miRTarBase - #MIRT726715 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RNMT   
Synonyms CMT1, CMT1c, MET, Met, RG7MT1, cm1p, hCMT1, hMet
Description RNA guanine-7 methyltransferase
Transcript NM_003799   
Expression
Putative miRNA Targets on RNMT
3'UTR of RNMT
(miRNA target sites are highlighted)
>RNMT|NM_003799|3'UTR
   1 GCACATAGGCAGTAGTCCCAGAGGGGCCGTGTTCTGTCCTGCACAAATTTGAACAACTCATCTCGATATATTTGATATTT
  81 CTCTGTCTGTTGATTTTAATTCTAAATGTGCAGGATGCTGCCAGAAACTCCAATGTAGAAATTCAACATTTGCTGTCTGT
 161 GACAGATGAACTTTTGCATGTGTATATAAGAATGAGTTGGGACCTCTGTCTTTAAAAATCTATTTTTAGGTAATGTTCTA
 241 AGAATTCCATTTGCCTCTATGATCTTAGCTCATAAAAATATAATATGACTTGATAAAGCAACTAAACTCTTTCCACAGTG
 321 TTCAGATTTGTCCTGTGTGTGTTTACAGTATTCAATTTATTGCAGTTATAGAATTGGTCAGAGAGCATTTTCATAGTGTG
 401 CTCATTTCTATGGTTTTGTTATATAGCATTTTTCAACATTTAATGGTCTGTACAGTTGAATGTAAGTGTTCAATATGTAT
 481 TGCTGAAGTTATAAGTTTAAAACTCAATTTCAGATGCTCATAAAAGTTACTTAGCTAAAATTTTAGCAATTTATTGCATT
 561 TTGAAATAATCATTAACATGCTGCAATTCAGGAGCTGGTTAGAACATTTTAAGTGGCAGCATAGAATTTTGGAATTTTGG
 641 GGCTTTCTTTTCAGAAATTGCTACCATAGTAATTAATGTTTCCAGTTATCAAGATTGTGATTAGACACATTTACCTTTCT
 721 TCATTGAACAAATGGTGCCATAGTTATTTTTCTCAAAATTTAGTGAAAATCCCTCCCATGTAGACATGTTGCACATTTTT
 801 TCCAAATTTATACATGGAACTGCAGTAGGAATATTCTCACCATCTGATGCCATGTACCCACTTCAGAAATAAGCAATACT
 881 TGTTCCTCTGTTACAACCTCAGCACTTTGCACCGTAGGAGCCATTGTTAAAGTTGTCACTTGTGTAACTGACTGCTTTTC
 961 CAAAACTGGTACTTATGTGAACTGTTGTCCTTGCTTTACACCACCATTTGGAAAACTTACCAGTTTTTAGATGTAGATGT
1041 AGTGAAAAACTTCAAGAATGAAGCAGAGCAATTGAGTATTCTTTTTTAAATTATTAAGCCATGATTTACAAAAACATTAC
1121 TTTCTGTAATTCACAATACTTGTTTTAAAAACATAGTGTCTTCATTAGTGTGCATCTATTAACTGTTCATGGTGTTAGAG
1201 TTGCAAACTTTTTAGCAAGAAAATATGGATTTCCTCATTTCAGTTCCTTCTGCAGCCTGTGAATCTCCACAAAGTGTTAC
1281 CAGTTTACAAAAATAAGTCTTTTTGCCTTAAGTCATTTTGGAAATAAGTAATACTGCATCTGACTCTGGTGGCTGTATTA
1361 GCTAGGAAAGGTTTGTAAATGGTGTCAGTGAGGTGGGGAAAGGAAGTCTTCCTGTCACATATGCAGGTTCGTTTTCATTC
1441 TAGGGCAGTGCCAGGAAGTATATTGATAGCTTTGTAGGTACAGGAAAAACATCATCATTATTTCCTCTGTTCACATTTAC
1521 TGGTCTTAATTAACAGGTAATAATAATACATGTACTTTTAGCCTGAAACCTCTTCCACGCCATGGGTAACTTGGGGGAGA
1601 GAAGAATCCTCCAAACGATGGAGTAGCCAGTGGTAATACAAAGCAGGGAGAACAGAAAGGTAGAGTTACTAAGGCCTTCA
1681 GTGAACAGAAAGGAGCAGAGAGCAAGATTAGATCTGAGAAGATGCTCTGGGGACTGAGCCCACTGTTGTTGGTGTCAGGG
1761 AGGCTTACTGGAGCCACACCTGCAGGCGCTGTGTTCAGGCACCACCTTCCTCCTTGAGCTTTGCCTGTCTCTTGCCTTAT
1841 CAGTTCTTCCTCCACCACCCTACACCCCCCTCCCCCCGGCCCCAAGCCCCTGTGTCTCCTTGTTACAATTAAGTTTCTGG
1921 ATATTGACTTAAGAACTGTTAGGAAGAGGACTAGAAAAGGCTTCCCCTGCCTATCCTCTCCGATCACCAAGGTGGAAGGG
2001 AGCTAGTAGGACTCTTCCTTGACACACCTTGTCGTCTAAATGTTCGGTATTCTATTCAGGACTTACGGTAACTATTATGA
2081 GGGAGGCATGGCTTTCCACCGTCGGGCCAGGAAGAGCACCTGTTGCTGCAAGCTCAGTGAAGTGGGGCACTCCCAGACCT
2161 GCCATGCAGTTTATCCTCTGAGAATGGAATTGGAAATGAAGACCTAACCAGCTATTGGTGGGAATGACGGAACTGGGGAT
2241 TGCGATGATTGATCTGGGAACATGGCTGGATTGTGATTTAACCAAGAATGCTGATGTTGAATTCTTTGGGCCTAGAATAT
2321 ACTTGAGAAAGCACTAGTGGCTTGTGTTCAGGGAGAGGAGCTGGCAGTTTTTAACCACTTCTGTGGGAGCCGTGTTCTAA
2401 CCTGTGGAAAGTATTGCAATTCTGTGAGAGTGACTCTGCAGAGTCACTGCACCATCAGGCTTGGCCCTGCTGTGCCTTCA
2481 GTACCCAGCCAGGTTCTCTGGGTCCAGGGTGACTCTCCAAAGAAATTGGCCTTCAGCTGGAGAAAACATTGGGTGGAGAC
2561 TCTCACTTATGTTAATGCAATCTTGAAATGACTGAAAGGTAGATTGCCAGCACAGTGAGTTTCCCAGCCTGCTCCCCCAT
2641 CCACACTTGGAAATTGAGGGAGCATGACCGCTCTCTGACTTCACATGTTAATAGAGGATCAGAGCAGAGTTGGGAGTATA
2721 TTGGTCAGGATCATAGAAAAGAAGACAAAGCTTGCTCAGCCATGAGATGGCCAGGTATCCAGTTTTGTTAACTCTCTTTG
2801 GGAATTTCTTTTTCAGCCTGTTTTTTAGCTTAGTGCCATTATGTCATTTTGATTTGTATTCAAGTACTCTTCAAGTATCT
2881 TTGTAATGAAGGTTTGGCTACTTGTATAGGTCTGCCTGCAGGGTGAAAATGCCAGTGTGAATATTCTAGCTACCAAACAT
2961 TGTTTTTTGTTGAAAAACTGACTTTCTGTTGTCTACCTCAGGCCTTGTGCATTTGGGTTATCTCAAGCCAGTCACCACAG
3041 AGGGTCTCTAGGGTCTGCAAAATAGAGGCCAAATCCAGGGACCAGGCCCTAATAATAGAAGTTGTACCAAAATGCCTGTG
3121 GTACTTGATGGCCTGTTGGTCAAATAGGAAGTACAAGTGTGTGATGTTAGAACCTCCCTAGTTGCTGCTATATCAAACAC
3201 TGCACACTTGACAAGTGTTTTCATTCCCCGCCCTCTGACAGAACAACATTCCTAATTCTTTGAAGGCAACCAGTGCAAAG
3281 GCTACTACACTTGTGTAATGATATTTAGCAGATGCATACAGGACTGGATCCCAGGGCACTGTCAGTTCTTCCCTCCCTCT
3361 CGTGCTGCTCAGTTTGTCCTCTGCTCCCATGTAGGCCTAAAGTCACCCCACTCCTTAGTGCCTGCACCTCACCACGATAT
3441 TGAGGAAGCACAGGACATCCAAGGGTACTCTCCAGTTTGGCTGTGGAGACTTGAGCAAGCCCTAAAGTCCCCTGCTCCCT
