miRTarBase - #MIRT728092 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C6orf106   
Synonyms FP852, dJ391O22.4
Description chromosome 6 open reading frame 106
Transcript NM_022758   
Other Transcripts NM_024294   
Expression
Putative miRNA Targets on C6orf106
3'UTR of C6orf106
(miRNA target sites are highlighted)
>C6orf106|NM_022758|3'UTR
   1 ACGGGTGTCAGCAAGAAGAAAAATTAACAAAAGACAGAAGGCCTGACTTTGGGGGGTTAGGGCAAGGGGTTCCTCTGGAT
  81 TGCAGACCACATCGCACAGACCCCTGGCTCTGACCCCCTCTCATCCCGGAAGAAGAGGAAGAAGCAGAACAGACTAGTTT
 161 TGAGTAAACTCAGTATGCATGTGTGAATGCTGAATCACAGGAATGGTGTTGAGGCTACCAAGAAGAAATCCATGCAGCCA
 241 CTTTGGGTTTTGTTATAGGCATCAGTCTAACAAGTCATTAGGTCACTCGGGAAGGGGGAAAAAGTTTAAAATGGGGGAAA
 321 AAAAGCCATCTTTTTAAACAAAAATTATTTTGCCTACAGAAAGGTTGTAGTTTTGAGCACATGTTAATTTTTTTCCCTCT
 401 TTCCCCACTTTTATTTTTTTAAATAAGGGATAACATATTCTTTATAGAATAGTGCTTGTTCTGGAAGAGATTCAGGTGAA
 481 AAGTTGGCGTGGCATGTTTGAGGACTCTGCGGATCAGTGCTACAGGAGTACATCTGCCCTGCCACATGACTCCAGAAGTC
 561 TCTGACCCCATTTGTTTTTAATGGCATCAGCCAATGAGTTATCACCCTTTTCCTCCTCTTTTCTCTTTAATCTTCTGTTG
 641 ATTTACACCTTTGACATTTGTATTCGTCAACCCTGTGGCTTGTTAGCATCAGAACCTCTCTGAAGACCAAACTTCCCTGT
 721 GTGGCCAGCAGAGGAAGCCTTGAGGATAGATCTCGGGTGACGTGGGATTTTCTAAGCCTGAGAGGTGTCCTTCTGCACAC
 801 CCTTGTAACAATTAAAATTGCTTTTCTTCCATGTTTCTCTTGGCAGAGAGAAATGCCATCATGCTTACTGCTCTTTTGGA
 881 TTCTTCATGCAGTGGCTTCCCATTTGCTCTGGGAACAGTGCCTCTGTGCTGGTTATATGTATGCACCACATGTGCACACA
 961 CGGGTGTCGGTGCAACTCACCAGCAGGTGTGCAGTAGGCAAGCTTGAAGGTGGCCCATGCTTCTCTGTTGTCACACAACA
1041 CCTTTCCCTGTTTCTCTTCAGTTGTCCTCTGATATTTTCACAGCCTGTTAGTGGCGGCTGATCTGTAGAGGTATGAAAAT
1121 ACAGCCCCAAAGGGGGAATTTGTCATGGGGAAGGGCCAGCCACTGACTACTTGATCTTGGAGACCACATTTAGATGGAAA
1201 TGAGAGGACCTCCACAGCCCCGCCTCCCTGCCAGGATGCTAGATTATTGGCTGGGAGGTGGGCAAGTGGCAGCCCAGCTG
1281 AAGCAAGAGGCTGATTGACTGGCTGCTCACTCAGGCAGGTGGCCTGCCCTGGCATCCTGTAGATTCTGAGCAGGTTGAGA
1361 TGTGGATATCTCCATGGGAAGCTTGAACCAGGCTAGAACAGCTGTCTGCCAAAGATACAAGAATATGCAAAGTCCCTCTT
1441 ACCCCCCTCCTTCCCTCAAGTCTTAGTTGGTTTGAGAGCCAGGGATATGGATCCAGGGTGCTGTTGCAGGGTCACCTGCC
1521 TGTTACCACACCCCCATCCAGCTGGGTGGTGGGTGAGGGTGTGAGACAGGCAGGGAGACCAGGTAATGAGTGGCTGCAAG
1601 GAGTCATATAGCCTGGGTGTGGGTGAGGGTCTGCCTGCCTGTTTCTGTCTGGGTGTCTGAGTTCCAAAAAATGTGTGTTG
1681 TTTGTTCCTCCTCATCCTCTTCTGAGACTGTTGTTTTTTTAGAGCTTGATTGTGGGAGAAAAGCTTGTGTGAAATTCCCT
1761 CTTCACCTCCCCACCCCCCAAAAAATAAAAGGGGGCATAAACTTTATTCCACTGGAGAAGCCCTGGGGGTGGCTGGAGCC
1841 AGCCTGCTGAGAAGCGTGGTGCAGCTGGGTCTGGGACTTCACTAGAGCTTACTCTGGAGCACCTATTTTCTGTGCACATG
