miRTarBase - #MIRT726482 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SMURF1   
Synonyms -
Description SMAD specific E3 ubiquitin protein ligase 1
Transcript NM_020429   
Other Transcripts NM_181349   
Expression
Putative miRNA Targets on SMURF1
3'UTR of SMURF1
(miRNA target sites are highlighted)
>SMURF1|NM_020429|3'UTR
   1 AAAGCAACCAAAGGCAACAGAGTCTAGCTCATGGCCACCAGACCAAAAGCATCCAGCTTCTGTGCACCTCCTGCAAAGCT
  81 GGCAGAGGCCCTGGAATTCCAGATCACCTGAGGGGAAAGGGTTGTCTCTCTCCTTTCTGTTGGGGGAGGGGGATGGGGGA
 161 CTTTTGTTGGTGGCTCCCACCCATATATCCCTCCTTTACCATAGTACTCCCACCCACTTCCATCACCCATCCAATAAAAT
 241 GCAGCCAGGTTTAGCCTTTGGCTTTGGTCACACAGGATATTCTGCTGTGTTGCAACCCATGTGGTGATAAGGCTCACAGC
 321 CCTGAGCTCTTTACGGGAGCATCAACTCACAGTTAGGGGACTGGGCGTGGCTGATTGAGGGTTTGGAACTGGTGGCTATG
 401 CCAGCTATTCCATCTCAAAACAGCCTTGAGGCCCCTTTTCAATTTGAGCAGCTGCTAGATATCTTATCAGAGCTCAGATT
 481 CCAGATTTCACATCCCAGCAGCCGGTTCTGGGTAGCAGATCAATTTCCAACTGGAAAATAACTATATAATGTATGCTTAT
 561 TGGAATTCTGCCACAGCAGGAAGCTTGAGTCAAAATGTGTTTCCCCTTTGAAAGGAGAAGGAATTGGAGCAGCTTTTCCT
 641 GGAGGCCCAGGATATTTCTTTTCTGGGTATCTTGGCTGAAAATTTTGTTTTACATAGAGAAAAACGATCTTTTAAGGGTC
 721 CCTTTTGCTGCATTATCTGTCCAGTTTGACTTTTTTTTCAGTGAAAACACCATGTCATGGAGTGTAGGAAAGAGCAGACC
 801 AAAATCAGCCCTAGAGCCAACCAGTCAGTCCCAAAGCTGTGACCTCTGTGCCACTGTTGTCCATAGAAGAGCATCGACTG
 881 TGTCACTTAAAATATTAGTAAACCATGATGCAGCAACTGCTAAGAGCTAAACTAACAAAATTGTGTCATCATAGCTGCTG
 961 GCTTGGTGTGAACTCGCTTAAAAGCAATGGTGAAAGGATAACCTCGATGATGTAAATCCACCCAAAGATACTGTTCTACA
1041 AAAAGTAGGGTGTGGACGCAAACCTGTGACAGCAGAGGGGGACGACTTCACACTCACTGCCTCATGTGGCCCCTTTCCCA
1121 GTGGCAGCTGGTGACACTAACGATTGCTACTCGGTTCACTTGCCCAGATGTCTTCATATGATGAGCAAGGCCAGAAGCAA
1201 GGCTAGATTCGAAGTTTCTGACACCATTTCCAGTTTGCACAAAAGTCAGTATTTTATCTTAAAGTGGCTTGATTTCCAAT
1281 AGCTGAACTTGGGCAGAAAACAGCAGGCCAATGTTCCTATGTGGTTTCTTTGTTGTTGTTTTTGTTTGGGGTGGGGGCAA
1361 GTACAGGGTAATTCATGAGCAAGACATTTCACTGCTGTCGAAGTCTCTGGGATCCCGCTGTGGGTCTGAGATGGCCTGGG
1441 AAGGACCTTGTGGACAATGGTTTTATCTGTTCTTTTTGTCACTGTTAATTTCTGGGCTGCTGAGGTTCTAGAATAGAAGG
1521 GCTGCCAAATGAGGTTTGCTGCAGGAGGAAAGTTTAATCCCCCATTCCAAAAGTCCAGGCCAAATGGTGGGCTTAGCCTC
1601 TTTGAAAAGTTCTGCCTTGCCCCCACAGGTGGGCACATCCTGTGTCTCATTCACCATGATGCTTCCTGAGGGTGTTCTAG
1681 AAGCCCGTTCCCCAGTGGCTGTATCCAGCCTTTCCTTGCATCATCTTCCTCTTGAAGGTGAGGAAGTGAAAACTACAGAC
1761 CTCCCCCGGACAGCCCACTCTCTATCACGAGCCTAACCCGCGGGAGGCGGAAGAGACATCCATTCGAGAACTGAAGCGGC
1841 CTCCGGGATGAGGTCAGAGGCCCCACCTGATTTTCCTGGTGGTGGTATCCAAAATCTTCAGTAACTAGGAAGGAAACCAG
1921 GGTCTCATGGTTTAAAAGACTTTGAAGCAGGAATGTTGCATTTGACGCCTTTAAAACTACCTTTTTGCTGTTGGGAGGAG
2001 TCGGGGGCGAGCCTTAGCAGCTGCACCGCCATCCCCATGCTGGTTGGTGCTGCCCTGCCTCTCGTGCCGGGTGTTGCTTC
2081 AGCCCAGAGCCAGAGGGCTGGGTCCCGGGTCCTCCACAGGTGACCCCGGTGGACACACGCGTTCCCATCCTGGCCTCCGT
2161 CTCTGCTTTTCCACTTCTACCTGCGTGTGGGTTTGCCGCCTTGTCATCGGTTGTGTGAGTGTCGCAGACCTTTCCAGAGC
2241 TCCGGTTCACTCTTTCCAAACAGGCCTCCCTGTCGGTGGCACTGCACTCCTAGAACCTTCAGTTTCTACGATGGTTTGTT
2321 TGGTCCTTTTGAACCACCCCAAAGAACTCAACATGGCAAAGCAAATGGTAAAAGCTTCCCGACTGTTCTACTTTGGGTCC
2401 GCGCGAAGCCCACTCACGTGTGATCTGTGTTGCCCCTCTCGGTGGTCCCAGGCGATCCAGCCATGCCCCCTGCCCCTCTG
2481 CCCAGATGCTTCAGGGGCCCGGCTTTTCAGGCTTGCCCTCACCAGCGGCCGTCAGCCGACACTCAGGGATGTAGCTAACA
2561 CCACTCCGCCAGTGCTTTCAGTAGGAAGAGCTGAGGCTGCCTGGGAGGCCCGGGGCGACCGGAAAAGGGCTCTCTCAAGT
2641 TCTGAAAAGAGAATCTGCCACCAGATCGAATTTCGACCCCTGAGCTTGTTCGGACGTATGGTCCAAATTCAGATTAAGGT