3521 GGACTTCTCCTGGGTTGTGCTTTTTTGGGGGCAACATACCTTGGACAAAGCTGAGCTGACAGCTAATGTTTATTAGCCTC
3601 CTACCTAAGTCAGTCACTTTGCTAAATTCTTCACCTGTGGTAACTCATTTTGATTGTTATAACATCTCAGCACCGTTATT
3681 CCCATTTTAATGATGAGGAAACTGAGTCATAGAGGATACAGACTTGCCCAAAGGAGAGCCAGGATTTTCACACCCCCTCC
3761 TCAAGCTGGGCCTGCCCTCCAAGTGCTTGTTATATACCTCCACGGGTGTCAGCCCAGATGACTCCTCACCCATCCACCAC
3841 CTGCAGCTTGAGATGTTAACTATTAGAGCTCCATTCTTTTGGTTCAAAACGTTGATACTTACTTAGATGTTCCCTGAGAG
3921 GAGTGTTTATTTCTGAGTAAGGGGCTTTGTTGAAAGAGGGGGTTAGAGAGAGCAAGACAGCACTTGAGTGCACTGGCAGG
4001 AAGCAGAGATAAGACTTGAATTTCAGTTTGGTAGACCACCTTCTTTAGCAGCCCAACCTGTAGCAAATCTAGTTTAGCCT
4081 GCATGGCAGGGAGAGGGATTCTCTTCCCACCCTCACCATTTGCAAGTGGCAGGAGCTGAGAATGCCAGTACGAGAGTGTA
4161 GCCAAAGTGAGAGGCTGAGAGCAAAGGAGACATTTTTTTCAGTTTTGAGTCGAGTATCCAGACAGAGGCAAATCATTTTG
4241 TTTAACTTTTTATTAAAGTGTAACTATAGAAACACATCAATGATTTTTCACAAGTGGAGCACGTGCATACAATCGGCACC
4321 CCAGAAGCCCCCCGTCAGATTCCCTTCCAGTTAACTACCTCTCCAAGGGAAACCACTATCCTGAGTTCTAAGCGCATAGA
4401 TTAGTTCTGTCTGGTTTGGGGAGATATATAAATGGAATTATGCATTCTTCGTATCTGGTTTCTTTTCACCAATATTATGT
4481 TTGTGAGATTTTTGTTGCATGTATTTGTACATGGATTTTCATTCTCATGGTTGTATAATATTTCATTGTGTGAATAAACC
4561 ACATACTGTTTATCTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUA---AUACACGACGAu 5'
             :|||| |   ||  ||||||| 
Target 5' ttaGAACC-TCCCTAGTTGCTGCTa 3'
3167 - 3190 150.00 -13.44
2
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || |   |||||||| 
Target 5' ttccctCCCTCTCGTGCTGCTc 3'
3349 - 3370 148.00 -12.00
3
miRNA  3' guguUUGGUAA-UACACGACGau 5'
              ||:|||| |  ||||||  
Target 5' aaatAATCATTAACATGCTGCaa 3'
564 - 586 142.00 -12.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31500850 20 COSMIC
COSN8604160 42 COSMIC
COSN26992510 43 COSMIC
COSN26145082 52 COSMIC
COSN30180944 60 COSMIC
COSN30158736 63 COSMIC
COSN31512511 75 COSMIC
COSN31582003 82 COSMIC
COSN31543873 89 COSMIC
COSN30522078 111 COSMIC
COSN23511598 162 COSMIC
COSN30126405 172 COSMIC
COSN31559094 248 COSMIC
COSN31539220 279 COSMIC
COSN31577612 292 COSMIC
COSN26509106 306 COSMIC
COSN31529988 358 COSMIC
COSN26678911 419 COSMIC
COSN31514117 441 COSMIC
COSN31488459 590 COSMIC
COSN1731878 612 COSMIC
COSN27091607 1056 COSMIC
COSN27246625 1871 COSMIC
COSN6415967 1872 COSMIC
COSN1203632 1879 COSMIC
COSN25760430 1885 COSMIC
COSN31529394 2023 COSMIC
COSN20054604 2035 COSMIC
COSN31552270 2049 COSMIC
COSN31596976 2102 COSMIC
COSN31975607 2176 COSMIC
COSN19596440 2244 COSMIC
COSN5421948 2434 COSMIC
COSN9326286 2546 COSMIC
COSN17038317 2629 COSMIC
COSN9326287 2688 COSMIC
COSN22164596 2767 COSMIC
COSN5865668 2915 COSMIC
COSN6114877 2974 COSMIC
COSN16089541 3152 COSMIC
COSN27076135 3191 COSMIC
COSN30550430 3204 COSMIC
COSN9223694 3625 COSMIC
COSN26470053 4155 COSMIC
COSN23747895 4300 COSMIC
COSN28201077 4355 COSMIC
COSN25005854 4406 COSMIC
COSN24294775 4410 COSMIC
COSN19122781 4481 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1356096833 1 dbSNP
rs1464676603 2 dbSNP
rs1302501078 5 dbSNP
rs1441290290 6 dbSNP
rs1306016318 10 dbSNP
rs377547660 16 dbSNP
rs753834861 19 dbSNP
rs1296468463 25 dbSNP
rs1340398535 26 dbSNP
rs371324994 27 dbSNP
rs752219446 29 dbSNP
rs757890413 30 dbSNP
rs76766210 31 dbSNP
rs746618761 32 dbSNP
rs377540161 37 dbSNP
rs746387956 42 dbSNP
rs1176133567 45 dbSNP
rs202121900 50 dbSNP
rs776058939 52 dbSNP
rs1180570572 65 dbSNP
rs1482942493 69 dbSNP
rs1251631302 75 dbSNP
rs1197809863 77 dbSNP
rs888990032 79 dbSNP
rs1356463069 80 dbSNP
rs1240309617 82 dbSNP
rs766696770 86 dbSNP
rs1325665264 89 dbSNP
rs1260673900 90 dbSNP
rs190058534 105 dbSNP
rs1336149022 107 dbSNP
rs1211749867 111 dbSNP
rs1253839646 113 dbSNP
rs1043300654 128 dbSNP
rs1468250076 134 dbSNP
rs9956610 138 dbSNP
rs897810118 144 dbSNP
rs1385734963 146 dbSNP
rs1157620729 147 dbSNP
rs993926399 165 dbSNP
rs560579518 167 dbSNP
rs1364779780 172 dbSNP
rs1158227204 175 dbSNP
rs888037314 176 dbSNP
rs1362023692 177 dbSNP
rs1013000221 178 dbSNP
rs1204474076 180 dbSNP
rs1266261079 181 dbSNP
rs182996727 181 dbSNP
rs1208059982 187 dbSNP
rs1039204320 197 dbSNP
rs1281132710 205 dbSNP
rs1242342148 206 dbSNP
rs1438346599 210 dbSNP
rs900284003 219 dbSNP
rs997673311 228 dbSNP
rs1375916277 235 dbSNP
