miRTarBase - #MIRT726812 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAB40B   
Synonyms RAR, SEC4L
Description RAB40B, member RAS oncogene family
Transcript NM_006822   
Expression
Putative miRNA Targets on RAB40B
3'UTR of RAB40B
(miRNA target sites are highlighted)
>RAB40B|NM_006822|3'UTR
   1 GGAAGGCACTGAAAGAAACACGGCGGAATCTCTCCAGGAGAAGCTCGGCGTTACCCCCGGCAGCTGGTGGATGCATCTCA
  81 GATCCCGGTTCCTCTCGGCGAATGCTGCTTGCGAATGTGTGCGACGCCTTCCGTGTGATGGAAACACACTACCCCGTCGG
 161 ACTTCGAATTTCTACGTGGATGTGCATGAAGCTCTTGTTTTCGATGTGTGTTTGTAAAGGGAAAATTAGTACTCTGCTCG
 241 ACTCTTGGTAACATGAAATTCTGAATGTTACTTTATCATGATTGCACTGCAACTTTTTCCTTAAAATAACTGCTTTTGTA
 321 AGAACGGTGATATTGGAGTGATTAGTATAAATTCAATGGAATTTGAGAAGCAATGGCAGCGGGATAATTTAGAGTCACTG
 401 ATATTACGAGAGGGGTCTTTTTGTAAACCTCCTTTTCAATGTCAAAGCGCCAATTTATAAAACGCTGCAGATGTAGAGGT
 481 TATGTGCAACTGATCTGTCCAGTTTGTGTATGAAATGGATTTGATAAAGTTTTTGCTAGTTATTTACTACATTTTGGGAT
 561 TAATAAGTGATTTATATGCATATTTTTCTGTAAATCTACAGTTTTTTGTACAAGATATTCTACAAGTTATGAAGCTAAGG
 641 GAAGAAAATGCCAAAGATACCTCTAGTTATGTTGAACACAGCCAGCACAGTTTCGACAGGTCAAGGAAGAGCTGTTTCAG
 721 TAAAGAATGAAGTGAAAACACTTATTTAGGAAAATGTTTCTCAACAATAAAATGTATAGTTGTTTCTCTCTTGGTAAAAA
 801 AAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' ttcctctcggcgaaTGCTGCTt 3'
89 - 110 140.00 -10.30
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            ||| ::|| |   |||||  
Target 5' gcCAATTTATAAAACGCTGCag 3'
449 - 470 108.00 -6.80
3
miRNA  3' guGUUUGG-UAAUACACGACGAu 5'
            ||:::| |  | | ||||:| 
Target 5' gaCAGGTCAAGGAAGAGCTGTTt 3'
695 - 717 108.00 -12.22
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN17077269 22 COSMIC
COSN26991325 25 COSMIC
COSN30188986 32 COSMIC
COSN26991328 46 COSMIC
COSN26991324 47 COSMIC
COSN13756534 49 COSMIC
COSN31509853 56 COSMIC
COSN28644381 96 COSMIC
COSN20063408 100 COSMIC
COSN30496294 119 COSMIC
COSN13756531 122 COSMIC
COSN13756530 126 COSMIC
COSN31524267 127 COSMIC
COSN30449490 128 COSMIC
COSN30538559 203 COSMIC
COSN31544600 463 COSMIC
COSN30529094 505 COSMIC
COSN31517807 606 COSMIC
COSN7457337 644 COSMIC
COSN24611852 694 COSMIC
COSN26482165 697 COSMIC
COSN31570513 709 COSMIC
COSN31561700 795 COSMIC
COSN7457336 1169 COSMIC
COSN7457335 1320 COSMIC
COSN21178345 1470 COSMIC
COSN25620245 1518 COSMIC
COSN23706490 2013 COSMIC
COSN17006188 2151 COSMIC
COSN17007204 2322 COSMIC
COSN21850363 2431 COSMIC
COSN2502342 2597 COSMIC
COSN22256137 2602 COSMIC
COSN5221745 2627 COSMIC
COSN29107507 2778 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs566119292 3 dbSNP
rs1384976473 7 dbSNP
rs770787173 10 dbSNP
rs760451932 11 dbSNP
rs761008455 18 dbSNP
rs776050585 19 dbSNP
rs3751912 21 dbSNP
rs772468950 21 dbSNP
rs201169084 22 dbSNP
rs1174192268 24 dbSNP
rs202229377 25 dbSNP
rs1351802636 26 dbSNP
rs747782623 27 dbSNP
rs1218279261 34 dbSNP
