miRTarBase - #MIRT727377 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TECPR2   
Synonyms KIAA0329, SPG49
Description tectonin beta-propeller repeat containing 2
Transcript NM_014844   
Other Transcripts NM_001172631   
Expression
Putative miRNA Targets on TECPR2
3'UTR of TECPR2
(miRNA target sites are highlighted)
>TECPR2|NM_014844|3'UTR
   1 AGGAGCCCTGGCCGAGTCACGCGGAGGGGCCCGGCGTCTGTGGCGGGCACAGGGGCTTCAGAGTGACTCCCTGGTGGACG
  81 CGCTGCCTCAACACTTGTCCAGACACCTCTGGCCAGGTTGGACCCGCACACTTACTTTCATCTATGTTGGTTTCTGTCTC
 161 GTTCCAGAACCCACAGCCTCCACCCGTGGCTGGCGTGATTGCTGCAGCAGTGGCGCCTCCTAGCTCAGGACAGTGGCGAC
 241 TGCCCGGCTGCATGCACTCCGATTACCCACGTGCTGCCGTCCTGGTCTCATCCACAGATAGCTCCAGCTTTTGTTGGTGG
 321 GAGTGGTCTCCGGAGGCCTCCCAGAACCAAGGGTAGCCGGGCAGCTGGTTTGGCCCAGGGCCTCCTTCCACATTAGTAGC
 401 CCCAGGGCCAGATGGAGCCAAAGGTCAGCTCTCTGCAGCGCGGGATGTGCTCGGTGATGGCTTTGTCCCATCATAGGGGG
 481 GTGTCCCCCCAGAGACAAAGCTGCAGAGCACATTCCATGCCAGACGCTCTGGCCAGGAAGCTGAGGCCGGGCTTGAGAGG
 561 AGAGCGCTGGCCATGCCAGGAGAGAACCCACGCACATGCACACCACAACACACAACACACCTCACCTCACACCACAGCAC
 641 ACCTCACCACACCACACCGCACTGCACCATACCTCACCACATCTCACCACACCACAGCACACCTCACCACACAACACACC
 721 ACACCCCACACCGCACTGCACCGCACCGCACCGCACCGTACCTCGCCACATCTCACCACACCACACCACACCACACCTCA
 801 CTGCCCACACACGGCGCAGGCTGCCCGCCTCCTGGAGAGCACACTTCAGCTGAAACAGTAAAGCCTGATGGGTGCAAATG
 881 GAACCTGGATGTGTGCACGTGTGTCCCAGGTAGGGACGGCACAGGAGGGTGCATGGGGCGTGGGGGAGCTGAGCAAGGGT
 961 CGCTCACTTAGAAATGTCTTTGGAATGGTGTTTAACTAATGCTGCTGGCGGACATCCTAAAACCAGATGCATCCTCAGAG
1041 GACGAGTCTACTAATTATTGCCTTTGTTGTTGTATTACAAATCTGCATAAAATACCTCATTTCAAATCAAATCTTACAAA
1121 TTTAGAAGAGAGATATGTTTTCCGAAAACAGTGGAAGCCCTTTGTTCCTTCCCGGGTTTGTCCTGAGCCTGCACTGTCCT
1201 CGCCTGCAGCCTCAGAGGGGCAGGCATCCCCGCACAGACTTGACTGGCAGGGCGGTCACGGGACCTGCGGGCTGGCTCCG
1281 AGTGGCAGCCCATGCCTTCTGCGGGGTATGGGTTGACACTTGACAGGTTGAAACCAGTGCCTCTATGGACGGCTGCTGTG
1361 GCCCCTTCAGACAATGGGCAGTGCCCACCCCGCCCACTGGCATCTGCGTGTGAGGGCTAGGCCGCCCTGCCACACATCCC
1441 GCCCCCTCCCGGAGGCAGCTTCAGGACAGGACACCAGGCTGGCTGCTTTTTTTAGCCTGCCCCTGGCCCAGGCCCAGTCC
1521 TTGGTGTCAGGGAGCCCCCAGGCCGCAGGTGGAGGGTGATAAAATATGTTCTCTGACAGGACCCAGCCAGCCACATAGGT
1601 GGAGGTTTTCCATGTCCAAATGAGGTCAAGATGCCGAAATCCCAGATCTGACTTCACACTTCCCTTTTCTAGAACCTTTT
1681 GTAAAAGTTGGTGGCAGCAGAGGCAGCCCCAGGCCGGGCTGCATCTCTCTGTGTCTGTTGTGCCTTGCCCGGCGCCTCAC
1761 GGATGGCAAAGCTCTCCTCACCCATGGGACTGTAGTGCAATTAAACCCGCGTCTAGGTGATGCTTTTAAAGTTGTAGCTT
1841 CGTGCTTTGTACAGTTTTCTTTCTGGTTTTAATTTTTAGTTGTGCTTTGAGTCAGTGCAATAAACTAGACTTTTTCCAAA
1921 CCTGGCCGAGTGTGGTGCCTGAGCTGTGAGAAGTGTCCTCAGCCGACACTCACGAGGGCAGTGCAAGGGAGAACCTGCCA
2001 GCCCAGCCCCACCACAGGGAGAGTGCGTCAGCAGACCTGTCCTGGCCTGGCTGGTGTTGAAATACACACCGGTTTGCCCA
2081 AGTGGCTGTTATGGGGGAATGGCCGCTCCAGAGCTGGCTGTACCCCATGGTAGCCTCTGAGGAGGACGCTGTGGGGTGAG
2161 GTCCAGGGCTGCCTCCTCATGGAGCTGTGTGTGAGCAGGCGTTGGAGGGGTTCGAGCCCCTGGTTCTGTATCTTCAGCCA
2241 GCAAACGAAACCATATCGCAAACCAGAGCTGCTGGAAACCAGCACACGCAAAAGATGACGCCCAGCACAGCAGCAGGACA
2321 CACCATGTGCCAGGAAATGACCTCAGCAAGAAACCTCAGGCCGTGTGAAGAGCAGCAAAGCTTTCCAGAAGGCATAAAAG
2401 GAAACTTGAATAAAGGAAGATATGTTCCACATTCCTGGATGGAGGACTACACACATTATGGAAAGACCTCATTCTTTCCA
2481 AAGGAATTTATAGGTGTAGCTTGATTTCAGTTCAAATCCCCACTGGGATTGTTTTGTTGGGGCAGGCAGGGAGGAATAAT
2561 GTTAGTACCCACAAATGCCCATGACTGTGCCCAATGTGCTTCTCACCAGAGCCCTGCAAGGGGAAGTCTCATTAGCCCCT
2641 TGAGACTCAGAGAGGTTAGGTAACTTGCTCAAGGTCACACAGCACTGGGACTGGAAGCCAGCTCTGTAGAACTGCAGACC
2721 TGTGCTGTTTGATGCCTCCTCACTGTCCCGTCACTCCTGGGAAGAAGAAACGGGTGAGAACTGCTAAGTGATGACAGGTG
2801 GAGCCCCAGCAGGGGCCACTCTATTGAATGGCATGGCCCAGACCCTCGGAGGGCCAGGCAACAGGCTAGCAAGGCCCACA
2881 GGGAGGGAGCAGAATGGAGAGGGCATCTCAGATGCGCTTAAGGAGCGGCGGGGGCGGGGCATGGGGGGTGTCACAACTAA
2961 TGTGGCCACTGCTTCATTCTCTGGGCAAAATAATATTAAATGGATTAAAGAATCTAAAACCAGTGGGAAAACTGTCTGAT
3041 TTCTGGATGGCAAAGGCTTTCTAAACTCAAAAGTGATAGGACAAGCTACAGAGGAAAATAAGTACATAGATTTGATTTCT
3121 CCAAAATACAGAAATGCTGCTGGGCACAGTGATGTGCAGTTATAGTCCCAGCTACTTGGGAGGCCAAGGCAGGAGGATTA
3201 CTTGAGCCCAGGAGTTTGAGGCTGCAATGAACTATGATCACACCACTGCACTCCAGCCTCGGCGACAGAGCAAGACCTTG
3281 TTTCTCAAAAATAAATAAATAGAAGGAAATAAATGTAAAAATGCTGCAAATTAAAAACCTCAAAGAAGGGAAATAATTGC
3361 AACAAATGGGAATTGATGTTGAATATTTACCTTAAAAACCTATACAACAATAAGAGGAGTGCGCCCTTCAGCAGCATGTA