rs542904737 239 dbSNP
rs972001098 241 dbSNP
rs1400688332 245 dbSNP
rs981864428 249 dbSNP
rs1035200758 255 dbSNP
rs748085138 261 dbSNP
rs1456716687 265 dbSNP
rs1384936160 273 dbSNP
rs1184461895 283 dbSNP
rs1446625837 286 dbSNP
rs1246302195 287 dbSNP
rs1187975308 291 dbSNP
rs1306871081 298 dbSNP
rs987811832 307 dbSNP
rs1487956168 310 dbSNP
rs886261571 310 dbSNP
rs3760533 313 dbSNP
rs1207932183 314 dbSNP
rs1235197499 316 dbSNP
rs1273961180 317 dbSNP
rs773021012 318 dbSNP
rs1016113738 331 dbSNP
rs1240286635 332 dbSNP
rs1296307663 349 dbSNP
rs1362553764 349 dbSNP
rs1430818948 353 dbSNP
rs963354449 356 dbSNP
rs986077943 367 dbSNP
rs910375730 369 dbSNP
rs746756055 370 dbSNP
rs1164569623 376 dbSNP
rs770582224 378 dbSNP
rs531508778 382 dbSNP
rs897919597 386 dbSNP
rs1243872387 387 dbSNP
rs913413229 388 dbSNP
rs78264345 394 dbSNP
rs187289905 395 dbSNP
rs979010618 396 dbSNP
rs759219701 400 dbSNP
rs369730947 403 dbSNP
rs192030639 411 dbSNP
rs1339715808 420 dbSNP
rs1273471767 426 dbSNP
rs887819714 440 dbSNP
rs1013114516 443 dbSNP
rs1340887232 445 dbSNP
rs532262293 446 dbSNP
rs907344597 447 dbSNP
rs1038736970 450 dbSNP
rs769242042 456 dbSNP
rs921577677 459 dbSNP
rs1421793282 462 dbSNP
rs1003464971 463 dbSNP
rs1480102814 465 dbSNP
rs1034739637 477 dbSNP
rs956660192 484 dbSNP
rs759506332 485 dbSNP
rs987926189 492 dbSNP
rs1021959362 495 dbSNP
rs1354789093 512 dbSNP
rs143562749 522 dbSNP
rs1204812268 527 dbSNP
rs1439160520 527 dbSNP
rs1275947432 535 dbSNP
rs1298020622 537 dbSNP
rs1323542474 540 dbSNP
rs1284504791 549 dbSNP
rs1225840519 555 dbSNP
rs565711641 557 dbSNP
rs1349055472 559 dbSNP
rs1443268573 566 dbSNP
rs529642849 569 dbSNP
rs200997002 570 dbSNP
rs944529205 578 dbSNP
rs763405068 579 dbSNP
rs886293317 579 dbSNP
rs1004636392 587 dbSNP
rs1178524831 588 dbSNP
rs1471545610 595 dbSNP
rs1177542379 596 dbSNP
rs543825499 602 dbSNP
rs1470989922 609 dbSNP
rs919310133 612 dbSNP
rs35564130 631 dbSNP
rs1202581229 633 dbSNP
rs1325186324 634 dbSNP
rs1461398239 635 dbSNP
rs929391561 656 dbSNP
rs1206168791 657 dbSNP
rs549236588 668 dbSNP
rs1315633960 677 dbSNP
rs183911908 679 dbSNP
rs909197590 691 dbSNP
rs1001837657 696 dbSNP
rs1203544276 699 dbSNP
rs948740275 714 dbSNP
rs1452127493 715 dbSNP
rs562511222 715 dbSNP
rs1383659214 723 dbSNP
rs529898683 734 dbSNP
rs907455843 738 dbSNP
rs556742126 754 dbSNP
rs1455617135 774 dbSNP
rs1486534979 789 dbSNP
rs1159645400 796 dbSNP
rs34353459 796 dbSNP
rs960284842 796 dbSNP
rs751988372 806 dbSNP
rs1256751131 809 dbSNP
rs1402249549 810 dbSNP
rs1411301215 811 dbSNP
rs1473919269 811 dbSNP
rs1182636201 813 dbSNP
rs1195273561 813 dbSNP
rs1419770032 815 dbSNP
rs1444836890 823 dbSNP
rs1244498263 824 dbSNP
rs1427624872 834 dbSNP
rs1186108534 836 dbSNP
rs187623489 837 dbSNP
rs1020747186 842 dbSNP
rs967546095 851 dbSNP
rs891996319 853 dbSNP
rs192527400 854 dbSNP
rs1022078511 858 dbSNP
rs1436993545 867 dbSNP
rs1313978542 870 dbSNP
rs967684594 877 dbSNP
rs150978499 884 dbSNP
rs1360406653 887 dbSNP
rs767992010 897 dbSNP
rs1017490095 902 dbSNP
rs1361277658 911 dbSNP
rs1272061749 914 dbSNP
rs61306721 914 dbSNP
rs966358851 915 dbSNP
rs1214139532 917 dbSNP
rs1293726002 919 dbSNP
rs1162673670 927 dbSNP
rs976065448 938 dbSNP
rs1386706033 943 dbSNP
rs919078175 945 dbSNP
rs548459383 947 dbSNP
rs543068285 948 dbSNP
rs1261750247 951 dbSNP
rs776074330 954 dbSNP
rs950583743 972 dbSNP
rs1267268594 976 dbSNP
rs11659762 977 dbSNP
rs1294218793 980 dbSNP
rs375540512 998 dbSNP
rs1307027591 1002 dbSNP
rs940439672 1013 dbSNP
rs909313326 1020 dbSNP
rs1343553044 1021 dbSNP
rs370831631 1023 dbSNP
rs183769938 1026 dbSNP
rs1405335829 1032 dbSNP
rs1044791990 1035 dbSNP
rs898988595 1038 dbSNP
rs1305820820 1039 dbSNP
rs928690207 1040 dbSNP
rs1373189950 1043 dbSNP
rs938922591 1045 dbSNP
rs1430863885 1054 dbSNP
rs895818078 1063 dbSNP
rs576439303 1065 dbSNP
rs891952874 1066 dbSNP
rs780038232 1082 dbSNP
rs763569717 1089 dbSNP
rs753913689 1095 dbSNP
rs1426867627 1099 dbSNP
rs187321515 1102 dbSNP
rs1252028584 1116 dbSNP
rs1206711555 1118 dbSNP
rs866675427 1119 dbSNP
rs141315397 1122 dbSNP
rs1174713355 1126 dbSNP
rs145049763 1127 dbSNP
rs1223988060 1140 dbSNP