2721 GGTCACCCAACCCGAGATGTCAGGAAAGGCCTTCTGCAGAGAAAATGTCCCCCCACCCGCCATCTGCAGCCAGGTGTGTG
2801 CCACACGGCAGCCTTCCCGAAACATAGTATGGATTTTAAAAATGTGTTTATTTTTGTTTCTCAACCACTTTATAACGTAT
2881 TTTTTAATTTATTTTGTAATGTCTTGTTTTGAAGTATTGCTGCTATCCTTGTTATCCTTCCCACTGTTTTTATCACTGAT
2961 TTATTTTGTGAAAGTTGTACACTAATGTTCTATGTCAAAATCAAAAGTATTTAATGAAATACTAGTTCTATTTAATGTGG
3041 TTATGGAACCAGCTGGAAACACAAAACAAACAGTGATTGTACAGCAGGCTGGGCCCAGGAGGTCAGGTTCATTTTGTTAC
3121 ATATGCAATAAACTCACGACTTTACATTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  | ||| ||||||| 
Target 5' tgttttgaAGTAT-TGCTGCTa 3'
2905 - 2925 149.00 -10.70
2
miRNA  3' gugUUUGGU--AAUACACGACGAu 5'
             ||||:|  || | |||||:| 
Target 5' ttaAAACTACCTT-TTTGCTGTTg 3'
1971 - 1993 144.00 -10.50
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            || :|:: |  |||||||  
Target 5' ccCATGCTGGTTGGTGCTGCcc 3'
2034 - 2055 136.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31563943 41 COSMIC
COSN30454518 54 COSMIC
COSN30138443 144 COSMIC
COSN30115555 207 COSMIC
COSN31534147 256 COSMIC
COSN31565036 278 COSMIC
COSN20104491 288 COSMIC
COSN31583128 319 COSMIC
COSN23460880 844 COSMIC
COSN5105743 933 COSMIC
COSN31519606 1380 COSMIC
COSN31516502 1400 COSMIC
COSN14919051 1608 COSMIC
COSN22995211 1731 COSMIC
COSN29983769 1755 COSMIC
COSN5668079 1877 COSMIC
COSN5668078 1878 COSMIC
COSN5105742 2193 COSMIC
COSN31585899 2405 COSMIC
COSN31481075 2420 COSMIC
COSN31538416 2422 COSMIC
COSN31488278 2492 COSMIC
COSN18723886 2611 COSMIC
COSN31513132 2681 COSMIC
COSN31553307 2811 COSMIC
COSN30164831 2862 COSMIC
COSN15658034 3143 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1172443774 3 dbSNP
rs1450073398 14 dbSNP
rs756538143 18 dbSNP
rs377416493 19 dbSNP
rs1299706335 20 dbSNP
rs1368199278 20 dbSNP
rs1455718425 21 dbSNP
rs1232967558 23 dbSNP
rs753105176 23 dbSNP
rs765582822 24 dbSNP
rs970419667 28 dbSNP
rs781445337 30 dbSNP
rs1000302667 31 dbSNP
rs755023278 33 dbSNP
rs751672272 37 dbSNP
rs765169623 38 dbSNP
rs1191102476 40 dbSNP
rs757152289 41 dbSNP
rs373051217 43 dbSNP
rs201398310 45 dbSNP
rs760603834 49 dbSNP
rs775260140 50 dbSNP
rs1012836859 52 dbSNP
rs893458260 53 dbSNP
rs895735017 65 dbSNP
rs1158199115 71 dbSNP
rs1057333324 78 dbSNP
rs1000414818 81 dbSNP
rs1301485942 95 dbSNP
rs1322252206 95 dbSNP
rs10282646 99 dbSNP
rs756070193 102 dbSNP
rs1440002639 110 dbSNP
rs1041879847 111 dbSNP
rs562764928 118 dbSNP
rs922791303 122 dbSNP
rs1039799580 124 dbSNP
rs1350231600 124 dbSNP
rs1211000079 125 dbSNP
rs1166710266 127 dbSNP
rs886966686 128 dbSNP
rs111728351 132 dbSNP
rs192194300 133 dbSNP
rs767024521 148 dbSNP
rs1210957340 154 dbSNP
rs866613128 157 dbSNP
rs1436133694 158 dbSNP
rs374995118 160 dbSNP
rs984529443 166 dbSNP
rs1473667162 176 dbSNP
rs1161119134 177 dbSNP
rs1415305974 183 dbSNP
rs951294592 187 dbSNP
rs1294024406 194 dbSNP
rs975053339 198 dbSNP
rs1389139838 201 dbSNP
rs1327551371 202 dbSNP
rs1350746112 215 dbSNP
rs1182812630 222 dbSNP
rs918513982 229 dbSNP
rs1291897986 255 dbSNP
rs1246233679 267 dbSNP
rs1267726672 275 dbSNP
rs1473261956 277 dbSNP
rs1337972927 282 dbSNP
rs1266178224 284 dbSNP
rs981886439 287 dbSNP
rs397969903 289 dbSNP
rs34506005 290 dbSNP
rs547564472 295 dbSNP
rs1255207521 300 dbSNP