3441 TACAAAAATTGCAACGATACAGAGATTAGCATGGCCCCTGCACAAGGATGACTCGCAAATTCATAAAGCTTTCCATAAAT
3521 ATATTTATTAAAAACCAATAGGAGGAGCACTTCGAGTCGAGTGTAAGGGCCCTTCACAAAAGCAGAAGGAACACTGGCCC
3601 AAACCCCCAGCACCCCGGAAGCAGAGGTGAGATGGGAGCAGCTTGGGAGCCCCCCATTGGCGCCGCCCTACTGGGGAAGC
3681 CGGTCCGTACGTAGGCCTTGCATCTCGCCACCTCCACTTCTGTCCTCAAGAACAAGTCCTAGGTCAAGGGAAACAGCACA
3761 GCCTGTTTATAATTAGGAAACACTTAAAACAGCCTGGCATTTGGGAACAGCCATGTTAACGTGAGCAAATTCCTCTCATG
3841 AAATAGCCTGCAGCTATTAAGAAGCACGTGTGTGCAGGAAGCGGAGGCGCAGGACCTCACCGCGCCAGCGTGAAGTTCCC
3921 GGGCATGGTCATGAAAGCGTGGTTCTGTAAGAAATCAGAGGGAGAAAGGGAGAGAAGGGGGAGGGAGACAACCCAAACGT
4001 TGGAGGGTATTTGTTGTAAACTTCAAACTTTTGGCAGGTTTGAAATTTTTCATAACTCCGGGGAGGAGCAAGAGGGGTGA
4081 AAAGAAACAAGTTCTCTACTTGTGATCAGCAGCTGGTCATAGTGGTTGCCTGGAGTATATGCCTTTTTGTATCCTTTGAA
4161 TTTCCAGCCATGTAAATGTATTATTTATTCCAAAAATAAAGCAGATTTACATTTTAAAAATTCAAAAAAAAAAAAAAAAA
4241 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU-AAUACACGACGAu 5'
            |||| :|   |  ||||||| 
Target 5' tcCAAAATACAGAAATGCTGCTg 3'
3120 - 3142 148.00 -12.40
2
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              |||:|  |  ||||||| 
Target 5' gtttAACTA--A--TGCTGCTg 3'
990 - 1007 146.00 -10.70
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:|||    |||||||:| 
Target 5' tgCAGACC----TGTGCTGTTt 3'
2713 - 2730 146.00 -18.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
991467 8 ClinVar
1191554 37 ClinVar
1180589 61 ClinVar
COSN30522305 6 COSMIC
COSN15664623 22 COSMIC
COSN20078143 45 COSMIC
COSN30168678 54 COSMIC
COSN26441365 60 COSMIC
COSN31521501 130 COSMIC
COSN26605049 337 COSMIC
COSN28675285 454 COSMIC
COSN20063336 482 COSMIC
COSN13571994 527 COSMIC
COSN31550959 528 COSMIC
COSN26677184 541 COSMIC
COSN19727122 566 COSMIC
COSN30602095 639 COSMIC
COSN5746158 667 COSMIC
COSN30576458 720 COSMIC
COSN15025959 753 COSMIC
COSN504923 794 COSMIC
COSN7429199 801 COSMIC
COSN32058684 840 COSMIC
COSN30541533 864 COSMIC
COSN19498351 891 COSMIC
COSN1164462 907 COSMIC
COSN30648458 909 COSMIC
COSN26562846 910 COSMIC
COSN31522066 925 COSMIC
COSN24294723 941 COSMIC
COSN30752958 995 COSMIC
COSN31531785 1011 COSMIC
COSN31555034 1030 COSMIC
COSN31569982 1066 COSMIC
COSN31528176 1123 COSMIC
COSN8822042 1160 COSMIC
COSN30541727 1186 COSMIC
COSN9609926 1314 COSMIC
COSN6241360 1644 COSMIC
COSN26635725 1695 COSMIC
COSN26465133 1711 COSMIC
COSN31638747 2106 COSMIC
COSN20666236 2288 COSMIC
COSN8822043 2817 COSMIC
COSN25913783 3067 COSMIC
COSN29733215 3150 COSMIC
COSN31592125 3509 COSMIC
COSN20774292 3658 COSMIC
COSN28702812 3989 COSMIC
COSN29866174 3994 COSMIC
COSN31576905 4038 COSMIC
COSN28793010 4060 COSMIC
COSN26678553 4103 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748466344 5 dbSNP
rs772168943 7 dbSNP
rs778208284 8 dbSNP
rs1269228186 10 dbSNP
rs1339712261 12 dbSNP
rs747306978 14 dbSNP
rs377705487 15 dbSNP
rs1467640611 20 dbSNP
rs777228559 21 dbSNP
rs368107040 22 dbSNP
rs199611656 23 dbSNP
rs371538349 24 dbSNP
rs200883283 33 dbSNP
rs1478896966 34 dbSNP
rs1472802927 35 dbSNP
rs1163092266 36 dbSNP
rs138500705 37 dbSNP
rs1462046567 39 dbSNP
rs188678923 41 dbSNP
rs1383524799 43 dbSNP
rs1381982011 44 dbSNP
rs763587732 45 dbSNP
rs544219399 46 dbSNP
rs761550968 47 dbSNP
rs1291067971 50 dbSNP
rs768604045 51 dbSNP
rs1214150578 52 dbSNP
rs767281885 53 dbSNP
rs1267110680 54 dbSNP
rs746276098 55 dbSNP
rs1228109580 60 dbSNP
rs2403058 61 dbSNP
rs1394773845 67 dbSNP
rs1337425620 69 dbSNP
rs1379106138 69 dbSNP
rs1454653239 71 dbSNP
rs1386654201 74 dbSNP
rs907079676 80 dbSNP
rs1044022340 81 dbSNP
rs867789795 82 dbSNP
rs143901912 83 dbSNP
rs3742436 87 dbSNP
rs1414490687 95 dbSNP
rs147264281 105 dbSNP
rs1039822010 106 dbSNP
rs559435342 110 dbSNP
rs899579856 112 dbSNP
rs1298228925 118 dbSNP
rs1262810136 119 dbSNP
rs1243104998 122 dbSNP
rs1321573170 125 dbSNP
rs539080914 126 dbSNP
rs528632770 127 dbSNP
rs1364456314 131 dbSNP
rs1029316810 145 dbSNP
rs148747529 146 dbSNP
rs1280494005 151 dbSNP
rs142249090 155 dbSNP
rs1382970388 157 dbSNP
rs1387445556 161 dbSNP
rs1004061581 162 dbSNP
rs1031964487 167 dbSNP
rs1457225897 170 dbSNP
rs1016819471 177 dbSNP
rs1165383165 186 dbSNP
rs150837322 187 dbSNP