rs1347193408 1152 dbSNP
rs1304559076 1153 dbSNP
rs1310563402 1155 dbSNP
rs1390509993 1165 dbSNP
rs541072503 1171 dbSNP
rs1299446820 1175 dbSNP
rs551772602 1176 dbSNP
rs571627392 1177 dbSNP
rs1481033711 1190 dbSNP
rs547816371 1192 dbSNP
rs997831926 1206 dbSNP
rs1430137245 1212 dbSNP
rs1026248387 1215 dbSNP
rs1287299409 1218 dbSNP
rs950524728 1227 dbSNP
rs1179112002 1229 dbSNP
rs984596081 1232 dbSNP
rs1262541851 1243 dbSNP
rs1302489408 1260 dbSNP
rs768877502 1271 dbSNP
rs1325563498 1281 dbSNP
rs1258803483 1283 dbSNP
rs1238050822 1284 dbSNP
rs954412925 1293 dbSNP
rs1345473630 1300 dbSNP
rs987579390 1317 dbSNP
rs567594701 1319 dbSNP
rs1381460060 1328 dbSNP
rs909261089 1347 dbSNP
rs970110499 1348 dbSNP
rs1284897531 1349 dbSNP
rs940472120 1362 dbSNP
rs1213083799 1363 dbSNP
rs116989461 1365 dbSNP
rs928611315 1383 dbSNP
rs938717770 1394 dbSNP
rs550095967 1402 dbSNP
rs777627618 1408 dbSNP
rs1364692774 1415 dbSNP
rs920446338 1422 dbSNP
rs1468689965 1423 dbSNP
rs571770551 1425 dbSNP
rs538865126 1431 dbSNP
rs1184271419 1432 dbSNP
rs774646431 1432 dbSNP
rs937129924 1437 dbSNP
rs554213162 1440 dbSNP
rs552426194 1447 dbSNP
rs746809110 1449 dbSNP
rs191728960 1453 dbSNP
rs1351158236 1455 dbSNP
rs1262243752 1456 dbSNP
rs1243382909 1463 dbSNP
rs895755009 1471 dbSNP
rs1315226249 1479 dbSNP
rs1409397955 1487 dbSNP
rs947505614 1491 dbSNP
rs1041763234 1494 dbSNP
rs1382118568 1497 dbSNP
rs536635291 1497 dbSNP
rs1000296261 1498 dbSNP
rs372833355 1500 dbSNP
rs770776550 1501 dbSNP
rs1160799927 1516 dbSNP
rs889998297 1520 dbSNP
rs1384839317 1531 dbSNP
rs1164373381 1532 dbSNP
rs1325491497 1538 dbSNP
rs900003104 1538 dbSNP
rs943105106 1548 dbSNP
rs1368452647 1550 dbSNP
rs781024166 1554 dbSNP
rs1038812225 1560 dbSNP
rs555030524 1570 dbSNP
rs901489429 1579 dbSNP
rs997204480 1580 dbSNP
rs1219975075 1584 dbSNP
rs1490107298 1597 dbSNP
rs1026615673 1602 dbSNP
rs1221561859 1605 dbSNP
rs1274580091 1615 dbSNP
rs1336919681 1616 dbSNP
rs886360297 1617 dbSNP
rs955835200 1618 dbSNP
rs982981311 1619 dbSNP
rs1300506573 1622 dbSNP
rs1014554900 1634 dbSNP
rs961665042 1635 dbSNP
rs1334926151 1640 dbSNP
rs1304001270 1650 dbSNP
rs1407251765 1654 dbSNP
rs1417523668 1656 dbSNP
rs1212619326 1661 dbSNP
rs1167399068 1663 dbSNP
rs1006130774 1665 dbSNP
rs3744815 1670 dbSNP
rs1197119968 1671 dbSNP
rs1480001254 1675 dbSNP
rs543741730 1685 dbSNP
rs973129078 1694 dbSNP
rs1435692859 1697 dbSNP
rs920310691 1701 dbSNP
rs969892259 1706 dbSNP
rs937099075 1709 dbSNP
rs980574597 1710 dbSNP
rs1340775567 1711 dbSNP
rs745551269 1723 dbSNP
rs1222165715 1740 dbSNP
rs1284290398 1744 dbSNP
rs1345307706 1744 dbSNP
rs570926432 1744 dbSNP
rs1352977728 1745 dbSNP
rs1328365105 1747 dbSNP
rs867089193 1750 dbSNP
rs960286614 1759 dbSNP
rs1410621676 1761 dbSNP
rs1180650419 1769 dbSNP
rs1174228103 1779 dbSNP
rs769452034 1781 dbSNP
rs558587391 1788 dbSNP
rs1192692601 1789 dbSNP
rs1468339258 1793 dbSNP
rs947615827 1803 dbSNP
rs979043276 1806 dbSNP
rs1420037971 1807 dbSNP
rs1182006640 1817 dbSNP
rs1462051793 1820 dbSNP
rs911380915 1832 dbSNP
rs1260656882 1838 dbSNP
rs1041628882 1844 dbSNP
rs1264219837 1850 dbSNP
rs942906783 1851 dbSNP
rs1039164156 1854 dbSNP
rs576939463 1856 dbSNP
rs1335092980 1863 dbSNP
rs1279212471 1864 dbSNP
rs111586867 1865 dbSNP
rs1379263211 1865 dbSNP
rs1334763656 1866 dbSNP
rs1439850316 1869 dbSNP
rs538346274 1870 dbSNP
rs1047382892 1871 dbSNP
rs1045054919 1872 dbSNP
rs1158818099 1873 dbSNP
rs886137802 1874 dbSNP
rs368078719 1878 dbSNP
rs1003059626 1879 dbSNP
rs1341104567 1884 dbSNP
rs1037031560 1885 dbSNP
rs1197917160 1886 dbSNP
rs1283972642 1887 dbSNP
rs1274068591 1891 dbSNP
rs897154779 1892 dbSNP
rs1203566277 1893 dbSNP
rs899951780 1894 dbSNP
rs1475557721 1895 dbSNP
rs1187372330 1896 dbSNP
rs1366921385 1897 dbSNP
rs1476552186 1898 dbSNP
rs1016157923 1902 dbSNP
rs1304537185 1903 dbSNP
rs1395435481 1906 dbSNP
rs1344429726 1922 dbSNP
rs996919974 1929 dbSNP
rs1314606688 1931 dbSNP
rs1421212885 1934 dbSNP
rs905667870 1939 dbSNP
rs1162471979 1944 dbSNP
rs1444741523 1946 dbSNP
rs78482894 1949 dbSNP
rs1036151678 1950 dbSNP
rs541418794 1961 dbSNP
rs1241960389 1966 dbSNP
rs1327684118 1968 dbSNP