rs774190466 36 dbSNP
rs768245374 37 dbSNP
rs748833734 38 dbSNP
rs748764916 41 dbSNP
rs1485585491 44 dbSNP
rs374869472 46 dbSNP
rs373168157 47 dbSNP
rs565636323 48 dbSNP
rs761021034 49 dbSNP
rs752874827 50 dbSNP
rs1307776711 53 dbSNP
rs765475581 56 dbSNP
rs547100484 57 dbSNP
rs753877226 58 dbSNP
rs1456220492 59 dbSNP
rs766538636 59 dbSNP
rs760524386 63 dbSNP
rs202007349 67 dbSNP
rs767191577 76 dbSNP
rs961774970 84 dbSNP
rs1441656687 85 dbSNP
rs761720148 86 dbSNP
rs774102898 87 dbSNP
rs146244829 91 dbSNP
rs3751911 96 dbSNP
rs1184230466 97 dbSNP
rs1190660712 98 dbSNP
rs531940453 99 dbSNP
rs1257247030 100 dbSNP
rs1196811642 105 dbSNP
rs999995741 106 dbSNP
rs1482057022 111 dbSNP
rs769388917 112 dbSNP
rs188137213 113 dbSNP
rs778367753 118 dbSNP
rs916646186 121 dbSNP
rs3751910 122 dbSNP
rs546242698 123 dbSNP
rs111294198 125 dbSNP
rs755179029 126 dbSNP
rs1421767975 127 dbSNP
rs754155710 128 dbSNP
rs766337439 129 dbSNP
rs1398390658 132 dbSNP
rs756265057 133 dbSNP
rs750275932 135 dbSNP
rs767591042 136 dbSNP
rs1329273063 137 dbSNP
rs1035637407 138 dbSNP
rs1336399114 139 dbSNP
rs761630201 141 dbSNP
rs774297387 146 dbSNP
rs1417695166 147 dbSNP
rs1183184249 148 dbSNP
rs762667850 149 dbSNP
rs554086386 152 dbSNP
rs759119048 155 dbSNP
rs773525501 156 dbSNP
rs772582291 157 dbSNP
rs759500642 158 dbSNP
rs779243980 159 dbSNP
rs967618809 161 dbSNP
rs769047078 165 dbSNP
rs748733077 166 dbSNP
rs756104311 168 dbSNP
rs149376935 171 dbSNP
rs1446309837 174 dbSNP
rs1395580217 175 dbSNP
rs892925561 176 dbSNP
rs1459892006 178 dbSNP
rs781213834 181 dbSNP
rs1039408217 190 dbSNP
rs1236480736 194 dbSNP
rs1189714831 196 dbSNP
rs564658135 197 dbSNP
rs769388257 202 dbSNP
rs757259866 203 dbSNP
rs751591971 205 dbSNP
rs1251008384 206 dbSNP
rs371681301 208 dbSNP
rs1454982600 210 dbSNP
rs1253179159 211 dbSNP
rs1329636468 212 dbSNP
rs1195134461 214 dbSNP
rs373804585 217 dbSNP
rs763962077 218 dbSNP
rs780865135 219 dbSNP
rs890760954 219 dbSNP
rs762831280 220 dbSNP
rs1413133286 225 dbSNP
rs1315070524 236 dbSNP
rs1352824847 237 dbSNP
rs1258735782 238 dbSNP
rs1239077663 239 dbSNP
rs1371482383 240 dbSNP
rs1305845098 249 dbSNP
rs958334107 253 dbSNP
rs1276787598 258 dbSNP
rs1034098334 259 dbSNP
rs376257474 265 dbSNP
rs1338333458 266 dbSNP
rs185384001 267 dbSNP
rs757314831 271 dbSNP
rs1212547155 275 dbSNP
rs553036472 287 dbSNP
rs1257807262 297 dbSNP
rs1051302865 299 dbSNP
rs1191242792 304 dbSNP
rs1399497791 308 dbSNP
rs537341623 319 dbSNP
rs555239163 325 dbSNP
rs930206973 326 dbSNP
rs536976059 328 dbSNP
rs1010042819 338 dbSNP
rs552299972 346 dbSNP
rs117735422 349 dbSNP
rs1376297719 371 dbSNP
rs780993033 373 dbSNP
rs1316669394 375 dbSNP
rs1328633332 378 dbSNP
rs546095122 380 dbSNP
rs918761554 381 dbSNP
rs368284283 391 dbSNP
rs1424977275 392 dbSNP
rs1235888999 394 dbSNP
rs1280513658 395 dbSNP
