSNP
rs1413932106 2193 dbSNP
rs1476336162 2196 dbSNP
rs1166559631 2202 dbSNP
rs776971772 2206 dbSNP
rs934021417 2211 dbSNP
rs970719348 2226 dbSNP
rs1313639519 2228 dbSNP
rs774242441 2232 dbSNP
rs1394312626 2241 dbSNP
rs1425380791 2246 dbSNP
rs1014830209 2247 dbSNP
rs1230254430 2249 dbSNP
rs1295878404 2250 dbSNP
rs41309353 2250 dbSNP
rs1211197298 2260 dbSNP
rs1281964858 2267 dbSNP
rs6052000 2274 dbSNP
rs202104808 2276 dbSNP
rs1453351730 2284 dbSNP
rs1448718165 2286 dbSNP
rs1290650014 2287 dbSNP
rs1209356832 2293 dbSNP
rs565525159 2294 dbSNP
rs559597487 2297 dbSNP
rs139236906 2298 dbSNP
rs1379637343 2308 dbSNP
rs1219571790 2310 dbSNP
rs1464704843 2313 dbSNP
rs1302404277 2317 dbSNP
rs1007596118 2322 dbSNP
rs889693167 2323 dbSNP
rs529345622 2329 dbSNP
rs1319084683 2335 dbSNP
rs563448803 2336 dbSNP
rs1235542212 2346 dbSNP
rs775817972 2346 dbSNP
rs933800911 2350 dbSNP
rs1310145904 2359 dbSNP
rs1351025802 2365 dbSNP
rs913088308 2378 dbSNP
rs1232065118 2380 dbSNP
rs748201153 2382 dbSNP
rs1260811753 2383 dbSNP
rs1486520960 2386 dbSNP
rs960652817 2400 dbSNP
rs146220205 2405 dbSNP
rs781288314 2415 dbSNP
rs1195308325 2427 dbSNP
rs1264995054 2436 dbSNP
rs1431719723 2459 dbSNP
rs1175544130 2460 dbSNP
rs1364489354 2461 dbSNP
rs1458841940 2464 dbSNP
rs1034743277 2465 dbSNP
rs1322273919 2478 dbSNP
rs1442275248 2480 dbSNP
rs1001964339 2482 dbSNP
rs755150386 2491 dbSNP
rs925571247 2492 dbSNP
rs533382636 2495 dbSNP
rs1330635242 2496 dbSNP
rs1402009151 2497 dbSNP
rs1266907446 2504 dbSNP
rs1335464774 2505 dbSNP
rs1170952774 2520 dbSNP
rs979763222 2539 dbSNP
rs1263461785 2540 dbSNP
rs111322188 2544 dbSNP
rs1011198399 2547 dbSNP
rs1251573576 2556 dbSNP
rs917478588 2559 dbSNP
rs1180188442 2560 dbSNP
rs1411309299 2561 dbSNP
rs867659601 2564 dbSNP
rs993121456 2566 dbSNP
rs1348537447 2578 dbSNP
rs1478295312 2580 dbSNP
rs1299082135 2583 dbSNP
rs1246119536 2588 dbSNP
rs1407611281 2593 dbSNP
rs1355478467 2597 dbSNP
rs766708289 2597 dbSNP
rs950916568 2598 dbSNP
rs1229988487 2601 dbSNP
rs1287582872 2601 dbSNP
rs1026446086 2616 dbSNP
rs973418429 2617 dbSNP
rs1484190537 2621 dbSNP
rs1052791789 2627 dbSNP
rs963425784 2628 dbSNP
rs1017676047 2633 dbSNP
rs1475555309 2634 dbSNP
rs1184136876 2635 dbSNP
rs1412330255 2638 dbSNP
rs772653567 2643 dbSNP
rs1260168822 2644 dbSNP
rs1372785738 2645 dbSNP
rs1427437935 2651 dbSNP
rs1007958205 2657 dbSNP
rs758686773 2659 dbSNP
rs1375543534 2665 dbSNP
rs1029969873 2671 dbSNP
rs998127625 2684 dbSNP
rs1449642842 2688 dbSNP
rs891600598 2697 dbSNP
rs1271301519 2701 dbSNP
rs1215072252 2709 dbSNP
rs1299557588 2715 dbSNP
rs1221334649 2720 dbSNP
rs1226511331 2721 dbSNP