1921 GGAGTGCTCCACTCCCTAGCAGAGCAGAGGGAAGTCTCTGCCAGGTACCCACGCCACAGGCCTCAGGATGGCTTTTTGTC
2001 TGAGGGCCTCATTAGGCCCAGACTGCTGCTGCTGGTACCAGTCTCCTGAGACACTGCCTCCCTGGAGCCCATGCATGCCC
2081 AGCTGTTCTTACTGCTTAGTAGCCTTGAAGCAGCACATCTCCACTGTCCCTGGCAGGATTGTGGGAGGCTTCACAACCCC
2161 TGCTTTCCTGACTTCCTCTTCTGCCCAACACTGGGTGCCCCTTCCCAGTTTCCCAGCAGGGGCTTCATGGGCCACCGTCA
2241 GTGGGTCTGGGCCTGCCAGAGTCGTCTTGCTCTTCCTCTTGCTTCTAGGCAACCACACTTGGCAAGTTAAATGTCCCAAG
2321 CACCTTGTCTCCCTTCCCAAGAACAAACCATTTCTGTGCACATCCTTGGAGGCGAGATGAGCTCCTTGCAGAGGGCCAGA
2401 GTAAGTGCAAGTCATGGAGTGCAGGCAGAGGGGTCCATGGCTTCCCCAGCCCAGGGAGGGTATCAGTATCATTCATTCTC
2481 TCTCCCCTCACTGGTATGGGTTCAGAGCAATGCCTAGGGCCCCTCTCTGCTCCCCTGCCTAGTGGGGTGGTAGTGGCTAC
2561 CTCTCAGCCCCAATAGTCCCTGCTCCTCTTAGAATCTTCACCAAGTGGCAGGCCACCTCTGGGCAGGACCACCTGCGTCT
2641 GGCACCCAGGAGGTGAGGCAGACACCATGGTTAGGTGATAGGGTCTGAACCCAGTTGGGGAGACAGAGGGGTTCAGACTT
2721 GGGAAGAATCTGTCAGTGTGCATGGAGTGAGGTGTGTGTGTGTGGATGGATGTGCACGTGTGCATGCTTTTTTTCTTTTT
2801 GCCGTGAGGACAGTTGAATTTGGGGCATTTTTCTACAAGAAGCAGTCAGCCTTCTCTCCCCCATAAGGACTGGCTGTAAC
2881 CTTAAGCCCATCAAAGTTACTTCCAGCCTGGAGAGAACCTCACCAAACAGCTGGTGTGGCCTGAGGGTGGCCATGGTGGG
2961 AAATGGGCATGAGAATAAATACCTCCCCAAATTCAATCTGAGCCCAGCAGGAGAGGATGGTAGGGTTGCCAGGGCTCAGA
3041 AGTGCAAGCTGATTACTCACCCCACCCTGCCTCGCCGCACCTTTCCTTTGTTTCCTTGGGTGAATGCAGGAGCAGCAGTG
3121 GCTGCCCTTCCCACCTGGACAGTGGTGTGTGTAGAAAGCCAGCTGGATGTTTGTGGTGGGGCCTCATGGTGCCTAGGAGG
3201 AGATAAAGATGAGGAGGTTTTTCCTTATTGTATAAATGAATATTTGTATGATTAAATTAACACACACACCAAAAAAAGCT
3281 GTTTTAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUAC-------ACGACGAu 5'
                :||||| |       ||||||| 
Target 5' agggccTCATTAGGCCCAGACTGCTGCTg 3'
2003 - 2031 148.00 -21.60
2
miRNA  3' gugUUU--GGUAAUAC--ACGACGAu 5'
             |||  |||| |||  | ||||| 
Target 5' gagAAATGCCATCATGCTTACTGCTc 3'
848 - 873 135.00 -10.60
3
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             :| |||  : ||||||:| 
Target 5' atgGATCCA--GGGTGCTGTTg 3'
1487 - 1506 135.00 -15.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN24382717 4 COSMIC
COSN31553844 18 COSMIC
COSN30520855 24 COSMIC
COSN30189445 27 COSMIC
COSN31500681 47 COSMIC
COSN26968759 61 COSMIC
COSN30109664 120 COSMIC
COSN15335074 164 COSMIC
COSN31515636 225 COSMIC
COSN31582510 231 COSMIC
COSN2160308 236 COSMIC
COSN26563199 327 COSMIC
COSN9781221 339 COSMIC
COSN31577473 370 COSMIC
COSN29789760 584 COSMIC
COSN21565378 668 COSMIC
COSN20091373 793 COSMIC
COSN29245025 1319 COSMIC
COSN31515456 1605 COSMIC
COSN24301618 1694 COSMIC