rs980573717 195 dbSNP
rs914299420 196 dbSNP
rs1193303486 212 dbSNP
rs1429880244 214 dbSNP
rs757979261 215 dbSNP
rs1465840277 216 dbSNP
rs1488350711 238 dbSNP
rs551038659 239 dbSNP
rs979895934 243 dbSNP
rs1225330908 245 dbSNP
rs928449042 246 dbSNP
rs1033968644 247 dbSNP
rs960813398 250 dbSNP
rs992677372 252 dbSNP
rs1328359971 253 dbSNP
rs567207024 254 dbSNP
rs879312039 261 dbSNP
rs945375547 262 dbSNP
rs898972255 266 dbSNP
rs979648752 270 dbSNP
rs1174521230 271 dbSNP
rs925528542 272 dbSNP
rs1038353008 277 dbSNP
rs1391186895 278 dbSNP
rs1463081165 279 dbSNP
rs898548326 280 dbSNP
rs1319981142 286 dbSNP
rs996895955 291 dbSNP
rs1480581686 292 dbSNP
rs1270023734 295 dbSNP
rs780767512 303 dbSNP
rs1202073507 304 dbSNP
rs529666830 314 dbSNP
rs1344479185 322 dbSNP
rs1428585330 328 dbSNP
rs1028400239 331 dbSNP
rs943641869 333 dbSNP
rs891289018 340 dbSNP
rs1008421987 341 dbSNP
rs1346407586 351 dbSNP
rs1284913728 354 dbSNP
rs546687197 359 dbSNP
rs1039195189 360 dbSNP
rs1280956283 361 dbSNP
rs1330853389 380 dbSNP
rs566597059 384 dbSNP
rs139195321 385 dbSNP
rs374214628 392 dbSNP
rs549700585 395 dbSNP
rs755437449 403 dbSNP
rs866079287 414 dbSNP
rs1247853285 417 dbSNP
rs1003842138 424 dbSNP
rs1038208898 425 dbSNP
rs1197800395 430 dbSNP
rs1414380135 439 dbSNP
rs898412871 440 dbSNP
rs181457518 441 dbSNP
rs538095555 442 dbSNP
rs867884467 443 dbSNP
rs1158462949 444 dbSNP
rs186147419 453 dbSNP
rs3742437 454 dbSNP
rs748336497 455 dbSNP
rs542633409 467 dbSNP
rs1021467934 473 dbSNP
rs966661447 478 dbSNP
rs979426064 480 dbSNP
rs1301068204 482 dbSNP
rs1456443165 482 dbSNP
rs925309297 488 dbSNP
rs769996875 493 dbSNP
rs777716094 498 dbSNP
rs1471417834 503 dbSNP
rs1351886755 508 dbSNP
rs1367235464 512 dbSNP
rs1182996127 514 dbSNP
rs1228649489 515 dbSNP
rs144167649 519 dbSNP
rs572985053 526 dbSNP
rs556217894 527 dbSNP
rs1284635933 528 dbSNP
rs1225288861 548 dbSNP
rs1050832246 549 dbSNP
rs908300522 550 dbSNP
rs1246701031 559 dbSNP
rs1348512293 560 dbSNP
rs879324072 561 dbSNP
rs1204502485 566 dbSNP
rs1262118126 567 dbSNP
rs775453416 568 dbSNP
rs1345448613 575 dbSNP
rs1319311593 576 dbSNP
rs1402816864 577 dbSNP
rs1186007120 580 dbSNP
rs1486315044 584 dbSNP
rs1257153695 587 dbSNP
rs1445808968 588 dbSNP
rs939810877 591 dbSNP
rs750403022 592 dbSNP
rs760573958 593 dbSNP
rs1362546589 598 dbSNP
rs768367236 600 dbSNP
rs1217608492 601 dbSNP
rs757408216 604 dbSNP
rs898194944 604 dbSNP
rs545138123 608 dbSNP
rs1453876557 610 dbSNP
rs1159653504 611 dbSNP
rs565136080 615 dbSNP
rs747938718 616 dbSNP
rs1223101023 618 dbSNP
rs1433311622 619 dbSNP
rs1361568032 620 dbSNP
rs1008786030 623 dbSNP
rs1310690265 626 dbSNP
rs1213479814 627 dbSNP
rs1354469512 641 dbSNP
rs769582571 645 dbSNP
rs781534763 645 dbSNP
rs1396083115 650 dbSNP
rs1314184795 655 dbSNP
rs1329679951 656 dbSNP
rs1333509666 657 dbSNP
rs761378068 659 dbSNP
rs531016319 660 dbSNP
rs1418456173 665 dbSNP
rs779105289 667 dbSNP
rs1013842103 673 dbSNP
rs1286668824 673 dbSNP
rs892016764 674 dbSNP
rs1188504903 675 dbSNP
rs541081833 675 dbSNP
rs1355569199 684 dbSNP
rs1021923429 688 dbSNP
rs1199914145 689 dbSNP
rs1208548460 700 dbSNP
rs1020838437 702 dbSNP
rs1486151120 705 dbSNP
rs1183843782 709 dbSNP
rs1290273509 710 dbSNP
rs1248463387 713 dbSNP
rs1418589269 715 dbSNP
rs966777722 717 dbSNP
rs1307557494 722 dbSNP
rs544850016 723 dbSNP
rs184020793 726 dbSNP
rs1217091871 729 dbSNP
rs1322427097 733 dbSNP
rs1452923374 734 dbSNP
rs765008052 737 dbSNP
rs1032326640 738 dbSNP
rs563322831 738 dbSNP
rs762581989 738 dbSNP
rs773891584 738 dbSNP
rs1172688311 742 dbSNP
rs561441788 743 dbSNP
rs1035819837 744 dbSNP
rs964724314 745 dbSNP
rs1466195252 746 dbSNP
rs983652248 746 dbSNP
rs1304231395 748 dbSNP
rs758647505 749 dbSNP
rs1390374999 751 dbSNP
rs74513122 753 dbSNP
rs954861956 754 dbSNP
rs1373055811 755 dbSNP
rs747400739 756 dbSNP
rs762604589 758 dbSNP
rs139904968 759 dbSNP
rs1212433586 765 dbSNP
rs555644465 766 dbSNP
rs973815959 768 dbSNP
rs1480345244 769 dbSNP
rs746436330 770 dbSNP
rs1240545330 771 dbSNP
rs1453063674 773 dbSNP
rs10531276 774 dbSNP
rs1223696847 774 dbSNP
rs1374730200 774 dbSNP
rs770143642 777 dbSNP