rs1224317562 307 dbSNP
rs1165442318 315 dbSNP
rs538571910 326 dbSNP
rs1460353843 329 dbSNP
rs189096289 334 dbSNP
rs956211881 335 dbSNP
rs1352365422 337 dbSNP
rs1281512175 338 dbSNP
rs1397007686 339 dbSNP
rs1315217051 340 dbSNP
rs1031870361 345 dbSNP
rs761284243 350 dbSNP
rs1275524236 351 dbSNP
rs1344390189 354 dbSNP
rs1209052562 357 dbSNP
rs754007142 357 dbSNP
rs1198648244 359 dbSNP
rs576971657 365 dbSNP
rs903412329 366 dbSNP
rs774044159 367 dbSNP
rs1187843055 369 dbSNP
rs998469573 372 dbSNP
rs901335178 375 dbSNP
rs1450078773 379 dbSNP
rs549379153 379 dbSNP
rs1358244138 381 dbSNP
rs942759353 383 dbSNP
rs531164536 386 dbSNP
rs909962837 392 dbSNP
rs1426548110 399 dbSNP
rs1174824626 405 dbSNP
rs1433396520 411 dbSNP
rs1360309190 418 dbSNP
rs574439325 421 dbSNP
rs62472038 424 dbSNP
rs895699538 430 dbSNP
rs1232219841 432 dbSNP
rs1302699506 435 dbSNP
rs1313005347 438 dbSNP
rs1212511306 441 dbSNP
rs527379256 446 dbSNP
rs559725381 451 dbSNP
rs140871036 455 dbSNP
rs770723666 465 dbSNP
rs376105275 469 dbSNP
rs796450970 469 dbSNP
rs1035594789 475 dbSNP
rs1248602294 481 dbSNP
rs918610435 488 dbSNP
rs1191222575 491 dbSNP
rs981981195 492 dbSNP
rs1433476154 496 dbSNP
rs970652036 497 dbSNP
rs539973732 503 dbSNP
rs1004566582 504 dbSNP
rs1321588777 521 dbSNP
rs886934738 525 dbSNP
rs1048257867 534 dbSNP
rs1274410803 540 dbSNP
rs1368383359 544 dbSNP
rs957783879 545 dbSNP
rs1305098174 550 dbSNP
rs183078715 551 dbSNP
rs1227581183 568 dbSNP
rs1232545862 569 dbSNP
rs565552073 580 dbSNP
rs899601030 587 dbSNP
rs966355974 588 dbSNP
rs1303620467 596 dbSNP
rs1030038441 599 dbSNP
rs543841219 605 dbSNP
rs1192604571 612 dbSNP
rs1405377174 615 dbSNP
rs901429714 629 dbSNP
rs943734520 649 dbSNP
rs912236506 650 dbSNP
rs1364165537 655 dbSNP
rs576463655 658 dbSNP
rs1414651396 667 dbSNP
rs1007482196 674 dbSNP
rs1323457163 676 dbSNP
rs888512889 683 dbSNP
rs1438741403 686 dbSNP
rs1048938965 691 dbSNP
rs1350117235 694 dbSNP
rs1410597461 695 dbSNP
rs1403891008 697 dbSNP
rs1330927275 698 dbSNP
rs1231430463 702 dbSNP
rs930104241 705 dbSNP
rs554939708 709 dbSNP
rs78501487 711 dbSNP
rs111233664 722 dbSNP
rs1448555333 729 dbSNP
rs968755624 742 dbSNP
rs219810 744 dbSNP
rs538410427 747 dbSNP
rs34666591 759 dbSNP
rs554302124 759 dbSNP
rs925172570 760 dbSNP
rs960056133 773 dbSNP
rs190655030 784 dbSNP
rs773369335 787 dbSNP
rs777832981 792 dbSNP
rs975753220 796 dbSNP
rs1483588771 797 dbSNP
rs965589960 799 dbSNP
rs1283327527 800 dbSNP
rs1036135121 801 dbSNP
rs1226417248 802 dbSNP
rs1229891988 808 dbSNP
rs1271936300 814 dbSNP
rs1341800731 819 dbSNP
rs1298043083 822 dbSNP
rs1007164489 823 dbSNP
rs888599219 824 dbSNP
rs185803688 833 dbSNP
rs1484458020 836 dbSNP
rs1187301416 844 dbSNP
rs1238345621 846 dbSNP
rs1230271268 847 dbSNP
rs1185273914 852 dbSNP
rs772032001 855 dbSNP
rs1430451916 860 dbSNP
rs772179761 864 dbSNP
rs1170521714 869 dbSNP
rs1333384242 871 dbSNP
rs1004131386 875 dbSNP
rs182630195 876 dbSNP
rs567199372 880 dbSNP
rs1046354230 900 dbSNP
rs1026743808 931 dbSNP
rs1364326040 936 dbSNP
rs1228533189 938 dbSNP
rs1295988032 941 dbSNP
rs548944728 943 dbSNP
rs899569977 947 dbSNP
rs895171547 948 dbSNP
rs146527669 950 dbSNP
rs145442980 960 dbSNP
rs936637534 961 dbSNP
rs1008420480 966 dbSNP
rs1450581573 967 dbSNP