COSN20231984 1828 COSMIC
COSN26585259 1839 COSMIC
COSN15999243 2222 COSMIC
COSN29264570 2803 COSMIC
COSN31530801 2886 COSMIC
COSN31602941 3031 COSMIC
COSN31602810 3032 COSMIC
COSN28734011 3042 COSMIC
COSN30157996 3110 COSMIC
COSN31542684 3244 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1396547258 2 dbSNP
rs780722411 3 dbSNP
rs770331439 7 dbSNP
rs778783770 7 dbSNP
rs746739255 11 dbSNP
rs1321620882 12 dbSNP
rs777219979 13 dbSNP
rs1159867276 19 dbSNP
rs370971261 26 dbSNP
rs753061457 27 dbSNP
rs779593543 29 dbSNP
rs367775900 30 dbSNP
rs1255365102 33 dbSNP
rs1214873574 35 dbSNP
rs1451592685 38 dbSNP
rs754373352 40 dbSNP
rs766540857 41 dbSNP
rs760667638 43 dbSNP
rs750663976 50 dbSNP
rs375408752 51 dbSNP
rs1235575141 52 dbSNP
rs1044007131 55 dbSNP
rs1356201897 56 dbSNP
rs1208590106 66 dbSNP
rs1469627929 67 dbSNP
rs915627605 79 dbSNP
rs1401628560 87 dbSNP
rs991658552 87 dbSNP
rs959707797 88 dbSNP
rs1035785761 89 dbSNP
rs1009204903 91 dbSNP
rs1464120558 92 dbSNP
rs892151336 93 dbSNP
rs28509434 94 dbSNP
rs1267132595 95 dbSNP
rs1169643111 109 dbSNP
rs1182525770 110 dbSNP
rs1021075215 118 dbSNP
rs939100288 119 dbSNP
rs1348814561 122 dbSNP
rs926398062 127 dbSNP
rs1313807864 128 dbSNP
rs893984185 150 dbSNP
rs1243249877 158 dbSNP
rs761080704 160 dbSNP
rs1028336440 166 dbSNP
rs941200000 169 dbSNP
rs1460738639 181 dbSNP
rs1271904737 191 dbSNP
rs1486422207 214 dbSNP
rs528392787 233 dbSNP
rs1258629986 244 dbSNP
rs1182102220 252 dbSNP
rs1200511140 269 dbSNP
rs1316001415 281 dbSNP
rs1195206022 289 dbSNP
rs909768209 295 dbSNP
rs1271593649 299 dbSNP
rs1167985174 303 dbSNP
rs982675776 304 dbSNP
rs1368804607 306 dbSNP
rs753032045 308 dbSNP
rs564111017 318 dbSNP
rs1394704675 319 dbSNP
rs1300406619 320 dbSNP
rs1228347098 325 dbSNP
rs1366513017 325 dbSNP
rs149164602 326 dbSNP
rs530649399 345 dbSNP
rs1210368487 352 dbSNP
rs1378197148 362 dbSNP
rs1333808353 364 dbSNP
rs1445127532 369 dbSNP
rs749201975 373 dbSNP
rs1354500077 375 dbSNP
rs1206629538 377 dbSNP
rs766016726 381 dbSNP
rs1407204887 382 dbSNP
rs1186599181 383 dbSNP
rs1411862964 383 dbSNP
rs1163256525 384 dbSNP
rs1443765598 386 dbSNP
rs1238497796 395 dbSNP
rs1180278966 399 dbSNP
rs145224162 405 dbSNP
rs1464764115 406 dbSNP
rs901156986 409 dbSNP
rs968216873 411 dbSNP
rs1434930972 412 dbSNP
rs1319200640 414 dbSNP
rs1022527457 427 dbSNP
rs1009802907 428 dbSNP
rs1232256783 429 dbSNP
rs762657014 430 dbSNP
rs1219342369 431 dbSNP
rs1300024694 434 dbSNP
rs1056123072 451 dbSNP