rs1395999612 779 dbSNP
rs1435291313 784 dbSNP
rs1177777003 786 dbSNP
rs1450556227 787 dbSNP
rs1337627837 791 dbSNP
rs537581650 791 dbSNP
rs1471099625 793 dbSNP
rs867736045 797 dbSNP
rs753119784 806 dbSNP
rs1158130650 807 dbSNP
rs1461018062 808 dbSNP
rs775070913 813 dbSNP
rs143395588 814 dbSNP
rs532240191 816 dbSNP
rs1325149450 817 dbSNP
rs1243292166 826 dbSNP
rs768381115 827 dbSNP
rs774043162 828 dbSNP
rs1293656763 833 dbSNP
rs1307182214 838 dbSNP
rs1219502134 840 dbSNP
rs386780892 840 dbSNP
rs145492109 841 dbSNP
rs386780893 841 dbSNP
rs3783381 842 dbSNP
rs66715502 843 dbSNP
rs3783382 844 dbSNP
rs554820246 845 dbSNP
rs760672666 848 dbSNP
rs1244501196 853 dbSNP
rs1489669524 864 dbSNP
rs1382084014 865 dbSNP
rs766159535 868 dbSNP
rs1315880573 870 dbSNP
rs949364423 871 dbSNP
rs1427509064 873 dbSNP
rs1170991324 875 dbSNP
rs1383114810 882 dbSNP
rs1425070967 886 dbSNP
rs752849808 890 dbSNP
rs1288001294 892 dbSNP
rs1454133851 893 dbSNP
rs758359980 896 dbSNP
rs1350436906 899 dbSNP
rs1042232946 900 dbSNP
rs1286850416 902 dbSNP
rs1361050047 909 dbSNP
rs902372010 910 dbSNP
rs190911716 913 dbSNP
rs1160785164 915 dbSNP
rs1280350974 917 dbSNP
rs1332751044 918 dbSNP
rs1053645747 919 dbSNP
rs1260620915 920 dbSNP
rs1205411683 923 dbSNP
rs1291180937 926 dbSNP
rs1486393081 927 dbSNP
rs891966027 929 dbSNP
rs755490381 932 dbSNP
rs1324080670 934 dbSNP
rs759285897 940 dbSNP
rs1043316784 941 dbSNP
rs1248269370 942 dbSNP
rs906121630 943 dbSNP
rs1295111128 949 dbSNP
rs1383056142 952 dbSNP
rs1488826693 953 dbSNP
rs1001568022 954 dbSNP
rs1264963102 959 dbSNP
rs1366150347 964 dbSNP
rs533869006 966 dbSNP
rs1164867574 969 dbSNP
rs1460040719 972 dbSNP
rs1473919293 975 dbSNP
rs1444405845 983 dbSNP
rs1372063853 988 dbSNP
rs1180821621 998 dbSNP
rs1297541655 1001 dbSNP
rs1413913104 1003 dbSNP
rs1035379148 1010 dbSNP
rs900465614 1011 dbSNP
rs751869468 1017 dbSNP
rs1197751002 1018 dbSNP
rs1490310396 1020 dbSNP
rs1481504760 1025 dbSNP
rs960028503 1029 dbSNP
rs996582697 1035 dbSNP
rs1177527874 1039 dbSNP
rs1449889736 1044 dbSNP
rs552939228 1045 dbSNP
rs572949164 1049 dbSNP
rs1300424003 1079 dbSNP
rs1366641912 1084 dbSNP
rs1309511822 1089 dbSNP
rs1227063893 1093 dbSNP
rs781419423 1101 dbSNP
rs1346010485 1114 dbSNP
rs538700987 1125 dbSNP
rs1015109721 1130 dbSNP
rs558792806 1135 dbSNP
rs1347334224 1137 dbSNP
rs983696006 1144 dbSNP
rs1015027064 1145 dbSNP
rs1460027694 1146 dbSNP
rs921815595 1157 dbSNP
rs963528651 1158 dbSNP
rs1426772396 1166 dbSNP
rs973760469 1173 dbSNP
rs1480306454 1175 dbSNP
rs1270133945 1183 dbSNP
rs11624709 1184 dbSNP
rs919682629 1189 dbSNP
rs35544899 1190 dbSNP
rs1249848212 1192 dbSNP
rs912552748 1194 dbSNP
rs71417804 1202 dbSNP
rs756427377 1203 dbSNP
rs1192137732 1207 dbSNP
rs1371155708 1214 dbSNP
rs1323945985 1219 dbSNP
rs1285008012 1229 dbSNP
rs913353597 1232 dbSNP
rs575760934 1233 dbSNP
rs1403338264 1234 dbSNP
rs778113853 1253 dbSNP
rs1404980093 1254 dbSNP
rs1042347941 1255 dbSNP
rs902317820 1257 dbSNP
rs1469021255 1261 dbSNP
rs749489220 1263 dbSNP
rs11624743 1266 dbSNP
rs1057511608 1269 dbSNP
rs895463737 1270 dbSNP
rs1004993533 1279 dbSNP
rs936497047 1280 dbSNP
rs898924476 1281 dbSNP
rs1333159269 1296 dbSNP
rs1053831025 1303 dbSNP
rs1044502 1304 dbSNP
rs1282878437 1320 dbSNP
rs1241178014 1323 dbSNP
rs1379901031 1327 dbSNP
rs1313802805 1336 dbSNP
rs996307010 1351 dbSNP
rs561559942 1352 dbSNP
rs778924383 1353 dbSNP
rs1407885181 1354 dbSNP
rs1321675561 1356 dbSNP
rs1336485701 1356 dbSNP
rs1030732397 1377 dbSNP
rs1384775007 1384 dbSNP
rs1230240898 1386 dbSNP
rs890484466 1387 dbSNP
rs1005067127 1392 dbSNP
rs1015139938 1393 dbSNP
rs1486129453 1394 dbSNP
rs1445391991 1395 dbSNP
rs1044503 1403 dbSNP
rs973541285 1408 dbSNP
rs540969724 1409 dbSNP
rs1460961555 1411 dbSNP
rs1259629187 1416 dbSNP
rs11625646 1418 dbSNP
rs148850948 1423 dbSNP
rs990609441 1424 dbSNP
rs1199970033 1425 dbSNP
rs1428085990 1430 dbSNP
rs1268035020 1435 dbSNP
rs143442965 1439 dbSNP
rs1160679282 1441 dbSNP
rs1412109138 1442 dbSNP
rs1422012300 1442 dbSNP
rs1364253794 1444 dbSNP
rs552264715 1452 dbSNP
rs1425363579 1466 dbSNP
rs1416135612 1468 dbSNP
rs376919716 1478 dbSNP