rs944712625 397 dbSNP
rs1214072521 399 dbSNP
rs532504265 407 dbSNP
rs1447415569 408 dbSNP
rs941524587 431 dbSNP
rs1422126978 439 dbSNP
rs916691245 440 dbSNP
rs1472859077 445 dbSNP
rs1452586326 448 dbSNP
rs11105 449 dbSNP
rs930695043 451 dbSNP
rs1419327142 452 dbSNP
rs752306286 463 dbSNP
rs181184826 464 dbSNP
rs1258549115 466 dbSNP
rs1323425036 470 dbSNP
rs917499835 471 dbSNP
rs542554556 473 dbSNP
rs1303485834 478 dbSNP
rs993089047 479 dbSNP
rs1315777664 482 dbSNP
rs1280953490 490 dbSNP
rs1209027385 492 dbSNP
rs1277520568 508 dbSNP
rs1287574311 515 dbSNP
rs1233787587 528 dbSNP
rs1469758594 534 dbSNP
rs35919262 539 dbSNP
rs1214323701 542 dbSNP
rs76444460 547 dbSNP
rs967354410 548 dbSNP
rs1286015813 550 dbSNP
rs1446175567 551 dbSNP
rs1470676285 554 dbSNP
rs1163053217 561 dbSNP
rs1392812082 567 dbSNP
rs1020617852 568 dbSNP
rs990020712 572 dbSNP
rs978511504 576 dbSNP
rs968453622 579 dbSNP
rs1358804124 588 dbSNP
rs189489649 590 dbSNP
rs550476184 600 dbSNP
rs1467532331 608 dbSNP
rs1336727818 609 dbSNP
rs1006570129 611 dbSNP
rs900969523 614 dbSNP
rs890797376 618 dbSNP
rs1194152504 625 dbSNP
rs1029252709 630 dbSNP
rs868720000 635 dbSNP
rs766206437 653 dbSNP
rs1438595338 659 dbSNP
rs1187187710 666 dbSNP
rs889142918 667 dbSNP
rs1476419209 668 dbSNP
rs994232151 670 dbSNP
rs1459975427 677 dbSNP
rs1299373661 679 dbSNP
rs897447324 694 dbSNP
rs1039009276 695 dbSNP
rs7224226 699 dbSNP
rs1036416697 719 dbSNP
rs1415199466 724 dbSNP
rs1277405977 725 dbSNP
rs940891874 732 dbSNP
rs895287954 734 dbSNP
rs758156664 741 dbSNP
rs762385310 745 dbSNP
rs1180078532 755 dbSNP
rs1340197893 755 dbSNP
rs993511892 780 dbSNP
rs1456304552 781 dbSNP
rs374328212 796 dbSNP
rs937582298 802 dbSNP
rs765650659 804 dbSNP
rs1257163620 805 dbSNP
rs3794725 806 dbSNP
rs1173216434 807 dbSNP
rs913175793 808 dbSNP
rs978416763 809 dbSNP
rs1171314104 817 dbSNP
rs552496882 818 dbSNP
rs1415105562 822 dbSNP
rs1020460718 825 dbSNP
rs1383816952 829 dbSNP
rs1296268185 830 dbSNP
rs1327048329 847 dbSNP
rs965626899 847 dbSNP
rs988569979 847 dbSNP
rs1350310218 849 dbSNP
rs1211949986 855 dbSNP
rs1260475457 855 dbSNP
rs1485126936 856 dbSNP
rs747805895 858 dbSNP
rs568252146 861 dbSNP
rs185025217 862 dbSNP
rs1453195285 866 dbSNP
rs1191216825 868 dbSNP
rs985185473 878 dbSNP
rs760863252 881 dbSNP
rs542355471 885 dbSNP
rs1434940310 887 dbSNP
rs1157718376 888 dbSNP
rs1310307700 894 dbSNP
rs561110325 895 dbSNP
rs1029366613 908 dbSNP
rs1375209385 917 dbSNP
rs993873756 919 dbSNP
rs896802073 924 dbSNP
rs1306593362 925 dbSNP
rs1017201259 927 dbSNP
rs112183912 931 dbSNP
rs767853079 934 dbSNP
rs562576472 935 dbSNP
rs1380341561 936 dbSNP
rs1160132353 941 dbSNP
rs759399008 948 dbSNP
rs1237411012 957 dbSNP
rs1224743211 960 dbSNP
rs543280681 973 dbSNP
rs1489305692 981 dbSNP
rs1244931770 982 dbSNP
rs1036896276 987 dbSNP