rs745487391 1974 dbSNP
rs891264300 1982 dbSNP
rs141962591 1983 dbSNP
rs530432522 1984 dbSNP
rs1322437637 1993 dbSNP
rs1314900684 1995 dbSNP
rs1015758495 1999 dbSNP
rs1361167021 2003 dbSNP
rs968736060 2004 dbSNP
rs1194311088 2011 dbSNP
rs1352674658 2013 dbSNP
rs1421315603 2016 dbSNP
rs1431217997 2020 dbSNP
rs978991211 2022 dbSNP
rs1302182618 2023 dbSNP
rs550400792 2025 dbSNP
rs1167691841 2026 dbSNP
rs1378393320 2027 dbSNP
rs1419426790 2030 dbSNP
rs964525378 2032 dbSNP
rs961694904 2033 dbSNP
rs4461147 2034 dbSNP
rs774468154 2035 dbSNP
rs1359985335 2036 dbSNP
rs1401079995 2045 dbSNP
rs574685363 2046 dbSNP
rs12458065 2047 dbSNP
rs1202533569 2048 dbSNP
rs748876990 2049 dbSNP
rs762398526 2050 dbSNP
rs532707404 2053 dbSNP
rs1312365346 2055 dbSNP
rs766295064 2056 dbSNP
rs1283183115 2059 dbSNP
rs1236696808 2061 dbSNP
rs1352357253 2065 dbSNP
rs367884358 2067 dbSNP
rs768043505 2068 dbSNP
rs1369283963 2071 dbSNP
rs1296020960 2073 dbSNP
rs750768616 2075 dbSNP
rs1190389847 2077 dbSNP
rs941716555 2082 dbSNP
rs1461053889 2085 dbSNP
rs1267829443 2087 dbSNP
rs1037554857 2088 dbSNP
rs1354561713 2089 dbSNP
rs971198016 2101 dbSNP
rs566156796 2102 dbSNP
rs1001736450 2104 dbSNP
rs1199131849 2104 dbSNP
rs1420375132 2105 dbSNP
rs1269756514 2109 dbSNP
rs765124043 2111 dbSNP
rs1175654276 2114 dbSNP
rs1056963667 2117 dbSNP
rs1258760600 2118 dbSNP
rs1457859940 2121 dbSNP
rs1294449927 2123 dbSNP
rs1373656816 2126 dbSNP
rs1442581832 2132 dbSNP
rs752655518 2137 dbSNP
rs762823719 2144 dbSNP
rs762388004 2147 dbSNP
rs572433194 2153 dbSNP
rs1402233917 2154 dbSNP
rs1285805812 2155 dbSNP
rs1322495060 2158 dbSNP
rs536793089 2159 dbSNP
rs1220747155 2162 dbSNP
rs1265750297 2165 dbSNP
rs1469640391 2174 dbSNP
rs1176612778 2175 dbSNP
rs1237762860 2189 dbSNP
rs1233714403 2191 dbSNP
rs1234868653 2198 dbSNP
rs895675393 2199 dbSNP
rs763616839 2201 dbSNP
rs935897917 2205 dbSNP
rs1178971573 2207 dbSNP
rs763441476 2210 dbSNP
rs1304439553 2213 dbSNP
rs1390418659 2215 dbSNP
rs1054481537 2216 dbSNP
rs1332765490 2219 dbSNP
rs1405223383 2224 dbSNP
rs1449724015 2228 dbSNP
rs150392396 2229 dbSNP
rs1020406332 2230 dbSNP
rs968684018 2236 dbSNP
rs932739735 2237 dbSNP
rs1051162105 2238 dbSNP
rs1205840133 2239 dbSNP
rs891290733 2244 dbSNP
rs1238934808 2248 dbSNP
rs1004302498 2255 dbSNP
rs1000204455 2256 dbSNP
rs1261275929 2258 dbSNP
rs1242468954 2264 dbSNP
rs1200912702 2269 dbSNP
rs1346894782 2270 dbSNP
rs1258702251 2277 dbSNP
rs1018497096 2284 dbSNP
rs1463762405 2291 dbSNP
rs964322796 2302 dbSNP
rs1037153981 2307 dbSNP
rs1310897905 2308 dbSNP
rs1195734578 2311 dbSNP
rs1381342161 2318 dbSNP
rs138337122 2320 dbSNP
rs3744816 2336 dbSNP
rs558780000 2341 dbSNP
rs879548317 2342 dbSNP
rs1265613719 2345 dbSNP
rs958371620 2354 dbSNP
rs1160623365 2357 dbSNP
rs138510415 2367 dbSNP
rs951654365 2382 dbSNP
rs1173816428 2386 dbSNP
rs1365504480 2388 dbSNP
rs1384640848 2390 dbSNP
rs3744817 2392 dbSNP
rs1157544977 2393 dbSNP
rs907641592 2398 dbSNP
rs534792493 2407 dbSNP
rs1259469117 2409 dbSNP
rs1385989002 2411 dbSNP
rs1204326901 2417 dbSNP
rs1024020944 2420 dbSNP
rs1287746994 2423 dbSNP
rs971228995 2430 dbSNP
rs1037333517 2431 dbSNP
rs761494516 2434 dbSNP
rs868679892 2434 dbSNP
rs1246248843 2445 dbSNP
rs1299784789 2450 dbSNP
rs1338102105 2451 dbSNP
rs1293978178 2453 dbSNP
rs957301647 2454 dbSNP
rs1361513307 2457 dbSNP
rs990053067 2459 dbSNP
rs937267148 2460 dbSNP
rs921280851 2463 dbSNP
rs932628026 2477 dbSNP
rs552795636 2481 dbSNP
rs1371269311 2487 dbSNP
rs1192777936 2492 dbSNP
rs574185194 2496 dbSNP
rs1215731804 2499 dbSNP
rs541482356 2508 dbSNP
rs1467841342 2513 dbSNP
rs747369536 2513 dbSNP
rs912680475 2516 dbSNP
rs940106851 2518 dbSNP
rs1010094084 2521 dbSNP
rs1336816100 2523 dbSNP
rs1037184794 2530 dbSNP
rs1218516926 2532 dbSNP
rs1419671186 2533 dbSNP
rs898655990 2537 dbSNP
rs995728795 2548 dbSNP
rs1181006748 2550 dbSNP
rs1324368688 2551 dbSNP
rs1055359994 2554 dbSNP
rs1394375777 2561 dbSNP
rs754982557 2565 dbSNP
rs1169929308 2567 dbSNP
rs1462583441 2568 dbSNP
rs1041796033 2570 dbSNP
rs904608443 2571 dbSNP
rs1197013304 2579 dbSNP
rs1477538131 2581 dbSNP
rs1246941129 2590 dbSNP
rs1200493074 2591 dbSNP