rs772678989 458 dbSNP
rs1340269434 473 dbSNP
rs1464326828 488 dbSNP
rs904901508 489 dbSNP
rs1045223574 496 dbSNP
rs1221632906 504 dbSNP
rs1323038938 507 dbSNP
rs1489488172 511 dbSNP
rs1191804054 512 dbSNP
rs13192251 513 dbSNP
rs1424582584 513 dbSNP
rs1161659952 518 dbSNP
rs1413160611 519 dbSNP
rs1457086876 522 dbSNP
rs909735652 523 dbSNP
rs1352080136 534 dbSNP
rs1244715836 536 dbSNP
rs1437830569 543 dbSNP
rs1292377680 546 dbSNP
rs761364574 552 dbSNP
rs1311865404 554 dbSNP
rs776729270 561 dbSNP
rs139269113 567 dbSNP
rs1225306084 570 dbSNP
rs11558665 585 dbSNP
rs1373224643 588 dbSNP
rs1291804377 597 dbSNP
rs1322206925 598 dbSNP
rs868508028 601 dbSNP
rs1246136991 606 dbSNP
rs1489900288 607 dbSNP
rs1306901368 608 dbSNP
rs976107886 615 dbSNP
rs538159817 619 dbSNP
rs1252859812 620 dbSNP
rs1472402859 621 dbSNP
rs944709340 628 dbSNP
rs1180404395 635 dbSNP
rs931165220 650 dbSNP
rs915732070 655 dbSNP
rs187479183 656 dbSNP
rs986228468 665 dbSNP
rs1302641199 666 dbSNP
rs569493768 670 dbSNP
rs1022457344 674 dbSNP
rs1308232638 679 dbSNP
rs1003314990 682 dbSNP
rs967015192 692 dbSNP
rs577108467 695 dbSNP
rs558560523 699 dbSNP
rs989677804 705 dbSNP
rs1357330028 706 dbSNP
rs1407119039 706 dbSNP
rs1207329147 712 dbSNP
rs116671426 725 dbSNP
rs146249814 737 dbSNP
rs555542420 749 dbSNP
rs1181768092 754 dbSNP
rs371052711 755 dbSNP
rs772240562 757 dbSNP
rs1168616875 761 dbSNP
rs1005242094 762 dbSNP
rs751192784 767 dbSNP
rs1335856585 785 dbSNP
rs888225933 786 dbSNP
rs746107532 787 dbSNP
rs1359515127 790 dbSNP
rs536703843 793 dbSNP
rs1391648193 800 dbSNP
rs778963759 801 dbSNP
rs1282241007 802 dbSNP
rs1367205079 803 dbSNP
rs1041370342 807 dbSNP
rs1229065981 811 dbSNP
rs944696127 834 dbSNP
rs757382708 837 dbSNP
rs1004253584 838 dbSNP
rs1341627214 845 dbSNP
rs1194282551 852 dbSNP
rs1214870488 853 dbSNP
rs1443324319 860 dbSNP
rs568211724 862 dbSNP
rs1316769976 880 dbSNP
rs546809133 891 dbSNP
rs1241709123 899 dbSNP
rs1221376282 900 dbSNP
rs753894516 905 dbSNP
rs1366114256 920 dbSNP
rs1048368008 931 dbSNP
rs1474175618 936 dbSNP
rs995401674 943 dbSNP
rs528428291 944 dbSNP
rs1413574394 945 dbSNP
rs1282674758 946 dbSNP
rs1390564245 947 dbSNP
rs1400709813 950 dbSNP
rs1362667056 952 dbSNP
rs986157800 956 dbSNP
rs570736699 961 dbSNP
rs143461771 962 dbSNP
rs1344446016 963 dbSNP
rs205268 968 dbSNP
rs182481923 975 dbSNP
rs928413990 988 dbSNP
rs1445802281 999 dbSNP
rs1035250146 1014 dbSNP
rs1427141364 1015 dbSNP
rs982788664 1016 dbSNP