rs925107820 967 dbSNP
rs1190606486 968 dbSNP
rs1367106630 971 dbSNP
rs1187428810 975 dbSNP
rs568468826 976 dbSNP
rs977955469 987 dbSNP
rs548034466 990 dbSNP
rs1203179941 999 dbSNP
rs557242238 1003 dbSNP
rs140366265 1005 dbSNP
rs975720828 1006 dbSNP
rs1232138298 1016 dbSNP
rs1275042952 1024 dbSNP
rs1275538535 1029 dbSNP
rs1346634188 1031 dbSNP
rs1226967240 1033 dbSNP
rs1267829902 1037 dbSNP
rs755208542 1046 dbSNP
rs1265425206 1051 dbSNP
rs565585223 1057 dbSNP
rs544167739 1058 dbSNP
rs1043217558 1061 dbSNP
rs1379614122 1066 dbSNP
rs1283433077 1077 dbSNP
rs1156691154 1080 dbSNP
rs532029097 1083 dbSNP
rs1457760087 1084 dbSNP
rs561153132 1086 dbSNP
rs986108511 1089 dbSNP
rs542989554 1090 dbSNP
rs916111772 1093 dbSNP
rs1285898865 1096 dbSNP
rs1408615359 1097 dbSNP
rs1407538746 1102 dbSNP
rs1027526792 1104 dbSNP
rs991581989 1105 dbSNP
rs1330222431 1122 dbSNP
rs1230817639 1127 dbSNP
rs1264237918 1131 dbSNP
rs1356208574 1133 dbSNP
rs1210529713 1137 dbSNP
rs994309443 1141 dbSNP
rs961419260 1142 dbSNP
rs1024997229 1152 dbSNP
rs572461205 1153 dbSNP
rs755984424 1164 dbSNP
rs895132832 1168 dbSNP
rs1366667866 1174 dbSNP
rs1457293186 1182 dbSNP
rs1163332072 1186 dbSNP
rs1392249897 1192 dbSNP
rs1055174091 1194 dbSNP
rs879316226 1200 dbSNP
rs1370645983 1204 dbSNP
rs928616440 1206 dbSNP
rs983198822 1210 dbSNP
rs951272832 1211 dbSNP
rs1323740277 1236 dbSNP
rs1472282870 1238 dbSNP
rs750343808 1240 dbSNP
rs1267367347 1241 dbSNP
rs995405666 1242 dbSNP
rs191508545 1243 dbSNP
rs1204757203 1248 dbSNP
rs1275659016 1264 dbSNP
rs997164507 1271 dbSNP
rs1484130477 1280 dbSNP
rs1184589706 1283 dbSNP
rs1450130305 1291 dbSNP
rs1253736031 1292 dbSNP
rs963831463 1301 dbSNP
rs1423237423 1304 dbSNP
rs781054455 1306 dbSNP
rs1188144554 1307 dbSNP
rs368606995 1307 dbSNP
rs756756666 1318 dbSNP
rs1167367203 1322 dbSNP
rs112893674 1328 dbSNP
rs1463142892 1332 dbSNP
rs1301525760 1335 dbSNP
rs544814976 1338 dbSNP
rs1397175719 1339 dbSNP
rs1315402417 1341 dbSNP
rs1052072546 1345 dbSNP
rs58848249 1348 dbSNP
rs1298346332 1349 dbSNP
rs1344584447 1349 dbSNP
rs1208276089 1352 dbSNP
rs1254085281 1353 dbSNP
rs1482792182 1358 dbSNP
rs1201004256 1363 dbSNP
rs1244919595 1364 dbSNP
rs910207323 1371 dbSNP
rs577457602 1372 dbSNP
rs984474674 1376 dbSNP
rs1390249887 1377 dbSNP
rs1429996594 1379 dbSNP
rs999203697 1380 dbSNP
rs920208085 1382 dbSNP
rs555940291 1383 dbSNP
rs903410864 1390 dbSNP
rs146680801 1391 dbSNP
rs961512379 1399 dbSNP
rs947653169 1400 dbSNP
rs867518323 1407 dbSNP
rs1217739547 1408 dbSNP
rs567536567 1410 dbSNP
rs1397182866 1414 dbSNP
rs1264702575 1415 dbSNP
rs567004959 1416 dbSNP
rs1013623621 1417 dbSNP
rs959489485 1421 dbSNP
rs186204230 1427 dbSNP
rs1188911447 1430 dbSNP
rs1266257232 1431 dbSNP
rs533754474 1435 dbSNP
rs1433349524 1437 dbSNP
rs1464782550 1438 dbSNP
rs928727701 1441 dbSNP
rs1000888200 1442 dbSNP
rs982781278 1444 dbSNP
rs566448150 1448 dbSNP
rs1160523503 1450 dbSNP
rs551455061 1451 dbSNP
rs538912846 1460 dbSNP
rs1199886861 1469 dbSNP
rs1292957467 1469 dbSNP
rs763752115 1472 dbSNP
rs1406990283 1473 dbSNP
rs1285022646 1474 dbSNP
rs919954063 1475 dbSNP
rs202219752 1476 dbSNP
rs1227754946 1478 dbSNP
rs1268731211 1481 dbSNP
rs1172257712 1487 dbSNP
rs973950291 1492 dbSNP
rs1218755636 1493 dbSNP