rs1475237304 1479 dbSNP
rs1242437532 1487 dbSNP
rs80169506 1487 dbSNP
rs947470931 1507 dbSNP
rs879564016 1513 dbSNP
rs376827631 1522 dbSNP
rs111757727 1531 dbSNP
rs562463202 1534 dbSNP
rs768573142 1545 dbSNP
rs531463343 1546 dbSNP
rs1053610001 1557 dbSNP
rs921816523 1568 dbSNP
rs182015897 1572 dbSNP
rs1339692754 1606 dbSNP
rs1343817697 1613 dbSNP
rs1051874738 1614 dbSNP
rs1402253618 1623 dbSNP
rs1289258696 1632 dbSNP
rs1316385192 1636 dbSNP
rs1237042681 1637 dbSNP
rs79578604 1642 dbSNP
rs1036007328 1651 dbSNP
rs113701543 1659 dbSNP
rs994535306 1660 dbSNP
rs1222880915 1663 dbSNP
rs1004844142 1666 dbSNP
rs547293391 1676 dbSNP
rs1028724310 1678 dbSNP
rs1172484073 1680 dbSNP
rs1479327752 1681 dbSNP
rs1036360425 1682 dbSNP
rs1009181711 1685 dbSNP
rs899417491 1689 dbSNP
rs995081837 1695 dbSNP
rs1203251232 1697 dbSNP
rs1438000440 1704 dbSNP
rs1034915581 1713 dbSNP
rs1035057546 1715 dbSNP
rs1250857781 1716 dbSNP
rs56232046 1717 dbSNP
rs538664799 1718 dbSNP
rs1012382822 1724 dbSNP
rs1370367300 1725 dbSNP
rs1296482689 1726 dbSNP
rs769456711 1732 dbSNP
rs1370645912 1734 dbSNP
rs558982711 1739 dbSNP
rs575631116 1749 dbSNP
rs538372635 1751 dbSNP
rs1364067987 1752 dbSNP
rs773041921 1755 dbSNP
rs1405060397 1758 dbSNP
rs917487113 1761 dbSNP
rs1432065530 1762 dbSNP
rs970340372 1763 dbSNP
rs1176601676 1765 dbSNP
rs1036603539 1772 dbSNP
rs1372963778 1781 dbSNP
rs977747793 1784 dbSNP
rs554857471 1786 dbSNP
rs1201370850 1788 dbSNP
rs1460608479 1792 dbSNP
rs1262836354 1796 dbSNP
rs1211300134 1801 dbSNP
rs1314402951 1805 dbSNP
rs1305460423 1809 dbSNP
rs957927568 1810 dbSNP
rs989435390 1811 dbSNP
rs1450642026 1818 dbSNP
rs1382354063 1822 dbSNP
rs921736991 1827 dbSNP
rs1246665932 1829 dbSNP
rs1290998675 1833 dbSNP
rs762657992 1843 dbSNP
rs1401274801 1849 dbSNP
rs766013973 1850 dbSNP
rs1251460814 1853 dbSNP
rs1181220565 1881 dbSNP
rs1480113758 1884 dbSNP
rs1443589106 1885 dbSNP
rs1243397806 1898 dbSNP
rs575087144 1901 dbSNP
rs911978469 1907 dbSNP
rs576585458 1928 dbSNP
rs1259407141 1929 dbSNP
rs968701915 1933 dbSNP
rs1355060500 1938 dbSNP
rs1288210576 1949 dbSNP
rs1243904111 1951 dbSNP
rs141838880 1956 dbSNP
rs754923218 1958 dbSNP
rs1036307519 1965 dbSNP
rs1398078807 1966 dbSNP
rs1359588823 1967 dbSNP
rs1355595370 1974 dbSNP
rs899198251 1975 dbSNP
rs185898689 1978 dbSNP
rs1362410857 1982 dbSNP
rs759962218 1987 dbSNP
rs1423428470 1995 dbSNP
rs1171572690 1998 dbSNP
rs560780427 1998 dbSNP
rs1354102289 2002 dbSNP
rs1056065204 2005 dbSNP
rs894600769 2027 dbSNP
rs576877132 2028 dbSNP
rs768133752 2031 dbSNP
rs1220957021 2038 dbSNP
rs972288221 2040 dbSNP
rs1014425635 2041 dbSNP
rs1024931533 2042 dbSNP
rs970454940 2044 dbSNP
rs1305989279 2071 dbSNP
rs545459670 2072 dbSNP
rs1219033251 2083 dbSNP
rs137914532 2088 dbSNP
rs1342195906 2091 dbSNP
rs1301181314 2092 dbSNP
rs1404327158 2092 dbSNP
rs1452073311 2093 dbSNP
rs1314278775 2095 dbSNP
rs1030653504 2096 dbSNP
rs1380578573 2097 dbSNP
rs1372172932 2106 dbSNP
rs1171014982 2108 dbSNP
rs957709813 2118 dbSNP
rs989774585 2135 dbSNP
rs1028914362 2136 dbSNP
rs1478336896 2140 dbSNP
rs953459967 2148 dbSNP
rs1197880314 2149 dbSNP
rs1451550859 2154 dbSNP
rs910278714 2156 dbSNP
rs1306516999 2157 dbSNP
rs1479752631 2161 dbSNP
rs562537481 2161 dbSNP
rs1250947189 2163 dbSNP
rs1040153259 2183 dbSNP
rs1319729022 2196 dbSNP
rs1257441190 2200 dbSNP
rs1461364856 2201 dbSNP
rs911755152 2202 dbSNP
rs1331611743 2208 dbSNP
rs531295468 2214 dbSNP
rs45595341 2215 dbSNP
rs1331609434 2216 dbSNP
rs972142915 2222 dbSNP
rs903778451 2223 dbSNP
rs1451899042 2231 dbSNP
rs548310842 2243 dbSNP
rs1402837248 2244 dbSNP
rs756549236 2247 dbSNP
rs561686417 2248 dbSNP
rs1378741047 2254 dbSNP
rs1201708300 2258 dbSNP
rs60990548 2259 dbSNP
rs894507248 2270 dbSNP
rs930654701 2275 dbSNP
rs45519134 2283 dbSNP
rs1309116327 2285 dbSNP
rs894723014 2288 dbSNP
rs950382606 2289 dbSNP
rs1345516707 2290 dbSNP
rs570435468 2300 dbSNP
rs1469351373 2301 dbSNP
rs539378831 2302 dbSNP
rs1309372281 2308 dbSNP
rs1403754222 2320 dbSNP
rs1448449027 2326 dbSNP
rs1432842394 2340 dbSNP
rs1289413193 2347 dbSNP
rs1027823349 2362 dbSNP
rs952316820 2363 dbSNP