rs1477887407 1017 dbSNP
rs1413884268 1019 dbSNP
rs1457617145 1027 dbSNP
rs945744656 1034 dbSNP
rs547980061 1035 dbSNP
rs1388470612 1036 dbSNP
rs1331762014 1039 dbSNP
rs914219878 1041 dbSNP
rs1281682972 1046 dbSNP
rs529790693 1048 dbSNP
rs1023245000 1056 dbSNP
rs559734889 1059 dbSNP
rs1267915246 1060 dbSNP
rs1485349795 1061 dbSNP
rs1212155010 1067 dbSNP
rs139654166 1075 dbSNP
rs1450597325 1083 dbSNP
rs888194700 1085 dbSNP
rs116926307 1086 dbSNP
rs1253576213 1090 dbSNP
rs1472731777 1092 dbSNP
rs1181129581 1095 dbSNP
rs2744937 1096 dbSNP
rs112405508 1110 dbSNP
rs946758539 1112 dbSNP
rs1163838753 1114 dbSNP
rs1342525535 1126 dbSNP
rs1020149423 1128 dbSNP
rs1276526302 1132 dbSNP
rs1424156331 1136 dbSNP
rs1004284657 1142 dbSNP
rs1352502354 1144 dbSNP
rs1381805116 1150 dbSNP
rs1380209412 1157 dbSNP
rs1040945586 1161 dbSNP
rs1288043359 1166 dbSNP
rs1334423250 1167 dbSNP
rs767941596 1169 dbSNP
rs942596388 1184 dbSNP
rs1266594633 1186 dbSNP
rs951380696 1193 dbSNP
rs576362543 1210 dbSNP
rs11558663 1221 dbSNP
rs1403781370 1222 dbSNP
rs1050412838 1223 dbSNP
rs186636645 1226 dbSNP
rs572485603 1227 dbSNP
rs1190399462 1238 dbSNP
rs1188141298 1246 dbSNP
rs915294328 1255 dbSNP
rs1055713798 1263 dbSNP
rs754282210 1268 dbSNP
rs1052533887 1276 dbSNP
rs1430637333 1277 dbSNP
rs553230637 1288 dbSNP
rs1297876283 1291 dbSNP
rs907022289 1295 dbSNP
rs547130213 1296 dbSNP
rs935487921 1301 dbSNP
rs371555329 1305 dbSNP
rs1460291729 1324 dbSNP
rs1041471177 1329 dbSNP
rs1244440229 1330 dbSNP
rs1299092680 1334 dbSNP
rs1342343185 1338 dbSNP
rs534834116 1346 dbSNP
rs570626001 1348 dbSNP
rs182345956 1354 dbSNP
rs1484096677 1356 dbSNP
rs1200783884 1365 dbSNP
rs73409980 1368 dbSNP
rs533435756 1385 dbSNP
rs1054015339 1388 dbSNP
rs1190505552 1399 dbSNP
rs34243800 1406 dbSNP
rs936926039 1407 dbSNP
rs921548804 1408 dbSNP
rs975680945 1424 dbSNP
rs982332148 1428 dbSNP
rs1169969463 1440 dbSNP
rs1371513453 1443 dbSNP
rs944229770 1445 dbSNP
rs77499152 1446 dbSNP
rs1423630060 1447 dbSNP
rs72900436 1453 dbSNP
rs1397562479 1474 dbSNP
rs373855809 1482 dbSNP
rs1026991281 1484 dbSNP
rs974109745 1495 dbSNP
rs1313539338 1515 dbSNP
rs1335858892 1522 dbSNP
rs761234038 1525 dbSNP
rs958727038 1531 dbSNP
rs952392122 1533 dbSNP
rs191055331 1536 dbSNP
rs1402408781 1546 dbSNP
rs73745010 1552 dbSNP
rs965183468 1553 dbSNP
rs1368650142 1557 dbSNP
rs1185955380 1567 dbSNP
rs879369480 1577 dbSNP
rs1259759815 1591 dbSNP
rs907048029 1596 dbSNP
rs1020044982 1598 dbSNP