rs963967573 1502 dbSNP
rs1018066982 1504 dbSNP
rs1488639667 1515 dbSNP
rs1329847008 1516 dbSNP
rs1250125950 1521 dbSNP
rs1472450495 1524 dbSNP
rs987045394 1531 dbSNP
rs1410820500 1534 dbSNP
rs539529227 1540 dbSNP
rs180927315 1551 dbSNP
rs35202486 1552 dbSNP
rs1350528591 1557 dbSNP
rs1009514120 1558 dbSNP
rs571771164 1559 dbSNP
rs1040270598 1560 dbSNP
rs1279857674 1562 dbSNP
rs1375444897 1563 dbSNP
rs1226526614 1564 dbSNP
rs1288593373 1567 dbSNP
rs766865453 1569 dbSNP
rs1275035172 1576 dbSNP
rs999305297 1580 dbSNP
rs943072215 1585 dbSNP
rs780502126 1589 dbSNP
rs1234958622 1595 dbSNP
rs903513376 1599 dbSNP
rs1022011131 1602 dbSNP
rs1472129963 1604 dbSNP
rs1181769400 1609 dbSNP
rs1414680716 1614 dbSNP
rs756616533 1619 dbSNP
rs910309573 1620 dbSNP
rs1049182624 1622 dbSNP
rs1011797422 1623 dbSNP
rs1370201031 1625 dbSNP
rs894728935 1625 dbSNP
rs761180495 1629 dbSNP
rs1435009848 1630 dbSNP
rs550375069 1634 dbSNP
rs930308749 1636 dbSNP
rs1412770384 1642 dbSNP
rs531943324 1646 dbSNP
rs1383385972 1670 dbSNP
rs1007008 1671 dbSNP
rs1173350130 1686 dbSNP
rs1047120608 1687 dbSNP
rs188976942 1690 dbSNP
rs930093443 1692 dbSNP
rs527635558 1701 dbSNP
rs1275612093 1707 dbSNP
rs1441022176 1716 dbSNP
rs972951519 1721 dbSNP
rs1238582971 1733 dbSNP
rs219811 1739 dbSNP
rs974045113 1743 dbSNP
rs942597762 1754 dbSNP
rs911141276 1756 dbSNP
rs986626847 1758 dbSNP
rs1172349367 1767 dbSNP
rs545146542 1768 dbSNP
rs1030868686 1772 dbSNP
rs1421438587 1776 dbSNP
rs959694340 1777 dbSNP
rs977834336 1778 dbSNP
rs867369937 1780 dbSNP
rs1278775022 1784 dbSNP
rs1454509120 1784 dbSNP
rs1021934996 1788 dbSNP
rs1011934634 1789 dbSNP
rs968061266 1793 dbSNP
rs1020998650 1799 dbSNP
rs761933936 1800 dbSNP
rs142117535 1801 dbSNP
rs1034999015 1802 dbSNP
rs901763630 1803 dbSNP
rs562380380 1808 dbSNP
rs1007405182 1813 dbSNP
rs1447619555 1819 dbSNP
rs1195365515 1821 dbSNP
rs1245223412 1825 dbSNP
rs544361942 1826 dbSNP
rs1272397464 1831 dbSNP
rs774320304 1837 dbSNP
rs1446520026 1838 dbSNP
rs1003158250 1844 dbSNP
rs907354033 1845 dbSNP
rs1048791928 1848 dbSNP
rs1335006509 1852 dbSNP
rs1047256410 1853 dbSNP
rs73145620 1860 dbSNP
rs897494083 1876 dbSNP
rs549449465 1877 dbSNP
rs187659828 1891 dbSNP
rs1038303530 1901 dbSNP
rs940244916 1907 dbSNP
rs1435299877 1911 dbSNP
rs554597126 1917 dbSNP
rs752212085 1919 dbSNP
rs992715234 1920 dbSNP
rs911249398 1921 dbSNP
rs780309342 1928 dbSNP
rs1351965457 1929 dbSNP
rs181903921 1933 dbSNP
rs933963653 1934 dbSNP
rs1287733369 1935 dbSNP
rs1180022613 1938 dbSNP
rs114758990 1942 dbSNP
rs1269383792 1955 dbSNP
rs1481313754 1958 dbSNP
rs1237548574 1963 dbSNP
rs536396935 1966 dbSNP
rs1411171288 1967 dbSNP
rs1454191172 1969 dbSNP
rs1159865649 1973 dbSNP
rs1481796435 1974 dbSNP
rs968161700 1981 dbSNP
rs1404447199 1987 dbSNP
rs1303344092 1990 dbSNP
rs557783335 1993 dbSNP
rs1205471128 1995 dbSNP
rs373725504 2002 dbSNP
rs1241798861 2003 dbSNP
rs965922272 2008 dbSNP
rs1355693202 2009 dbSNP
rs1223266292 2013 dbSNP
rs1294253230 2015 dbSNP
rs1227098757 2017 dbSNP
rs967763239 2018 dbSNP
rs1007918853 2024 dbSNP
rs915013626 2027 dbSNP
rs1419658315 2028 dbSNP
rs764751741 2031 dbSNP
rs759128932 2032 dbSNP
rs959286808 2044 dbSNP
rs1163613884 2046 dbSNP
rs1307598897 2055 dbSNP
rs539568106 2059 dbSNP