rs1457703812 2608 dbSNP
rs1012552561 2615 dbSNP
rs1000319489 2623 dbSNP
rs1018265399 2626 dbSNP
rs1292210707 2635 dbSNP
rs964417840 2637 dbSNP
rs998590566 2639 dbSNP
rs1031519036 2642 dbSNP
rs998429879 2646 dbSNP
rs957167470 2663 dbSNP
rs1028207444 2664 dbSNP
rs1334109587 2665 dbSNP
rs1392416639 2669 dbSNP
rs563045491 2670 dbSNP
rs751553215 2671 dbSNP
rs954090276 2688 dbSNP
rs1294161017 2692 dbSNP
rs951519684 2695 dbSNP
rs1478837799 2707 dbSNP
rs1219115312 2709 dbSNP
rs575150872 2710 dbSNP
rs940138099 2719 dbSNP
rs972763574 2720 dbSNP
rs920112669 2722 dbSNP
rs1458663946 2723 dbSNP
rs757161006 2730 dbSNP
rs1442248015 2731 dbSNP
rs1195208935 2739 dbSNP
rs931459708 2744 dbSNP
rs1348805312 2751 dbSNP
rs982922277 2754 dbSNP
rs1187983678 2756 dbSNP
rs1007367263 2757 dbSNP
rs1240987641 2763 dbSNP
rs1379148420 2770 dbSNP
rs895435826 2773 dbSNP
rs1447156361 2774 dbSNP
rs1359571870 2777 dbSNP
rs949668875 2778 dbSNP
rs1379305941 2783 dbSNP
rs780884929 2783 dbSNP
rs1158811929 2786 dbSNP
rs906836221 2789 dbSNP
rs1382808447 2793 dbSNP
rs1180675335 2795 dbSNP
rs973161787 2795 dbSNP
rs998621742 2799 dbSNP
rs1212690990 2804 dbSNP
rs1487481159 2809 dbSNP
rs1172076985 2831 dbSNP
rs1217576969 2835 dbSNP
rs1356002435 2836 dbSNP
rs1312978346 2839 dbSNP
rs1356697444 2841 dbSNP
rs926968604 2843 dbSNP
rs184647936 2847 dbSNP
rs1031384673 2853 dbSNP
rs892981103 2857 dbSNP
rs1285811550 2859 dbSNP
rs937028637 2863 dbSNP
rs1462790882 2870 dbSNP
rs1307997548 2880 dbSNP
rs992737505 2884 dbSNP
rs745631413 2888 dbSNP
rs565557527 2893 dbSNP
rs1041568536 2894 dbSNP
rs1313489310 2896 dbSNP
rs1163458330 2905 dbSNP
rs1423823710 2909 dbSNP
rs1191404631 2912 dbSNP
rs1415178078 2915 dbSNP
rs954011162 2917 dbSNP
rs987109285 2924 dbSNP
rs904389404 2935 dbSNP
rs769348498 2952 dbSNP
rs1380116208 2953 dbSNP
rs961337267 2964 dbSNP
rs1438193379 2982 dbSNP
rs1226878249 2986 dbSNP
rs144351881 2990 dbSNP
rs919978462 2996 dbSNP
rs1322343899 3006 dbSNP
rs1307898800 3008 dbSNP
rs931381584 3012 dbSNP
rs936055748 3026 dbSNP
rs548010181 3029 dbSNP
rs188966963 3045 dbSNP
rs1278593972 3059 dbSNP
rs779694358 3066 dbSNP
rs998605960 3068 dbSNP
rs1029879317 3078 dbSNP
rs1292524258 3081 dbSNP
rs1457991595 3092 dbSNP
rs1351077829 3096 dbSNP
rs949673301 3097 dbSNP
rs1399069931 3099 dbSNP
rs1442516390 3101 dbSNP
rs748946410 3102 dbSNP
rs1423421302 3106 dbSNP
rs530329609 3122 dbSNP
rs1376357240 3124 dbSNP
rs1441434072 3133 dbSNP
rs182192110 3134 dbSNP
rs45596939 3137 dbSNP
rs1336902874 3145 dbSNP
rs1196500282 3146 dbSNP
rs1004461264 3151 dbSNP
rs576821265 3157 dbSNP
rs140901629 3159 dbSNP
rs76675921 3160 dbSNP
rs1235752564 3162 dbSNP
rs747968661 3164 dbSNP
rs780449514 3165 dbSNP
rs1182589756 3166 dbSNP
rs1247331182 3167 dbSNP
rs1388865692 3193 dbSNP
rs1437197095 3197 dbSNP
rs1174799747 3200 dbSNP
rs1300207479 3201 dbSNP
rs112931390 3206 dbSNP
rs1445872177 3208 dbSNP
rs1290884567 3217 dbSNP
rs1362859902 3224 dbSNP
rs544296041 3227 dbSNP
rs1011723317 3228 dbSNP
rs1349772914 3229 dbSNP
rs377293361 3230 dbSNP
rs1277796851 3231 dbSNP
rs1400215748 3232 dbSNP
rs1309969467 3238 dbSNP
rs958371808 3243 dbSNP
rs1332558751 3261 dbSNP
rs889588703 3262 dbSNP
rs1008164980 3274 dbSNP
rs1433959789 3279 dbSNP
rs1427438932 3281 dbSNP
rs534640823 3282 dbSNP
rs1019451504 3283 dbSNP
rs961368207 3285 dbSNP
rs552857120 3289 dbSNP
rs1200416903 3305 dbSNP
rs992913030 3312 dbSNP
rs1482177935 3315 dbSNP
rs1242354057 3323 dbSNP
rs916956528 3328 dbSNP
rs945936626 3329 dbSNP
rs34786407 3330 dbSNP
rs1186276554 3331 dbSNP
rs977362113 3332 dbSNP
rs952851986 3336 dbSNP
rs575599167 3337 dbSNP
rs1376928518 3341 dbSNP
rs1455837449 3361 dbSNP
rs925756337 3362 dbSNP
rs185535579 3363 dbSNP
rs1302622231 3365 dbSNP
rs1361131369 3367 dbSNP
rs1157031972 3368 dbSNP
rs916769980 3372 dbSNP
rs1039761209 3379 dbSNP
rs899922323 3385 dbSNP
rs1180488094 3387 dbSNP
rs1421979424 3388 dbSNP
rs1255289946 3404 dbSNP
rs369500449 3405 dbSNP
rs73418756 3414 dbSNP
rs1405218406 3420 dbSNP
rs887143296 3432 dbSNP
rs189198164 3433 dbSNP
rs1353844864 3436 dbSNP
rs1052793109 3437 dbSNP
rs1241881495 3443 dbSNP
rs73418757 3447 dbSNP
rs1274208825 3458 dbSNP