rs1429013674 1603 dbSNP
rs1019856703 1606 dbSNP
rs532579539 1608 dbSNP
rs1443149150 1609 dbSNP
rs1009947569 1610 dbSNP
rs892846988 1611 dbSNP
rs565090837 1618 dbSNP
rs1179656822 1622 dbSNP
rs1054128862 1628 dbSNP
rs1369185357 1631 dbSNP
rs1006762283 1647 dbSNP
rs543808255 1653 dbSNP
rs1459445301 1661 dbSNP
rs1282293802 1667 dbSNP
rs761454939 1672 dbSNP
rs1040381540 1678 dbSNP
rs1043001167 1691 dbSNP
rs1268550367 1692 dbSNP
rs1010883062 1694 dbSNP
rs1316210145 1707 dbSNP
rs776248506 1710 dbSNP
rs1195273242 1712 dbSNP
rs530756360 1713 dbSNP
rs1488886932 1724 dbSNP
rs878917983 1729 dbSNP
rs187043674 1730 dbSNP
rs1489540533 1732 dbSNP
rs866823205 1734 dbSNP
rs935572801 1739 dbSNP
rs1268501756 1741 dbSNP
rs1479598647 1742 dbSNP
rs982910258 1767 dbSNP
rs930127348 1776 dbSNP
rs561161118 1778 dbSNP
rs542985355 1780 dbSNP
rs935400166 1785 dbSNP
rs1302019090 1786 dbSNP
rs928105060 1791 dbSNP
rs562015605 1795 dbSNP
rs1288674339 1796 dbSNP
rs1372433546 1804 dbSNP
rs948248959 1810 dbSNP
rs1390900546 1812 dbSNP
rs916797395 1817 dbSNP
rs981778056 1821 dbSNP
rs984352247 1823 dbSNP
rs1291164304 1827 dbSNP
rs572320095 1830 dbSNP
rs760676999 1833 dbSNP
rs1384249912 1837 dbSNP
rs554322265 1842 dbSNP
rs1233799016 1856 dbSNP
rs1469988380 1858 dbSNP
rs550963252 1861 dbSNP
rs1416535777 1863 dbSNP
rs1424923314 1887 dbSNP
rs775232908 1902 dbSNP
rs771934322 1903 dbSNP
rs1363172926 1905 dbSNP
rs972456504 1907 dbSNP
rs892962616 1909 dbSNP
rs1353687023 1910 dbSNP
rs965496883 1917 dbSNP
rs1032749289 1923 dbSNP
rs1304407673 1950 dbSNP
rs995919079 1957 dbSNP
rs1245172683 1965 dbSNP
rs577111843 1967 dbSNP
rs1357441208 1968 dbSNP
rs558779342 1969 dbSNP
rs1274024124 1970 dbSNP
rs1008900322 1972 dbSNP
rs1202805123 1973 dbSNP
rs891423869 1983 dbSNP
rs1462104801 1984 dbSNP
rs1183586403 1988 dbSNP
rs536985612 1993 dbSNP
rs930157028 2001 dbSNP
rs920073022 2006 dbSNP
rs375497616 2010 dbSNP
rs927293412 2011 dbSNP
rs981425731 2019 dbSNP
rs774684881 2031 dbSNP
rs1451823945 2034 dbSNP
rs1220396120 2037 dbSNP
rs971800027 2040 dbSNP
rs1021527453 2041 dbSNP
rs541689009 2063 dbSNP
rs1287067471 2071 dbSNP
rs1217024650 2073 dbSNP
rs771030604 2079 dbSNP
rs1338916054 2082 dbSNP
rs1213030886 2092 dbSNP
rs1281162248 2107 dbSNP
rs1324789453 2122 dbSNP
rs1277687909 2123 dbSNP
rs988673358 2124 dbSNP
rs1238170076 2128 dbSNP
rs1331614116 2133 dbSNP
rs59283256 2139 dbSNP
rs891745697 2157 dbSNP
rs1402613946 2160 dbSNP
rs1032780368 2175 dbSNP
rs1298503067 2178 dbSNP