rs192886667 988 dbSNP
rs1459782841 989 dbSNP
rs763509370 989 dbSNP
rs866809068 992 dbSNP
rs1042850968 993 dbSNP
rs189121962 997 dbSNP
rs927552664 998 dbSNP
rs1225739950 1004 dbSNP
rs539266009 1006 dbSNP
rs947087555 1009 dbSNP
rs1387728960 1018 dbSNP
rs1468507081 1024 dbSNP
rs1370124790 1029 dbSNP
rs866307972 1030 dbSNP
rs1230735259 1031 dbSNP
rs1481409009 1033 dbSNP
rs565921261 1040 dbSNP
rs935888667 1042 dbSNP
rs1416872536 1043 dbSNP
rs911132530 1048 dbSNP
rs965143729 1049 dbSNP
rs184529176 1055 dbSNP
rs1166963599 1064 dbSNP
rs1418495832 1067 dbSNP
rs1405965472 1070 dbSNP
rs192563357 1072 dbSNP
rs985308333 1080 dbSNP
rs1299490840 1081 dbSNP
rs1417245203 1084 dbSNP
rs955192105 1091 dbSNP
rs1026939035 1092 dbSNP
rs1295579142 1093 dbSNP
rs1336090937 1095 dbSNP
rs1379314829 1098 dbSNP
rs770750585 1099 dbSNP
rs1434719043 1111 dbSNP
rs922406528 1112 dbSNP
rs972867059 1117 dbSNP
rs1422763324 1124 dbSNP
rs963733784 1127 dbSNP
rs1014914813 1128 dbSNP
rs1484531458 1140 dbSNP
rs961090676 1143 dbSNP
rs553585972 1150 dbSNP
rs1016972390 1151 dbSNP
rs1005209984 1152 dbSNP
rs186560534 1158 dbSNP
rs1005264721 1168 dbSNP
rs895920320 1169 dbSNP
rs568048241 1170 dbSNP
rs1169421416 1174 dbSNP
rs532393038 1177 dbSNP
rs749286422 1180 dbSNP
rs1375074014 1183 dbSNP
rs1001667119 1189 dbSNP
rs1315174697 1192 dbSNP
rs549822560 1198 dbSNP
rs1043328415 1199 dbSNP
rs947645329 1211 dbSNP
rs776119225 1212 dbSNP
rs1003741655 1215 dbSNP
rs906668979 1218 dbSNP
rs538491358 1227 dbSNP
rs1280739096 1235 dbSNP
rs1446260038 1241 dbSNP
rs1314355201 1243 dbSNP
rs1299622800 1244 dbSNP
rs943676044 1247 dbSNP
rs796238176 1248 dbSNP
rs1189311200 1254 dbSNP
rs1042493747 1256 dbSNP
rs1394625670 1261 dbSNP
rs985172903 1274 dbSNP
rs1010025078 1275 dbSNP
rs1300522701 1292 dbSNP
rs1400525141 1298 dbSNP
rs893813142 1299 dbSNP
rs1316778116 1300 dbSNP
rs1397615651 1300 dbSNP
rs1347480573 1302 dbSNP
rs1383565771 1303 dbSNP
rs571063939 1309 dbSNP
rs35834449 1315 dbSNP
rs1302052323 1319 dbSNP
rs1054232430 1322 dbSNP
rs1368193489 1328 dbSNP
rs1236008069 1330 dbSNP
rs1303718841 1332 dbSNP
rs943373890 1333 dbSNP
rs1303109145 1335 dbSNP
rs1467241487 1346 dbSNP
rs911163523 1350 dbSNP
rs1049620975 1354 dbSNP
rs772608239 1355 dbSNP
rs974017835 1356 dbSNP
rs922406208 1367 dbSNP
rs561789790 1368 dbSNP
rs552871327 1369 dbSNP
rs961384390 1370 dbSNP
rs1378431760 1378 dbSNP
rs909629689 1379 dbSNP
rs1469898564 1382 dbSNP
rs1410698952 1383 dbSNP
rs1458196925 1385 dbSNP
rs1325879363 1389 dbSNP
rs1391586081 1393 dbSNP
rs527876973 1396 dbSNP
rs983811913 1399 dbSNP
rs959013041 1402 dbSNP
rs117233767 1403 dbSNP
rs906063207 1405 dbSNP
rs1021735236 1410 dbSNP
rs1467143522 1412 dbSNP
rs773054511 1415 dbSNP
rs892063547 1416 dbSNP
rs1003772707 1422 dbSNP
rs1179971091 1426 dbSNP
rs569980610 1427 dbSNP
rs1318973881 1428 dbSNP