rs1397633266 2063 dbSNP
rs1003531867 2064 dbSNP
rs568957181 2066 dbSNP
rs563635993 2068 dbSNP
rs1035960343 2069 dbSNP
rs949742836 2070 dbSNP
rs1025732671 2071 dbSNP
rs1250594727 2074 dbSNP
rs1162510897 2082 dbSNP
rs1056703702 2088 dbSNP
rs938296253 2089 dbSNP
rs1460770746 2090 dbSNP
rs1183674479 2092 dbSNP
rs926806926 2094 dbSNP
rs1447344625 2097 dbSNP
rs538404870 2106 dbSNP
rs1373250550 2107 dbSNP
rs1189991192 2108 dbSNP
rs1171129799 2117 dbSNP
rs1044286494 2122 dbSNP
rs946748005 2124 dbSNP
rs567863712 2127 dbSNP
rs898561454 2128 dbSNP
rs1250459786 2133 dbSNP
rs549693345 2138 dbSNP
rs1038398818 2139 dbSNP
rs1253432414 2140 dbSNP
rs527975964 2141 dbSNP
rs560146199 2158 dbSNP
rs551348535 2159 dbSNP
rs889783062 2163 dbSNP
rs966021773 2164 dbSNP
rs1291168277 2179 dbSNP
rs1235702873 2184 dbSNP
rs770707183 2185 dbSNP
rs1429859986 2190 dbSNP
rs73711468 2197 dbSNP
rs1410663780 2198 dbSNP
rs144903130 2199 dbSNP
rs1179165449 2203 dbSNP
rs923868736 2204 dbSNP
rs1292018780 2205 dbSNP
rs1042223283 2207 dbSNP
rs2138087 2209 dbSNP
rs1289460282 2211 dbSNP
rs1027457570 2215 dbSNP
rs995092726 2220 dbSNP
rs74457716 2223 dbSNP
rs1014610593 2225 dbSNP
rs990970319 2239 dbSNP
rs959189637 2243 dbSNP
rs189215731 2244 dbSNP
rs981807048 2251 dbSNP
rs760576423 2252 dbSNP
rs1214465544 2265 dbSNP
rs1260800472 2267 dbSNP
rs1159329555 2268 dbSNP
rs149886482 2274 dbSNP
rs573152753 2275 dbSNP
rs1268671653 2279 dbSNP
rs1264742541 2283 dbSNP
rs1201977793 2286 dbSNP
rs1190302328 2289 dbSNP
rs557820489 2290 dbSNP
rs1160005882 2291 dbSNP
rs1347025854 2292 dbSNP
rs1488331104 2293 dbSNP
rs1456627264 2295 dbSNP
rs1025870065 2309 dbSNP
rs994402495 2310 dbSNP
rs1216064257 2314 dbSNP
rs115080509 2318 dbSNP
rs1017097157 2334 dbSNP
rs1002417937 2335 dbSNP
rs905450363 2340 dbSNP
rs34288799 2341 dbSNP
rs1267572581 2344 dbSNP
rs1239790284 2350 dbSNP
rs1218685706 2351 dbSNP
rs1007346711 2353 dbSNP
rs1490394193 2357 dbSNP
rs1299419474 2361 dbSNP
rs1225189855 2366 dbSNP
rs1218889549 2368 dbSNP
rs1250056829 2378 dbSNP
rs184459520 2380 dbSNP
rs1178258777 2381 dbSNP
rs1410307685 2384 dbSNP
rs1422159182 2385 dbSNP
rs889886388 2389 dbSNP
rs1432786657 2393 dbSNP
rs1030048596 2394 dbSNP
rs368006710 2397 dbSNP
rs141008965 2400 dbSNP
rs1441444650 2401 dbSNP
rs748064576 2402 dbSNP
rs1042318379 2403 dbSNP
rs147337556 2404 dbSNP
rs893638625 2405 dbSNP
rs1054966573 2409 dbSNP
rs911859223 2410 dbSNP
rs986547329 2412 dbSNP
rs1437577105 2418 dbSNP
rs953294714 2419 dbSNP
rs937722504 2422 dbSNP
rs219812 2425 dbSNP
rs1183140299 2434 dbSNP
rs761090557 2440 dbSNP
rs928954564 2441 dbSNP
rs1195958621 2448 dbSNP
rs1419029829 2450 dbSNP
rs1409175284 2451 dbSNP
rs1275252615 2453 dbSNP
rs555662262 2453 dbSNP
rs534545030 2454 dbSNP
rs1247880436 2455 dbSNP
rs1206276671 2456 dbSNP
rs1335566251 2456 dbSNP
rs1486863554 2458 dbSNP
rs1254393556 2459 dbSNP
rs1014742525 2460 dbSNP
rs1374250544 2463 dbSNP
rs1209670162 2465 dbSNP
rs566792824 2483 dbSNP
rs1446958583 2484 dbSNP
rs1268078058 2490 dbSNP
rs960060273 2490 dbSNP
rs1215528101 2494 dbSNP
rs962935773 2500 dbSNP
rs1001620173 2501 dbSNP
rs143992158 2526 dbSNP
rs1044349765 2527 dbSNP
rs113278612 2530 dbSNP
rs569020746 2531 dbSNP
rs1298181620 2532 dbSNP
rs1383901731 2534 dbSNP
rs768023330 2537 dbSNP