rs1241034365 2185 dbSNP
rs1474186339 2186 dbSNP
rs1052858075 2188 dbSNP
rs999572982 2190 dbSNP
rs1158360306 2195 dbSNP
rs1466971054 2197 dbSNP
rs1379901472 2202 dbSNP
rs964455820 2205 dbSNP
rs1457709586 2212 dbSNP
rs569915649 2213 dbSNP
rs1008598531 2216 dbSNP
rs1428883508 2221 dbSNP
rs1046483993 2222 dbSNP
rs749440084 2236 dbSNP
rs184129143 2237 dbSNP
rs1196191387 2246 dbSNP
rs759758980 2246 dbSNP
rs1047368426 2252 dbSNP
rs1048571192 2261 dbSNP
rs994398740 2263 dbSNP
rs1445509057 2266 dbSNP
rs529592747 2270 dbSNP
rs1200528120 2273 dbSNP
rs898677705 2275 dbSNP
rs574944139 2276 dbSNP
rs55661036 2288 dbSNP
rs1345604064 2289 dbSNP
rs1038502127 2292 dbSNP
rs1470464906 2301 dbSNP
rs1157992426 2313 dbSNP
rs1384306486 2317 dbSNP
rs1399076539 2323 dbSNP
rs937424584 2337 dbSNP
rs1366382553 2342 dbSNP
rs1404571545 2344 dbSNP
rs1139976 2346 dbSNP
rs1352775196 2359 dbSNP
rs1240378949 2360 dbSNP
rs1264975028 2361 dbSNP
rs927439370 2363 dbSNP
rs1349196071 2369 dbSNP
rs547095948 2373 dbSNP
rs1291878801 2384 dbSNP
rs1344384541 2386 dbSNP
rs918877351 2395 dbSNP
rs532075223 2396 dbSNP
rs562100201 2402 dbSNP
rs943724609 2408 dbSNP
rs373387437 2415 dbSNP
rs1180972277 2421 dbSNP
rs912267787 2428 dbSNP
rs985244979 2438 dbSNP
rs1278296774 2443 dbSNP
rs528275829 2446 dbSNP
rs774470244 2447 dbSNP
rs1432379515 2449 dbSNP
rs777821632 2453 dbSNP
rs375068970 2465 dbSNP
rs867478963 2468 dbSNP
rs957253879 2475 dbSNP
rs1399039186 2480 dbSNP
rs1392285095 2482 dbSNP
rs1408897621 2486 dbSNP
rs1247645503 2492 dbSNP
rs1315123027 2493 dbSNP
rs990016402 2494 dbSNP
rs925782677 2496 dbSNP
rs1276395591 2499 dbSNP
rs1480767257 2512 dbSNP
rs559088742 2513 dbSNP
rs955938457 2516 dbSNP
rs1248153248 2522 dbSNP
rs1444007719 2524 dbSNP
rs1184192410 2525 dbSNP
rs748654952 2531 dbSNP
rs190543604 2532 dbSNP
rs1172914024 2533 dbSNP
rs770786213 2537 dbSNP
rs1167645949 2544 dbSNP
rs1474525741 2544 dbSNP
rs1394860102 2557 dbSNP
rs999901365 2559 dbSNP
rs1461278540 2560 dbSNP
rs1018726871 2561 dbSNP
rs906548495 2565 dbSNP
rs186225321 2573 dbSNP
rs1244879689 2574 dbSNP
rs11558664 2578 dbSNP
rs781507181 2584 dbSNP
rs1025457725 2594 dbSNP
rs976975192 2613 dbSNP
rs964199069 2618 dbSNP
rs1307648923 2623 dbSNP
rs531939069 2629 dbSNP
rs1012269027 2632 dbSNP
rs1201872 2633 dbSNP
rs1322743197 2634 dbSNP
rs1346938510 2636 dbSNP
rs1048538669 2637 dbSNP
rs994429767 2640 dbSNP
rs898708837 2646 dbSNP
rs1181764731 2650 dbSNP
rs1017600413 2655 dbSNP
rs34941561 2676 dbSNP