rs943724579 1430 dbSNP
rs769298609 1445 dbSNP
rs1217303033 1450 dbSNP
rs369025134 1451 dbSNP
rs541431643 1452 dbSNP
rs562516109 1457 dbSNP
rs893924044 1463 dbSNP
rs1389301138 1468 dbSNP
rs774461941 1469 dbSNP
rs1350841176 1470 dbSNP
rs544204516 1483 dbSNP
rs1376528089 1486 dbSNP
rs1335606853 1488 dbSNP
rs1465969816 1497 dbSNP
rs919649230 1498 dbSNP
rs889088242 1506 dbSNP
rs1266072360 1509 dbSNP
rs575893188 1515 dbSNP
rs150610160 1519 dbSNP
rs780818361 1521 dbSNP
rs1277071492 1527 dbSNP
rs1483549763 1528 dbSNP
rs1187699738 1529 dbSNP
rs908464479 1530 dbSNP
rs992477963 1538 dbSNP
rs754685283 1545 dbSNP
rs1169219219 1546 dbSNP
rs1188336993 1546 dbSNP
rs1365686854 1550 dbSNP
rs746210467 1551 dbSNP
rs980184890 1553 dbSNP
rs970128466 1558 dbSNP
rs1294803804 1561 dbSNP
rs939850882 1563 dbSNP
rs909653119 1577 dbSNP
rs1225343690 1579 dbSNP
rs184223014 1585 dbSNP
rs983842963 1588 dbSNP
rs1343124871 1592 dbSNP
rs1183178921 1595 dbSNP
rs937677364 1596 dbSNP
rs1278593547 1617 dbSNP
rs1484455709 1620 dbSNP
rs926234649 1622 dbSNP
rs1011747295 1626 dbSNP
rs111276855 1628 dbSNP
rs982367349 1630 dbSNP
rs550064013 1637 dbSNP
rs1390319109 1654 dbSNP
rs572545853 1657 dbSNP
rs1171423562 1659 dbSNP
rs1021205656 1660 dbSNP
rs1031956052 1665 dbSNP
rs1466390492 1666 dbSNP
rs1008879217 1674 dbSNP
rs769355408 1675 dbSNP
rs890826040 1687 dbSNP
rs1339301216 1703 dbSNP
rs1366074979 1704 dbSNP
rs559099193 1708 dbSNP
rs757597177 1712 dbSNP
rs1319356082 1713 dbSNP
rs1032404711 1723 dbSNP
rs866329311 1724 dbSNP
rs1447029071 1725 dbSNP
rs1378907356 1726 dbSNP
rs932283781 1729 dbSNP
rs572128008 1732 dbSNP
rs1211164390 1738 dbSNP
rs898251207 1747 dbSNP
rs555997566 1748 dbSNP
rs1467659287 1749 dbSNP
rs1390535547 1750 dbSNP
rs1191321277 1761 dbSNP
rs1007575361 1764 dbSNP
rs939904997 1764 dbSNP
rs1158089415 1765 dbSNP
rs754325657 1766 dbSNP
rs1459537287 1770 dbSNP
rs569988975 1783 dbSNP
rs541915212 1784 dbSNP
rs201302225 1800 dbSNP
rs1163231575 1820 dbSNP
rs1030255693 1821 dbSNP
rs997519297 1832 dbSNP
rs1369983686 1833 dbSNP
rs111946258 1834 dbSNP
rs1177167294 1836 dbSNP
rs1315553762 1841 dbSNP
rs926513016 1845 dbSNP
rs1437554174 1846 dbSNP
rs76891339 1851 dbSNP
rs939862659 1852 dbSNP
rs192781482 1853 dbSNP
rs1488601475 1858 dbSNP
rs1176309700 1874 dbSNP
rs556766541 1875 dbSNP
rs1473468118 1876 dbSNP
rs1159726730 1881 dbSNP
rs769838413 1883 dbSNP
rs1355410014 1890 dbSNP
rs1306554122 1891 dbSNP
rs1459861847 1891 dbSNP
rs1238088244 1892 dbSNP
rs1331431011 1893 dbSNP
rs1437717852 1894 dbSNP
rs1351723770 1895 dbSNP
rs1437424760 1895 dbSNP
rs1384983894 1896 dbSNP
rs1297839184 1899 dbSNP
rs956270535 1907 dbSNP
rs1412074658 1908 dbSNP
rs866268362 1909 dbSNP
rs1032245971 1910 dbSNP
rs1491332013 1910 dbSNP
rs1420315356 1911 dbSNP
rs796882052 1911 dbSNP
rs1491428412 1912 dbSNP