rs903374900 2364 dbSNP
rs910196181 2366 dbSNP
rs944411168 2368 dbSNP
rs1452326464 2376 dbSNP
rs778756855 2387 dbSNP
rs999251449 2387 dbSNP
rs191200425 2396 dbSNP
rs182997367 2399 dbSNP
rs1260737490 2408 dbSNP
rs1441731138 2408 dbSNP
rs1466609100 2422 dbSNP
rs1442788212 2424 dbSNP
rs771561573 2426 dbSNP
rs1010570354 2429 dbSNP
rs945155832 2440 dbSNP
rs1043579444 2452 dbSNP
rs903747151 2456 dbSNP
rs1029111086 2467 dbSNP
rs1241714657 2468 dbSNP
rs937900138 2470 dbSNP
rs1313883476 2475 dbSNP
rs1055076438 2478 dbSNP
rs1341433113 2480 dbSNP
rs953309368 2501 dbSNP
rs1014292977 2516 dbSNP
rs1269787981 2528 dbSNP
rs987817791 2540 dbSNP
rs757422072 2544 dbSNP
rs76914816 2549 dbSNP
rs1480245031 2551 dbSNP
rs897917197 2560 dbSNP
rs1421561277 2564 dbSNP
rs1174316329 2594 dbSNP
rs1162879971 2597 dbSNP
rs1018713028 2618 dbSNP
rs1238922296 2621 dbSNP
rs779328409 2624 dbSNP
rs1159723859 2634 dbSNP
rs1263788266 2635 dbSNP
rs952242064 2635 dbSNP
rs1218755407 2642 dbSNP
rs1489635778 2649 dbSNP
rs1344602544 2665 dbSNP
rs76937234 2669 dbSNP
rs1358029528 2671 dbSNP
rs1286275658 2675 dbSNP
rs1225722159 2690 dbSNP
rs920680396 2699 dbSNP
rs930759786 2707 dbSNP
rs1402464114 2718 dbSNP
rs1304748442 2721 dbSNP
rs1345700965 2723 dbSNP
rs1322980725 2728 dbSNP
rs1403988659 2733 dbSNP
rs778969371 2736 dbSNP
rs1406130568 2737 dbSNP
rs966090133 2747 dbSNP
rs1166423463 2749 dbSNP
rs555052433 2750 dbSNP
rs373679337 2751 dbSNP
rs915923359 2753 dbSNP
rs1223913054 2756 dbSNP
rs1489842727 2772 dbSNP
rs945124420 2773 dbSNP
rs1452920898 2774 dbSNP
rs979228359 2776 dbSNP
rs1315664376 2781 dbSNP
rs1224175237 2796 dbSNP
rs925091900 2798 dbSNP
rs950311678 2799 dbSNP
rs937900296 2809 dbSNP
rs1046031447 2811 dbSNP
rs1197508644 2812 dbSNP
rs903322269 2824 dbSNP
rs934822952 2828 dbSNP
rs1366156333 2830 dbSNP
rs577750097 2831 dbSNP
rs758396983 2832 dbSNP
rs893553688 2835 dbSNP
rs1470550015 2841 dbSNP
rs1011102002 2842 dbSNP
rs1465353849 2846 dbSNP
rs1176690596 2848 dbSNP
rs1050076451 2849 dbSNP
rs1172560212 2862 dbSNP
rs1479391394 2874 dbSNP
rs1424396259 2875 dbSNP
rs1191746400 2886 dbSNP
rs1407081420 2893 dbSNP
rs1478724148 2897 dbSNP
rs1230736992 2902 dbSNP
rs568634094 2903 dbSNP
rs1457940471 2904 dbSNP
rs1008788359 2905 dbSNP
rs1259064979 2908 dbSNP
rs1045748934 2911 dbSNP
rs534412136 2916 dbSNP
rs748007396 2917 dbSNP
rs1220377800 2922 dbSNP
rs554432409 2927 dbSNP
rs993287128 2928 dbSNP
rs188078480 2930 dbSNP
rs190142581 2931 dbSNP
rs952148238 2934 dbSNP
rs968973319 2936 dbSNP
rs915890122 2937 dbSNP
rs978669726 2941 dbSNP
rs1007760304 2943 dbSNP
rs1358401232 2943 dbSNP
rs1464333987 2943 dbSNP
rs555882089 2946 dbSNP
rs575990551 2947 dbSNP
rs1416118573 2949 dbSNP
rs924537274 2950 dbSNP
rs1337234662 2951 dbSNP
rs1405084608 2959 dbSNP
rs1442215052 2962 dbSNP
rs1018238516 2964 dbSNP
rs1278459392 2966 dbSNP
rs1181415131 2967 dbSNP
rs1482479560 2968 dbSNP
rs971816558 2970 dbSNP
rs1190382186 2974 dbSNP
rs981655958 2984 dbSNP
rs924859274 2987 dbSNP
rs138804522 2994 dbSNP
rs934935895 2996 dbSNP
rs562424120 2997 dbSNP
rs1283920864 3015 dbSNP
rs1239541000 3021 dbSNP
rs1293202965 3022 dbSNP
rs1359154955 3028 dbSNP
rs1394570714 3029 dbSNP
rs1220802107 3032 dbSNP
rs748958309 3033 dbSNP
rs561463708 3035 dbSNP
rs1303219712 3037 dbSNP
rs115569999 3041 dbSNP
rs1358575091 3042 dbSNP
rs1158024687 3049 dbSNP
rs1419743455 3057 dbSNP
rs1438618413 3058 dbSNP
rs888755599 3069 dbSNP
rs1231288580 3078 dbSNP
rs1161267667 3080 dbSNP
rs1473841790 3090 dbSNP
rs1008521924 3091 dbSNP
rs1413439964 3098 dbSNP
rs1185326230 3100 dbSNP
rs1040058216 3102 dbSNP
rs897737593 3105 dbSNP
rs1216568706 3109 dbSNP
rs925059096 3111 dbSNP
rs1288272124 3113 dbSNP
rs1242800633 3115 dbSNP
rs1321386204 3120 dbSNP
rs1313104934 3125 dbSNP
rs1229798354 3138 dbSNP
rs993401893 3140 dbSNP
rs1027424192 3141 dbSNP
rs1338196939 3143 dbSNP
rs774139446 3153 dbSNP
rs1161449386 3155 dbSNP
rs1400601280 3163 dbSNP
rs377680837 3164 dbSNP
rs959434479 3171 dbSNP
rs1291290681 3177 dbSNP
rs951989941 3181 dbSNP
rs1457061186 3190 dbSNP
rs1012973399 3202 dbSNP
rs1398116433 3205 dbSNP
rs1350131321 3209 dbSNP
rs1166529237 3210 dbSNP