rs189415271 2728 dbSNP
rs942769543 2734 dbSNP
rs184956329 2739 dbSNP
rs534795265 2740 dbSNP
rs1378511911 2741 dbSNP
rs1483243112 2747 dbSNP
rs1187556662 2749 dbSNP
rs765642395 2751 dbSNP
rs948374799 2752 dbSNP
rs1395346032 2769 dbSNP
rs1415815284 2788 dbSNP
rs916942709 2790 dbSNP
rs1431390665 2791 dbSNP
rs1322420342 2794 dbSNP
rs1362800654 2797 dbSNP
rs993451835 2798 dbSNP
rs951637671 2801 dbSNP
rs1380311051 2811 dbSNP
rs929575113 2817 dbSNP
rs1346063626 2819 dbSNP
rs918805492 2822 dbSNP
rs1311610071 2828 dbSNP
rs1177958078 2829 dbSNP
rs11553433 2830 dbSNP
rs1250494834 2831 dbSNP
rs1424301186 2833 dbSNP
rs1191675556 2836 dbSNP
rs973532819 2837 dbSNP
rs542444432 2839 dbSNP
rs558780727 2841 dbSNP
rs1240130969 2845 dbSNP
rs1170370656 2846 dbSNP
rs1179395709 2848 dbSNP
rs1017623652 2852 dbSNP
rs1231461246 2858 dbSNP
rs986250389 2864 dbSNP
rs573737566 2872 dbSNP
rs969126315 2873 dbSNP
rs954844055 2874 dbSNP
rs767161986 2886 dbSNP
rs11553432 2895 dbSNP
rs1273260912 2896 dbSNP
rs998471692 2897 dbSNP
rs891715982 2898 dbSNP
rs1356527606 2903 dbSNP
rs1327770617 2908 dbSNP
rs1309314505 2911 dbSNP
rs1453640840 2914 dbSNP
rs1445480508 2920 dbSNP
rs1031628556 2921 dbSNP
rs1370704738 2927 dbSNP
rs1245823719 2929 dbSNP
rs1000018898 2937 dbSNP
rs904382810 2943 dbSNP
rs1044516911 2946 dbSNP
rs1409114749 2950 dbSNP
rs536615008 2952 dbSNP
rs1030896257 2958 dbSNP
rs571201464 2963 dbSNP
rs948512913 2967 dbSNP
rs895429816 2968 dbSNP
rs557503245 2969 dbSNP
rs1392658022 2970 dbSNP
rs929006851 2971 dbSNP
rs1322614261 2972 dbSNP
rs1349582929 2976 dbSNP
rs534597249 2977 dbSNP
rs973649007 2979 dbSNP
rs901126869 2981 dbSNP
rs1039676241 2985 dbSNP
rs1285246446 2988 dbSNP
rs565686571 2989 dbSNP
rs1208475678 2996 dbSNP
rs1289614263 2998 dbSNP
rs1483213931 2999 dbSNP
rs1159323959 3000 dbSNP
rs1418639939 3005 dbSNP
rs910734499 3007 dbSNP
rs1188192814 3013 dbSNP
rs1183847016 3015 dbSNP
rs548724333 3016 dbSNP
rs1162492639 3018 dbSNP
rs1257228282 3020 dbSNP
rs1370875240 3023 dbSNP
rs1430647880 3024 dbSNP
rs1310041650 3028 dbSNP
rs6115976 3030 dbSNP
rs1209228895 3034 dbSNP
rs1409345071 3053 dbSNP
rs774147746 3055 dbSNP
rs374351049 3060 dbSNP
rs1237634496 3061 dbSNP
rs1283988362 3063 dbSNP
rs867299816 3066 dbSNP
rs1230199201 3069 dbSNP
rs878966773 3073 dbSNP
rs570022003 3079 dbSNP
rs938912575 3080 dbSNP
rs6695 3081 dbSNP
rs533297803 3082 dbSNP
rs1257642569 3097 dbSNP
rs1031576158 3103 dbSNP
rs1186665294 3104 dbSNP
rs375424312 3106 dbSNP
rs564494163 3106 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE14794 Lymphoblastoid cells -0.3 2.0e-3 -0.286 3.1e-3 90 Click to see details