rs1182613914 1913 dbSNP
rs1203320311 1913 dbSNP
rs1249266523 1913 dbSNP
rs1321849646 1913 dbSNP
rs1368965621 1913 dbSNP
rs1483880443 1913 dbSNP
rs200946319 1913 dbSNP
rs576562825 1913 dbSNP
rs66478872 1913 dbSNP
rs749212873 1913 dbSNP
rs767901689 1913 dbSNP
rs774938185 1913 dbSNP
rs369008504 1914 dbSNP
rs1309015507 1915 dbSNP
rs1156999489 1917 dbSNP
rs1286491058 1917 dbSNP
rs1375266040 1917 dbSNP
rs1379176792 1926 dbSNP
rs1048173631 1931 dbSNP
rs1378546455 1935 dbSNP
rs1201713602 1936 dbSNP
rs1450386528 1937 dbSNP
rs1189725928 1939 dbSNP
rs187936822 1941 dbSNP
rs955628933 1945 dbSNP
rs926351113 1950 dbSNP
rs1283476217 1959 dbSNP
rs981814842 1969 dbSNP
rs534542607 1970 dbSNP
rs996522413 1975 dbSNP
rs1345510923 1980 dbSNP
rs1388474746 1984 dbSNP
rs150184240 1990 dbSNP
rs914171287 1994 dbSNP
rs1169519214 1995 dbSNP
rs1375169481 2004 dbSNP
rs988384391 2005 dbSNP
rs1004351008 2006 dbSNP
rs1317917055 2008 dbSNP
rs566915631 2010 dbSNP
rs1056714111 2017 dbSNP
rs939163448 2025 dbSNP
rs926542478 2026 dbSNP
rs1316556168 2027 dbSNP
rs1220756096 2038 dbSNP
rs1279140363 2042 dbSNP
rs1446355963 2043 dbSNP
rs867733158 2045 dbSNP
rs548397089 2046 dbSNP
rs530089464 2053 dbSNP
rs953498467 2054 dbSNP
rs914553713 2055 dbSNP
rs1479626337 2061 dbSNP
rs990280804 2069 dbSNP
rs569019121 2070 dbSNP
rs1390147329 2074 dbSNP
rs1435187614 2077 dbSNP
rs997953122 2088 dbSNP
rs2306912 2095 dbSNP
rs1015944948 2101 dbSNP
rs1438257624 2102 dbSNP
rs1004092130 2108 dbSNP
rs1349751512 2109 dbSNP
rs532402471 2114 dbSNP
rs1269975797 2129 dbSNP
rs868304868 2132 dbSNP
rs767836607 2133 dbSNP
rs183442142 2136 dbSNP
rs1442638589 2144 dbSNP
rs545765797 2145 dbSNP
rs2306911 2151 dbSNP
rs766157988 2154 dbSNP
rs913547205 2155 dbSNP
rs1016998392 2167 dbSNP
rs1163582450 2174 dbSNP
rs1057423 2188 dbSNP
rs1053119564 2189 dbSNP
rs1057424 2192 dbSNP
rs762677767 2193 dbSNP
rs1406720125 2194 dbSNP
rs1220361316 2196 dbSNP
rs773136679 2198 dbSNP
rs1342508387 2200 dbSNP
rs1290043677 2202 dbSNP
rs1268482879 2203 dbSNP
rs560041107 2208 dbSNP
rs1232642078 2209 dbSNP
rs1003853289 2217 dbSNP
rs1341307963 2220 dbSNP
rs886876861 2225 dbSNP
rs925532163 2236 dbSNP
rs1468594920 2256 dbSNP
rs1211816620 2257 dbSNP
rs1290860465 2261 dbSNP
rs1437546947 2268 dbSNP
rs1180460807 2270 dbSNP
rs769789553 2271 dbSNP
rs953533852 2272 dbSNP
rs923370183 2273 dbSNP
rs1366153335 2274 dbSNP
rs1473512884 2277 dbSNP
rs1163411924 2284 dbSNP
rs976168666 2289 dbSNP
rs1309587777 2299 dbSNP
rs962355352 2309 dbSNP
rs1416854736 2310 dbSNP
rs747645268 2312 dbSNP
rs542054316 2320 dbSNP
rs1044999410 2321 dbSNP
rs744991 2322 dbSNP
rs1203332739 2352 dbSNP
rs1277190387 2355 dbSNP
rs915135842 2356 dbSNP
rs556287926 2387 dbSNP
rs1200346856 2390 dbSNP
rs952644504 2393 dbSNP
rs1181329408 2404 dbSNP
rs1424983797 2412 dbSNP
rs1460738512 2414 dbSNP