rs1476370967 3222 dbSNP
rs990671646 3233 dbSNP
rs1023477534 3240 dbSNP
rs540807362 3242 dbSNP
rs1193507125 3245 dbSNP
rs1478438862 3252 dbSNP
rs1265384802 3253 dbSNP
rs1208160523 3254 dbSNP
rs1327815110 3256 dbSNP
rs971382558 3258 dbSNP
rs114512506 3261 dbSNP
rs758641989 3262 dbSNP
rs956257380 3264 dbSNP
rs990420073 3265 dbSNP
rs751319425 3269 dbSNP
rs533049245 3276 dbSNP
rs759141543 3281 dbSNP
rs1298496161 3287 dbSNP
rs1385707939 3289 dbSNP
rs1390874191 3297 dbSNP
rs929347602 3301 dbSNP
rs932823128 3303 dbSNP
rs1170454336 3315 dbSNP
rs1466559565 3327 dbSNP
rs1375268962 3330 dbSNP
rs1197423334 3342 dbSNP
rs1432667055 3343 dbSNP
rs1268217019 3360 dbSNP
rs1050144908 3363 dbSNP
rs1271210034 3366 dbSNP
rs528005885 3375 dbSNP
rs910292676 3392 dbSNP
rs1319791102 3404 dbSNP
rs550097274 3404 dbSNP
rs1040001348 3405 dbSNP
rs72700636 3408 dbSNP
rs1331163067 3409 dbSNP
rs1302780654 3411 dbSNP
rs929198740 3414 dbSNP
rs1375725896 3419 dbSNP
rs150247279 3421 dbSNP
rs1049461516 3423 dbSNP
rs887584127 3444 dbSNP
rs1171324022 3452 dbSNP
rs548361444 3456 dbSNP
rs1022836448 3457 dbSNP
rs138803441 3460 dbSNP
rs1002983625 3463 dbSNP
rs1032056339 3464 dbSNP
rs1417032709 3470 dbSNP
rs1031654552 3481 dbSNP
rs956038499 3488 dbSNP
rs1470630793 3489 dbSNP
rs959171767 3496 dbSNP
rs990367969 3498 dbSNP
rs1405925482 3509 dbSNP
rs1179535548 3513 dbSNP
rs991032348 3514 dbSNP
rs1253883908 3523 dbSNP
rs1451131248 3530 dbSNP
rs538823929 3540 dbSNP
rs554397595 3542 dbSNP
rs776103748 3543 dbSNP
rs918536664 3545 dbSNP
rs1337845715 3548 dbSNP
rs986026504 3549 dbSNP
rs1332616988 3553 dbSNP
rs149388316 3554 dbSNP
rs1403565584 3557 dbSNP
rs944438480 3559 dbSNP
rs975819828 3560 dbSNP
rs1379829705 3562 dbSNP
rs918893884 3564 dbSNP
rs928982189 3566 dbSNP
rs1366429048 3570 dbSNP
rs943477480 3574 dbSNP
rs1442841913 3577 dbSNP
rs1259494801 3585 dbSNP
rs1263839002 3590 dbSNP
rs1447360330 3595 dbSNP
rs1214446766 3600 dbSNP
rs111972611 3601 dbSNP
rs144670380 3613 dbSNP
rs1225047276 3615 dbSNP
rs948694074 3617 dbSNP
rs1244489011 3630 dbSNP
rs1042630570 3643 dbSNP
rs761046913 3645 dbSNP
rs1176466000 3650 dbSNP
rs1398754931 3650 dbSNP
rs45564331 3653 dbSNP
rs1298885691 3655 dbSNP
rs907053769 3655 dbSNP
rs1002929957 3658 dbSNP
rs541831286 3661 dbSNP
rs1467821606 3662 dbSNP
rs1160790083 3665 dbSNP
rs754134976 3666 dbSNP
rs1419835242 3670 dbSNP
rs1191345690 3671 dbSNP
rs1486542707 3677 dbSNP
rs1032021239 3682 dbSNP
rs891765089 3683 dbSNP
rs1217338437 3685 dbSNP
rs1011990112 3687 dbSNP
rs757614770 3688 dbSNP
rs370968524 3691 dbSNP
rs1011981191 3692 dbSNP
rs1340481446 3693 dbSNP
rs1025183567 3699 dbSNP
rs1021663296 3701 dbSNP
rs765502168 3708 dbSNP
rs750590129 3709 dbSNP
rs1168313298 3712 dbSNP
rs1464990273 3715 dbSNP
rs954426398 3716 dbSNP
rs111812355 3718 dbSNP
rs540770784 3719 dbSNP
rs1204272846 3722 dbSNP
rs34878683 3730 dbSNP
rs1199055461 3732 dbSNP
rs867422312 3758 dbSNP
rs965529563 3762 dbSNP
rs563938369 3777 dbSNP
rs909200360 3794 dbSNP
rs975770449 3804 dbSNP
rs1317740130 3809 dbSNP
rs1490790069 3815 dbSNP
rs758548709 3825 dbSNP
rs1199674873 3828 dbSNP
rs1216892362 3833 dbSNP
rs533157724 3834 dbSNP
rs929096964 3840 dbSNP
rs747163892 3850 dbSNP
rs1430949124 3866 dbSNP
rs769015825 3868 dbSNP
rs543315256 3869 dbSNP
rs1262167605 3870 dbSNP
rs908902967 3871 dbSNP
rs148493365 3877 dbSNP
rs948622312 3877 dbSNP
rs1044333203 3880 dbSNP
rs1364821397 3883 dbSNP
rs1445730882 3883 dbSNP
rs943386373 3884 dbSNP
rs1412700659 3885 dbSNP
rs187454123 3890 dbSNP
rs1367824106 3891 dbSNP
rs938499805 3892 dbSNP
rs563621044 3893 dbSNP
rs1302775530 3895 dbSNP
rs933437506 3901 dbSNP
rs1235946706 3902 dbSNP
rs192427636 3903 dbSNP
rs1042597940 3904 dbSNP
rs1052982306 3905 dbSNP
rs548585003 3906 dbSNP
rs1277947266 3910 dbSNP
rs1307821019 3911 dbSNP
rs936896177 3913 dbSNP
rs532859247 3915 dbSNP
rs1238199564 3920 dbSNP
rs547942405 3922 dbSNP
rs1373714352 3924 dbSNP
rs1307059474 3927 dbSNP
rs1299673252 3930 dbSNP
rs1445676735 3931 dbSNP
rs373785353 3932 dbSNP
rs1007523129 3939 dbSNP
rs527782136 3940 dbSNP
rs1290503936 3943 dbSNP
rs1024692406 3946 dbSNP
rs1157615106 3948 dbSNP