rs545763102 3461 dbSNP
rs1396998029 3462 dbSNP
rs563975019 3470 dbSNP
rs776902545 3478 dbSNP
rs1296630351 3481 dbSNP
rs1361318834 3490 dbSNP
rs1160373657 3491 dbSNP
rs1049920859 3492 dbSNP
rs1034069550 3497 dbSNP
rs889630312 3508 dbSNP
rs1007982313 3511 dbSNP
rs1260724268 3512 dbSNP
rs1192546801 3513 dbSNP
rs1488405106 3527 dbSNP
rs1287623054 3535 dbSNP
rs1207565634 3539 dbSNP
rs1040849484 3541 dbSNP
rs1265404407 3541 dbSNP
rs34760108 3541 dbSNP
rs1284427403 3549 dbSNP
rs1246130395 3550 dbSNP
rs1327850847 3555 dbSNP
rs1357815919 3556 dbSNP
rs1276687856 3563 dbSNP
rs958696705 3574 dbSNP
rs1399706643 3578 dbSNP
rs897118814 3596 dbSNP
rs1014037401 3602 dbSNP
rs1320466443 3603 dbSNP
rs1385179638 3607 dbSNP
rs994028436 3607 dbSNP
rs1026973840 3608 dbSNP
rs1462928697 3612 dbSNP
rs952796624 3621 dbSNP
rs1470132427 3633 dbSNP
rs1012333211 3635 dbSNP
rs1243512177 3636 dbSNP
rs577459975 3636 dbSNP
rs1246649864 3645 dbSNP
rs1477286151 3647 dbSNP
rs78970701 3652 dbSNP
rs574362947 3653 dbSNP
rs765346186 3656 dbSNP
rs1211023724 3657 dbSNP
rs143564231 3658 dbSNP
rs77575621 3661 dbSNP
rs1296359 3676 dbSNP
rs771321779 3678 dbSNP
rs563779377 3679 dbSNP
rs767436039 3684 dbSNP
rs1272173980 3693 dbSNP
rs530951136 3694 dbSNP
rs1231293492 3698 dbSNP
rs1330645879 3709 dbSNP
rs552534447 3710 dbSNP
rs1322570273 3719 dbSNP
rs1443097430 3724 dbSNP
rs934062457 3731 dbSNP
rs181040068 3732 dbSNP
rs570715094 3739 dbSNP
rs1308774285 3745 dbSNP
rs1330536125 3760 dbSNP
rs1465975110 3774 dbSNP
rs975995650 3776 dbSNP
rs947003162 3781 dbSNP
rs1477486272 3783 dbSNP
rs756007172 3801 dbSNP
rs1194966153 3802 dbSNP
rs985235378 3804 dbSNP
rs528469926 3805 dbSNP
rs940046339 3809 dbSNP
rs1225997507 3811 dbSNP
rs1040882105 3817 dbSNP
rs1275525194 3819 dbSNP
rs1294770002 3822 dbSNP
rs1217747677 3826 dbSNP
rs1344572703 3832 dbSNP
rs1038562958 3840 dbSNP
rs546459928 3873 dbSNP
rs1374710712 3874 dbSNP
rs1785067 3880 dbSNP
rs1308498646 3881 dbSNP
rs1447400897 3883 dbSNP
rs1002339109 3888 dbSNP
rs929910335 3891 dbSNP
rs1413635580 3895 dbSNP
rs1048747858 3901 dbSNP
rs1175071842 3903 dbSNP
rs1437308772 3906 dbSNP
rs1450219373 3910 dbSNP
rs776698234 3914 dbSNP
rs1379115658 3923 dbSNP
rs1178617206 3928 dbSNP
rs1470790004 3939 dbSNP
rs878981314 3941 dbSNP
rs888460469 3950 dbSNP
rs1442147590 3955 dbSNP
rs1253122596 3958 dbSNP
rs147165549 3960 dbSNP
rs1180035020 3963 dbSNP
rs1420301209 3965 dbSNP
rs376963609 3967 dbSNP
rs1473288460 3969 dbSNP
rs1240866509 3976 dbSNP
rs1375444857 3979 dbSNP
rs535256665 3987 dbSNP
rs1282294910 3997 dbSNP
rs1447049341 3998 dbSNP
rs34310394 4007 dbSNP
rs552362543 4010 dbSNP
rs556906490 4011 dbSNP
rs754647181 4013 dbSNP
rs1417460991 4014 dbSNP
rs1359411444 4026 dbSNP
rs1043925 4039 dbSNP
rs906639195 4042 dbSNP
rs1329492916 4043 dbSNP
rs1180582439 4061 dbSNP
rs967006481 4070 dbSNP
rs1258627139 4074 dbSNP
rs998530068 4078 dbSNP
rs1032889425 4079 dbSNP
rs1487426559 4086 dbSNP
rs552016216 4101 dbSNP
rs1216601568 4106 dbSNP
rs140352705 4107 dbSNP
rs990322371 4110 dbSNP
rs1227646867 4114 dbSNP
rs1356852502 4115 dbSNP
rs115208761 4116 dbSNP
rs1397825713 4117 dbSNP
rs921084384 4123 dbSNP
rs1298367592 4126 dbSNP
rs955258190 4131 dbSNP
rs1243683041 4136 dbSNP
rs956835590 4143 dbSNP
rs986825860 4146 dbSNP
rs1354728502 4147 dbSNP
rs989733921 4148 dbSNP
rs908649428 4149 dbSNP
rs1275994158 4152 dbSNP
rs572705649 4153 dbSNP
rs1167553127 4157 dbSNP
rs1477010849 4158 dbSNP
rs1262764845 4167 dbSNP
rs1187294923 4173 dbSNP
rs939992385 4175 dbSNP
rs1245035240 4177 dbSNP
rs540255396 4190 dbSNP
rs1491209576 4192 dbSNP
rs1491224128 4193 dbSNP
rs919970779 4193 dbSNP
rs1216584963 4203 dbSNP
rs185010022 4212 dbSNP
rs1055401973 4213 dbSNP
rs1215938462 4219 dbSNP
rs1364947131 4225 dbSNP
rs1292427699 4230 dbSNP
rs1235903568 4233 dbSNP
rs772470412 4235 dbSNP
rs1476283220 4237 dbSNP
rs1328454658 4241 dbSNP
rs1464416857 4244 dbSNP
rs1423324411 4247 dbSNP
rs1171458181 4254 dbSNP
rs1430512068 4255 dbSNP
rs575237604 4259 dbSNP
rs1190691580 4266 dbSNP
rs910872219 4267 dbSNP
rs1168927621 4268 dbSNP
rs542436299 4274 dbSNP
rs1254840271 4279 dbSNP
rs1196634128 4281 dbSNP
rs1457192093 4284 dbSNP
rs867211529 4295 dbSNP