rs1238541548 2428 dbSNP
rs544351315 2430 dbSNP
rs576746922 2431 dbSNP
rs1002067423 2433 dbSNP
rs1305694837 2439 dbSNP
rs934641904 2443 dbSNP
rs905000510 2445 dbSNP
rs1272128288 2448 dbSNP
rs1300949196 2468 dbSNP
rs768269536 2485 dbSNP
rs550081582 2490 dbSNP
rs534197802 2494 dbSNP
rs567157832 2497 dbSNP
rs924698606 2505 dbSNP
rs1286213371 2513 dbSNP
rs533544445 2520 dbSNP
rs779598697 2521 dbSNP
rs1343235965 2524 dbSNP
rs59717571 2525 dbSNP
rs749615429 2526 dbSNP
rs1985249 2528 dbSNP
rs1050606659 2529 dbSNP
rs1353283331 2530 dbSNP
rs1170302754 2538 dbSNP
rs932169925 2542 dbSNP
rs1453477932 2548 dbSNP
rs1276009581 2551 dbSNP
rs1379196677 2553 dbSNP
rs1466469632 2560 dbSNP
rs550640936 2569 dbSNP
rs796707519 2570 dbSNP
rs371570390 2577 dbSNP
rs1161338187 2578 dbSNP
rs976578469 2580 dbSNP
rs1322743470 2582 dbSNP
rs962184371 2587 dbSNP
rs531350574 2588 dbSNP
rs1386462293 2594 dbSNP
rs984831081 2595 dbSNP
rs952014932 2601 dbSNP
rs1026917753 2611 dbSNP
rs1314332170 2616 dbSNP
rs1035214007 2638 dbSNP
rs1268052186 2639 dbSNP
rs1479505862 2640 dbSNP
rs1210039089 2641 dbSNP
rs1248176324 2642 dbSNP
rs1232261818 2648 dbSNP
rs571517915 2652 dbSNP
rs781460458 2653 dbSNP
rs1003243025 2654 dbSNP
rs1452302057 2656 dbSNP
rs1458811599 2660 dbSNP
rs1161459987 2661 dbSNP
rs576926603 2668 dbSNP
rs527550092 2669 dbSNP
rs560462863 2670 dbSNP
rs1010672778 2677 dbSNP
rs2011631 2678 dbSNP
rs1013830292 2679 dbSNP
rs1349168251 2689 dbSNP
rs751754802 2690 dbSNP
rs1268187635 2693 dbSNP
rs1310189739 2696 dbSNP
rs1052331169 2698 dbSNP
rs1242797744 2700 dbSNP
rs529890246 2702 dbSNP
rs1488652262 2707 dbSNP
rs1397653757 2714 dbSNP
rs1204162363 2719 dbSNP
rs56348712 2719 dbSNP
rs1298147363 2720 dbSNP
rs1182837620 2725 dbSNP
rs371749878 2725 dbSNP
rs1408757015 2742 dbSNP
rs1437783216 2744 dbSNP
rs1052596398 2745 dbSNP
rs1351176847 2746 dbSNP
rs1458662877 2748 dbSNP
rs1300744810 2752 dbSNP
rs1423386942 2756 dbSNP
rs1000500231 2757 dbSNP
rs1051205967 2758 dbSNP
rs903504705 2762 dbSNP
rs1050639296 2763 dbSNP
rs1314325754 2768 dbSNP
rs932201479 2780 dbSNP
rs766523851 2784 dbSNP
rs975596386 2785 dbSNP
rs543937243 2786 dbSNP
rs1417121317 2790 dbSNP
rs902083450 2795 dbSNP
rs1272151824 2797 dbSNP
rs1040584492 2805 dbSNP
rs940834606 2806 dbSNP
rs1236848979 2811 dbSNP
rs762803624 2812 dbSNP
rs1406948312 2815 dbSNP
rs1191756227 2819 dbSNP
rs147104848 2822 dbSNP
rs907983245 2823 dbSNP
rs985253469 2824 dbSNP
rs1238670981 2831 dbSNP
rs141867486 2833 dbSNP
rs1266604457 2843 dbSNP
rs1359083463 2849 dbSNP
rs983044561 2858 dbSNP
rs540234304 2860 dbSNP
rs930651078 2862 dbSNP
rs1034628157 2863 dbSNP
rs927241820 2867 dbSNP
rs1227160825 2869 dbSNP
rs1294952186 2869 dbSNP
rs1343968807 2873 dbSNP
rs1228846340 2884 dbSNP
rs980692732 2886 dbSNP
rs753292137 2887 dbSNP