rs954247423 2542 dbSNP
rs1301823376 2544 dbSNP
rs892635999 2546 dbSNP
rs189907381 2551 dbSNP
rs1406681203 2552 dbSNP
rs1470678111 2561 dbSNP
rs944739822 2564 dbSNP
rs998707194 2567 dbSNP
rs902510220 2568 dbSNP
rs140087028 2570 dbSNP
rs1389975014 2575 dbSNP
rs1223243485 2576 dbSNP
rs1343997078 2576 dbSNP
rs1264334601 2581 dbSNP
rs1326199548 2588 dbSNP
rs1203468398 2589 dbSNP
rs1010786892 2590 dbSNP
rs184587887 2599 dbSNP
rs540038026 2611 dbSNP
rs973283913 2612 dbSNP
rs764064753 2616 dbSNP
rs1055335918 2617 dbSNP
rs528411583 2620 dbSNP
rs908748996 2621 dbSNP
rs959787319 2623 dbSNP
rs906382114 2632 dbSNP
rs1203306065 2634 dbSNP
rs979899756 2634 dbSNP
rs1383591974 2635 dbSNP
rs1400974885 2649 dbSNP
rs73145619 2651 dbSNP
rs1363281154 2652 dbSNP
rs752799651 2657 dbSNP
rs1284249544 2658 dbSNP
rs1348002959 2659 dbSNP
rs117561424 2667 dbSNP
rs918884137 2675 dbSNP
rs1021340779 2682 dbSNP
rs1229513483 2684 dbSNP
rs192720913 2691 dbSNP
rs892731009 2692 dbSNP
rs1221556590 2695 dbSNP
rs1269319507 2699 dbSNP
rs1453307425 2700 dbSNP
rs941588655 2704 dbSNP
rs1179536765 2715 dbSNP
rs1031148060 2718 dbSNP
rs1470221432 2722 dbSNP
rs910155822 2723 dbSNP
rs1159740689 2725 dbSNP
rs1414803634 2733 dbSNP
rs1009498949 2734 dbSNP
rs1304190331 2742 dbSNP
rs1305750702 2747 dbSNP
rs1390206852 2751 dbSNP
rs1428745352 2752 dbSNP
rs1370311148 2756 dbSNP
rs1336819525 2757 dbSNP
rs1241292637 2761 dbSNP
rs986141294 2769 dbSNP
rs890655366 2770 dbSNP
rs565927681 2774 dbSNP
rs1193812189 2777 dbSNP
rs541939305 2778 dbSNP
rs922797425 2779 dbSNP
rs1475554365 2780 dbSNP
rs187589881 2793 dbSNP
rs1180261063 2796 dbSNP
rs1482885278 2801 dbSNP
rs966784546 2805 dbSNP
rs1460806253 2806 dbSNP
rs899155656 2807 dbSNP
rs1397916310 2808 dbSNP
rs1037667714 2813 dbSNP
rs1250965996 2818 dbSNP
rs940576766 2825 dbSNP
rs1453421142 2829 dbSNP
rs1317459389 2835 dbSNP
rs1020931445 2837 dbSNP
rs1324853656 2838 dbSNP
rs184816720 2843 dbSNP
rs1340051211 2856 dbSNP
rs938495782 2862 dbSNP
rs534099148 2864 dbSNP
rs1260749672 2865 dbSNP
rs1460508829 2871 dbSNP
rs958170010 2872 dbSNP
rs566827689 2876 dbSNP
rs1264741508 2877 dbSNP
rs1002559195 2885 dbSNP
rs1467682190 2886 dbSNP
rs780485502 2888 dbSNP
rs1174949318 2892 dbSNP
rs968499827 2892 dbSNP
rs1470350427 2900 dbSNP
rs1338700019 2905 dbSNP
rs756416889 2906 dbSNP
rs1285964592 2914 dbSNP
rs751791290 2917 dbSNP
rs192404641 2920 dbSNP
rs956921293 2922 dbSNP
rs1031242245 2937 dbSNP
rs1009184519 2942 dbSNP
rs890614152 2943 dbSNP
rs1322656575 2944 dbSNP
rs1203761116 2949 dbSNP
rs9373 2950 dbSNP
rs1257230745 2952 dbSNP
rs1484716993 2959 dbSNP
rs539736532 2960 dbSNP
rs993173378 2964 dbSNP
rs551890363 2967 dbSNP
rs1197636744 2968 dbSNP
rs1429201179 2971 dbSNP
rs1481045246 2972 dbSNP
rs542274975 2975 dbSNP
rs1343489532 2979 dbSNP
rs1393453192 2983 dbSNP
rs1037306029 2993 dbSNP
rs61326484 2994 dbSNP
rs200900307 3001 dbSNP
rs745613861 3002 dbSNP
rs1300991137 3019 dbSNP
rs1037636535 3024 dbSNP
rs1224020959 3025 dbSNP
rs1302817977 3026 dbSNP
rs1314646909 3040 dbSNP
rs1004857472 3046 dbSNP
rs1260957850 3050 dbSNP
rs1370674407 3053 dbSNP
rs1489027042 3056 dbSNP
rs1472307412 3060 dbSNP
rs1268604181 3064 dbSNP
rs1364540504 3068 dbSNP
rs886464890 3071 dbSNP
rs1056964716 3073 dbSNP
rs1406376171 3076 dbSNP