GSE17306 Multiple myeloma -0.317 1.3e-2 -0.305 1.7e-2 49 Click to see details
GSE27834 Pluripotent stem cells 0.529 1.8e-2 0.450 4.0e-2 16 Click to see details
GSE42095 Differentiated embryonic stem cells 0.409 2.6e-2 0.422 2.2e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.332 5.6e-2 -0.198 1.8e-1 24 Click to see details
GSE21032 Prostate cancer -0.126 1.3e-1 -0.026 4.1e-1 83 Click to see details
GSE28544 Breast cancer -0.204 1.7e-1 -0.591 1.2e-3 24 Click to see details
GSE28260 Renal cortex and medulla -0.28 1.8e-1 -0.269 1.9e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.169 2.1e-1 0.053 4.0e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.098 2.2e-1 -0.133 1.5e-1 64 Click to see details
GSE19783 ER+ ER+ breast cancer -0.123 3.0e-1 -0.135 2.9e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.073 3.6e-1 0.067 3.8e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.054 3.8e-1 0.119 2.6e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.066 3.9e-1 0.030 4.5e-1 20 Click to see details
GSE38226 Liver fibrosis 0.044 4.2e-1 0.055 4.1e-1 21 Click to see details
GSE19783 ER- ER- breast cancer 0.02 4.3e-1 0.034 3.8e-1 79 Click to see details
GSE19536 Breast cancer 0.014 4.5e-1 0.005 4.8e-1 100 Click to see details
GSE21849 B cell lymphoma 0.025 4.5e-1 0.111 2.8e-1 29 Click to see details
GSE19350 CNS germ cell tumors -0.027 4.7e-1 -0.063 4.2e-1 12 Click to see details
GSE19350 CNS germ cell tumors -0.027 4.7e-1 -0.063 4.2e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.507 0 -0.530 0 42 Click to see details
STAD -0.436 0.01 -0.460 0 32 Click to see details
ESCA 0.447 0.08 0.491 0.06 11 Click to see details
UCEC -0.28 0.12 -0.254 0.15 19 Click to see details
KIRP 0.21 0.12 0.165 0.18 32 Click to see details
LUSC -0.143 0.2 -0.084 0.31 38 Click to see details
COAD 0.349 0.2 0.429 0.14 8 Click to see details
THCA -0.109 0.21 -0.092 0.24 59 Click to see details
PRAD -0.112 0.22 -0.114 0.22 50 Click to see details
LIHC 0.103 0.24 -0.056 0.35 49 Click to see details
KICH 0.138 0.26 0.038 0.43 25 Click to see details
PCPG -0.662 0.27 -0.500 0.33 3 Click to see details
PAAD -0.456 0.27 -0.200 0.4 4 Click to see details
CHOL 0.109 0.39 -0.033 0.47 9 Click to see details
KIRC 0.034 0.39 -0.001 0.5 68 Click to see details
BLCA -0.066 0.4 -0.189 0.23 18 Click to see details
CESC 0.239 0.42 0.500 0.33 3 Click to see details
LUAD -0.054 0.43 0.105 0.37 12 Click to see details
BRCA -0.011 0.46 0.050 0.33 84 Click to see details
BRCA -0.011 0.46 0.050 0.33 84 Click to see details
BRCA -0.011 0.46 0.050 0.33 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*