rs750243274 2891 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.437 1.9e-2 0.443 1.7e-2 23 Click to see details
GSE38226 Liver fibrosis 0.421 2.9e-2 0.285 1.1e-1 21 Click to see details
GSE17306 Multiple myeloma -0.213 7.1e-2 -0.219 6.5e-2 49 Click to see details
GSE21032 Prostate cancer -0.162 7.2e-2 -0.167 6.6e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.3 9.9e-2 -0.192 2.1e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.248 1.2e-1 0.145 2.4e-1 25 Click to see details
GSE19783 ER- ER- breast cancer -0.113 1.6e-1 -0.071 2.7e-1 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.231 1.6e-1 -0.352 6.4e-2 20 Click to see details
GSE32688 Pancreatic cancer -0.174 1.7e-1 -0.290 5.4e-2 32 Click to see details
GSE19350 CNS germ cell tumors -0.258 2.1e-1 -0.028 4.7e-1 12 Click to see details
GSE19536 Breast cancer -0.081 2.1e-1 -0.020 4.2e-1 100 Click to see details
GSE28544 Breast cancer 0.157 2.3e-1 0.456 1.3e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.126 2.7e-1 -0.061 3.9e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.121 3.3e-1 -0.141 3.0e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.051 4.1e-1 -0.023 4.6e-1 24 Click to see details
GSE17498 Multiple myeloma 0.034 4.2e-1 0.139 2.0e-1 40 Click to see details
GSE21687 Ependynoma primary tumors -0.017 4.5e-1 0.012 4.6e-1 64 Click to see details
GSE14794 Lymphoblastoid cells 0.012 4.6e-1 -0.009 4.7e-1 90 Click to see details
GSE28260 Renal cortex and medulla -0.013 4.8e-1 0.005 4.9e-1 13 Click to see details
GSE21849 B cell lymphoma -0.001 5.0e-1 0.436 9.0e-3 29 Click to see details
GSE21849 B cell lymphoma -0.001 5.0e-1 0.436 9.0e-3 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.316 0.01 -0.281 0.02 50 Click to see details
PAAD -0.89 0.05 -1.000 0.5 4 Click to see details
CESC -0.985 0.06 -1.000 0.5 3 Click to see details
KIRC -0.169 0.08 -0.104 0.2 68 Click to see details
HNSC -0.208 0.09 -0.191 0.11 42 Click to see details
KIRP 0.207 0.13 0.338 0.03 32 Click to see details
LUSC 0.179 0.14 0.204 0.11 38 Click to see details
THCA -0.141 0.14 -0.106 0.21 59 Click to see details
COAD 0.419 0.15 0.595 0.06 8 Click to see details
PCPG -0.882 0.16 -0.500 0.33 3 Click to see details
LUAD -0.281 0.19 -0.189 0.28 12 Click to see details
BRCA -0.095 0.2 -0.114 0.15 84 Click to see details
UCEC -0.166 0.25 -0.358 0.07 19 Click to see details
CHOL 0.256 0.25 0.317 0.2 9 Click to see details
LIHC -0.089 0.27 0.012 0.47 49 Click to see details
KICH 0.072 0.37 0.168 0.21 25 Click to see details
BLCA -0.041 0.44 -0.096 0.35 18 Click to see details
STAD 0.025 0.45 0.041 0.41 32 Click to see details
ESCA -0.002 0.5 -0.064 0.43 11 Click to see details
ESCA -0.002 0.5 -0.064 0.43 11 Click to see details
ESCA -0.002 0.5 -0.064 0.43 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*