rs748143353 3949 dbSNP
rs1179345570 3950 dbSNP
rs1482510773 3957 dbSNP
rs993936561 3969 dbSNP
rs1025443151 3975 dbSNP
rs185842878 3978 dbSNP
rs571016344 3979 dbSNP
rs983982593 3980 dbSNP
rs1177298838 3983 dbSNP
rs11160687 3989 dbSNP
rs1226375609 3994 dbSNP
rs1378258353 3999 dbSNP
rs950502192 4002 dbSNP
rs1163354297 4003 dbSNP
rs1357997900 4006 dbSNP
rs1363887856 4010 dbSNP
rs139545958 4015 dbSNP
rs1453956713 4023 dbSNP
rs1346576256 4025 dbSNP
rs570309067 4036 dbSNP
rs1422426269 4046 dbSNP
rs908842192 4057 dbSNP
rs45438105 4060 dbSNP
rs187585079 4061 dbSNP
rs1193067635 4064 dbSNP
rs1329223460 4064 dbSNP
rs1384917235 4065 dbSNP
rs928537098 4066 dbSNP
rs1262711057 4068 dbSNP
rs1246366312 4071 dbSNP
rs1314137803 4072 dbSNP
rs1319511665 4073 dbSNP
rs1273585245 4074 dbSNP
rs1229119491 4075 dbSNP
rs192518133 4077 dbSNP
rs865781013 4100 dbSNP
rs534372366 4104 dbSNP
rs1277546627 4106 dbSNP
rs774194482 4114 dbSNP
rs1363537861 4118 dbSNP
rs1291414732 4122 dbSNP
rs1052928457 4139 dbSNP
rs1394114985 4144 dbSNP
rs913091730 4146 dbSNP
rs1196212508 4158 dbSNP
rs1245447514 4161 dbSNP
rs1422079017 4162 dbSNP
rs1462169011 4166 dbSNP
rs1183322966 4173 dbSNP
rs1263964202 4174 dbSNP
rs1189626834 4175 dbSNP
rs1355650857 4183 dbSNP
rs557445023 4204 dbSNP
rs947434132 4213 dbSNP
rs1253347488 4217 dbSNP
rs1043157187 4218 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer -0.209 2.9e-2 -0.150 8.8e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.347 4.5e-2 0.213 1.5e-1 25 Click to see details
GSE19536 Breast cancer 0.161 5.5e-2 0.119 1.2e-1 100 Click to see details
GSE28260 Renal cortex and medulla -0.405 8.5e-2 -0.385 9.7e-2 13 Click to see details
GSE38226 Liver fibrosis -0.302 9.2e-2 -0.111 3.2e-1 21 Click to see details
GSE19783 ER- ER- breast cancer 0.151 9.2e-2 0.138 1.1e-1 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.266 1.3e-1 -0.417 3.4e-2 20 Click to see details
GSE28544 Breast cancer -0.237 1.3e-1 -0.527 4.1e-3 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.216 1.5e-1 0.209 1.6e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.112 1.9e-1 -0.117 1.8e-1 64 Click to see details
GSE17498 Multiple myeloma -0.101 2.7e-1 -0.099 2.7e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer -0.146 2.7e-1 -0.044 4.3e-1 20 Click to see details
GSE21849 B cell lymphoma 0.095 3.1e-1 0.364 2.6e-2 29 Click to see details
GSE27834 Pluripotent stem cells 0.122 3.3e-1 0.065 4.1e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.085 3.5e-1 -0.079 3.6e-1 24 Click to see details
GSE17306 Multiple myeloma 0.056 3.5e-1 0.149 1.5e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.03 3.9e-1 -0.004 4.9e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.068 4.2e-1 -0.049 4.4e-1 12 Click to see details
GSE32688 Pancreatic cancer -0.019 4.6e-1 0.235 9.8e-2 32 Click to see details
GSE32688 Pancreatic cancer -0.019 4.6e-1 0.235 9.8e-2 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.892 0 -0.808 0 18 Click to see details
STAD -0.624 0 -0.634 0 32 Click to see details
CHOL -0.721 0.01 -0.717 0.01 9 Click to see details
UCEC -0.47 0.02 -0.532 0.01 19 Click to see details
HNSC -0.297 0.03 -0.345 0.01 42 Click to see details
PRAD -0.206 0.08 -0.203 0.08 50 Click to see details
PAAD -0.822 0.09 -0.800 0.1 4 Click to see details
KIRC -0.161 0.09 -0.155 0.1 68 Click to see details
THCA -0.123 0.18 -0.111 0.2 59 Click to see details
LIHC 0.118 0.21 -0.032 0.41 49 Click to see details
BRCA -0.056 0.31 -0.082 0.23 84 Click to see details
LUSC -0.068 0.34 -0.040 0.41 38 Click to see details
KIRP -0.065 0.36 -0.129 0.24 32 Click to see details
KICH 0.041 0.42 0.141 0.25 25 Click to see details
PCPG -0.193 0.44 -0.500 0.33 3 Click to see details
CESC -0.052 0.48 -0.500 0.33 3 Click to see details
ESCA 0.013 0.48 0.018 0.48 11 Click to see details
LUAD -0.006 0.49 -0.203 0.26 12 Click to see details
COAD 0.003 0.5 0.429 0.14 8 Click to see details
COAD 0.003 0.5 0.429 0.14 8 Click to see details
COAD 0.003 0.5 0.429 0.14 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
<
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3