rs773699638 4302 dbSNP
rs902936655 4303 dbSNP
rs867882095 4304 dbSNP
rs568493768 4313 dbSNP
rs747465696 4315 dbSNP
rs892833389 4316 dbSNP
rs1234406989 4328 dbSNP
rs997149313 4328 dbSNP
rs563767761 4329 dbSNP
rs929775861 4334 dbSNP
rs190206761 4335 dbSNP
rs545929494 4344 dbSNP
rs986606264 4350 dbSNP
rs1299099187 4374 dbSNP
rs1463792586 4378 dbSNP
rs866966421 4379 dbSNP
rs1454788482 4381 dbSNP
rs1396944201 4388 dbSNP
rs961440521 4394 dbSNP
rs142065412 4395 dbSNP
rs1327774724 4397 dbSNP
rs906503527 4405 dbSNP
rs181090144 4410 dbSNP
rs764576891 4424 dbSNP
rs1341883552 4425 dbSNP
rs546625306 4428 dbSNP
rs1211113831 4429 dbSNP
rs1349488511 4430 dbSNP
rs1283250924 4431 dbSNP
rs1031053364 4436 dbSNP
rs1335693724 4438 dbSNP
rs892650897 4445 dbSNP
rs759789333 4451 dbSNP
rs991448081 4452 dbSNP
rs45579037 4468 dbSNP
rs1435557109 4473 dbSNP
rs548028439 4473 dbSNP
rs949492572 4476 dbSNP
rs529197746 4478 dbSNP
rs1419109656 4490 dbSNP
rs1364330322 4502 dbSNP
rs1042574968 4504 dbSNP
rs750111617 4504 dbSNP
rs1161146241 4507 dbSNP
rs1421874921 4532 dbSNP
rs1448888070 4534 dbSNP
rs1255194577 4539 dbSNP
rs986389564 4542 dbSNP
rs1018363133 4546 dbSNP
rs964972759 4547 dbSNP
rs1350707128 4549 dbSNP
rs1261859219 4562 dbSNP
rs1241765670 4563 dbSNP
rs550741678 4564 dbSNP
rs1320353065 4566 dbSNP
rs1293057533 4568 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.285 4.5e-3 0.243 1.3e-2 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.548 6.2e-3 0.672 5.9e-4 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.42 1.8e-2 0.450 1.2e-2 25 Click to see details
GSE38226 Liver fibrosis -0.456 1.9e-2 -0.464 1.7e-2 21 Click to see details
GSE27834 Pluripotent stem cells 0.515 2.1e-2 0.429 4.9e-2 16 Click to see details
GSE28260 Renal cortex and medulla -0.426 7.3e-2 -0.379 1.0e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.331 1.5e-1 0.385 1.1e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.244 1.5e-1 -0.221 1.7e-1 20 Click to see details
GSE14794 Lymphoblastoid cells 0.101 1.7e-1 0.114 1.4e-1 90 Click to see details
GSE17306 Multiple myeloma -0.109 2.3e-1 -0.090 2.7e-1 49 Click to see details
GSE21849 B cell lymphoma 0.144 2.3e-1 -0.152 2.2e-1 29 Click to see details
GSE17498 Multiple myeloma -0.118 2.3e-1 0.077 3.2e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells 0.13 2.8e-1 0.011 4.8e-1 23 Click to see details
GSE32688 Pancreatic cancer -0.104 2.9e-1 -0.124 2.5e-1 32 Click to see details
GSE19783 ER- ER- breast cancer 0.057 3.1e-1 -0.018 4.4e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.103 3.2e-1 0.125 2.8e-1 24 Click to see details
GSE19536 Breast cancer -0.048 3.2e-1 -0.094 1.8e-1 100 Click to see details
GSE28544 Breast cancer 0.084 3.5e-1 0.454 1.3e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.005 4.9e-1 -0.015 4.7e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.001 5.0e-1 -0.097 2.2e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.001 5.0e-1 -0.097 2.2e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.267 0.01 -0.302 0 84 Click to see details
KICH 0.391 0.03 0.388 0.03 25 Click to see details
BLCA -0.449 0.03 -0.408 0.05 18 Click to see details
STAD -0.332 0.03 -0.372 0.02 32 Click to see details
PAAD 0.894 0.05 0.800 0.1 4 Click to see details
HNSC -0.188 0.12 -0.143 0.18 42 Click to see details
ESCA -0.35 0.15 -0.591 0.03 11 Click to see details
CHOL -0.385 0.15 -0.367 0.17 9 Click to see details
PRAD -0.145 0.16 -0.067 0.32 50 Click to see details
THCA -0.13 0.16 -0.212 0.05 59 Click to see details
PCPG 0.858 0.17 0.500 0.33 3 Click to see details
LIHC 0.089 0.27 0.103 0.24 49 Click to see details
KIRP -0.088 0.32 -0.077 0.34 32 Click to see details
LUAD 0.118 0.36 0.000 0.5 12 Click to see details
UCEC 0.075 0.38 -0.042 0.43 19 Click to see details
CESC 0.334 0.39 0.500 0.33 3 Click to see details
KIRC 0.028 0.41 0.053 0.33 68 Click to see details
LUSC 0.036 0.42 0.019 0.45 38 Click to see details
COAD 0.089 0.42 -0.095 0.41 8 Click to see details
COAD 0.089 0.42 -0.095 0.41 8 Click to see details
COAD 0.089 0.42 -0.095 0.41 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1<