rs746285233 3077 dbSNP
rs1159851520 3079 dbSNP
rs1382407734 3090 dbSNP
rs1266455965 3092 dbSNP
rs1050004112 3093 dbSNP
rs1214219010 3094 dbSNP
rs865930173 3098 dbSNP
rs932938732 3108 dbSNP
rs922757793 3111 dbSNP
rs550677442 3114 dbSNP
rs966753034 3120 dbSNP
rs1295242592 3121 dbSNP
rs187636696 3123 dbSNP
rs1390314543 3137 dbSNP
rs914003541 3137 dbSNP
rs1309341167 3138 dbSNP
rs914345182 3141 dbSNP
rs989586521 3143 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.536 7.4e-3 -0.650 9.6e-4 20 Click to see details
GSE28260 Renal cortex and medulla -0.444 6.4e-2 -0.396 9.0e-2 13 Click to see details
GSE17306 Multiple myeloma 0.219 6.5e-2 0.133 1.8e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells 0.284 9.5e-2 -0.021 4.6e-1 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.262 1.0e-1 0.187 1.9e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.286 1.1e-1 -0.286 1.1e-1 20 Click to see details
GSE21849 B cell lymphoma 0.205 1.4e-1 0.360 2.8e-2 29 Click to see details
GSE38226 Liver fibrosis -0.206 1.9e-1 -0.199 1.9e-1 21 Click to see details
GSE21687 Ependynoma primary tumors -0.11 1.9e-1 -0.171 8.8e-2 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.161 2.3e-1 0.071 3.7e-1 24 Click to see details
GSE27834 Pluripotent stem cells -0.18 2.5e-1 -0.244 1.8e-1 16 Click to see details
GSE32688 Pancreatic cancer 0.121 2.5e-1 0.160 1.9e-1 32 Click to see details
GSE28544 Breast cancer -0.134 2.7e-1 -0.349 4.7e-2 24 Click to see details
GSE14794 Lymphoblastoid cells -0.058 2.9e-1 -0.057 3.0e-1 90 Click to see details
GSE19783 ER- ER- breast cancer 0.043 3.5e-1 0.047 3.4e-1 79 Click to see details
GSE19536 Breast cancer -0.028 3.9e-1 -0.095 1.7e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.047 4.1e-1 0.130 2.7e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.034 4.6e-1 0.266 2.0e-1 12 Click to see details
GSE17498 Multiple myeloma 0.016 4.6e-1 0.106 2.6e-1 40 Click to see details
GSE21032 Prostate cancer 0.01 4.6e-1 -0.010 4.6e-1 83 Click to see details
GSE21032 Prostate cancer 0.01 4.6e-1 -0.010 4.6e-1 83 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUAD 0.559 0.03 0.573 0.03 12 Click to see details
THCA -0.236 0.04 -0.278 0.02 59 Click to see details
KIRP -0.295 0.05 -0.337 0.03 32 Click to see details
BLCA 0.341 0.08 0.323 0.1 18 Click to see details
LIHC -0.195 0.09 -0.207 0.08 49 Click to see details
BRCA -0.122 0.13 -0.141 0.1 84 Click to see details
KIRC 0.096 0.22 0.128 0.15 68 Click to see details
CESC -0.726 0.24 -0.500 0.33 3 Click to see details
CHOL 0.239 0.27 0.333 0.19 9 Click to see details
KICH 0.1 0.32 0.132 0.26 25 Click to see details
PRAD 0.061 0.34 0.074 0.3 50 Click to see details
STAD 0.067 0.36 0.158 0.19 32 Click to see details
COAD 0.147 0.36 0.000 0.5 8 Click to see details
LUSC 0.043 0.4 -0.008 0.48 38 Click to see details
ESCA 0.086 0.4 0.073 0.42 11 Click to see details
PAAD -0.154 0.42 -0.600 0.2 4 Click to see details
PCPG -0.144 0.45 -0.500 0.33 3 Click to see details
HNSC -0.01 0.47 -0.093 0.28 42 Click to see details
UCEC -0.008 0.49 -0.061 0.4 19 Click to see details
UCEC -0.008 0.49 -0.061 0.4 19 Click to see details
UCEC -0.008 0.49 -0.061 0.4 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*