rs398001123 2676 dbSNP
rs931481764 2679 dbSNP
rs542916705 2681 dbSNP
rs1215840783 2685 dbSNP
rs897364285 2694 dbSNP
rs906011320 2699 dbSNP
rs181275247 2700 dbSNP
rs943677445 2704 dbSNP
rs1468702458 2705 dbSNP
rs560478113 2708 dbSNP
rs140962880 2709 dbSNP
rs1401703230 2711 dbSNP
rs543574783 2714 dbSNP
rs1381294874 2720 dbSNP
rs545562531 2730 dbSNP
rs1330919396 2733 dbSNP
rs912211363 2738 dbSNP
rs751845068 2742 dbSNP
rs891808003 2743 dbSNP
rs764979343 2747 dbSNP
rs369138720 2748 dbSNP
rs558820171 2752 dbSNP
rs543626280 2753 dbSNP
rs1259856227 2765 dbSNP
rs925928269 2765 dbSNP
rs975053581 2772 dbSNP
rs1200514593 2777 dbSNP
rs932381768 2778 dbSNP
rs1446687464 2788 dbSNP
rs1479734412 2796 dbSNP
rs554851602 2797 dbSNP
rs1161993873 2798 dbSNP
rs554861043 2803 dbSNP
rs536112602 2804 dbSNP
rs1366982697 2812 dbSNP
rs16891465 2818 dbSNP
rs1282385658 2821 dbSNP
rs911690569 2823 dbSNP
rs1225366707 2848 dbSNP
rs1307678627 2854 dbSNP
rs1316295014 2856 dbSNP
rs1205965589 2861 dbSNP
rs553343717 2862 dbSNP
rs987232816 2863 dbSNP
rs1490884751 2870 dbSNP
rs1435635132 2876 dbSNP
rs200685254 2877 dbSNP
rs1223575763 2880 dbSNP
rs985836723 2893 dbSNP
rs1031978364 2896 dbSNP
rs1489972831 2897 dbSNP
rs543402553 2915 dbSNP
rs1361154326 2918 dbSNP
rs1409289771 2920 dbSNP
rs1313318913 2928 dbSNP
rs1419013746 2939 dbSNP
rs11752024 2945 dbSNP
rs1156248606 2949 dbSNP
rs190064617 2950 dbSNP
rs75954598 2953 dbSNP
rs1302193005 2955 dbSNP
rs973103783 2956 dbSNP
rs1444047072 2969 dbSNP
rs756963712 2970 dbSNP
rs1372442739 2971 dbSNP
rs1017212968 2974 dbSNP
rs1012239361 2975 dbSNP
rs906047533 2982 dbSNP
rs575875574 2986 dbSNP
rs1027032481 2996 dbSNP
rs1046318 2998 dbSNP
rs1426744557 3010 dbSNP
rs1207011241 3011 dbSNP
rs549582038 3017 dbSNP
rs1176054628 3023 dbSNP
rs1161422768 3030 dbSNP
rs1443817093 3031 dbSNP
rs1408614886 3041 dbSNP
rs1178935614 3043 dbSNP
rs1468544368 3054 dbSNP
rs951697838 3059 dbSNP
rs531947770 3061 dbSNP
rs1231750330 3064 dbSNP
rs34001620 3070 dbSNP
rs1053125739 3071 dbSNP
rs897338222 3073 dbSNP
rs1221697706 3074 dbSNP
rs1490724248 3075 dbSNP
rs1037628891 3076 dbSNP
rs1008465969 3077 dbSNP
rs1170810956 3079 dbSNP
rs1222212000 3080 dbSNP
rs763709918 3098 dbSNP
rs1338663326 3101 dbSNP
rs1309624336 3103 dbSNP
rs1453399026 3111 dbSNP
rs1222499634 3112 dbSNP
rs1373295527 3118 dbSNP
rs567718276 3121 dbSNP
rs1216611538 3122 dbSNP
rs1274147806 3127 dbSNP
rs1307328703 3128 dbSNP
rs1197279616 3130 dbSNP
rs1265491872 3132 dbSNP
rs1462179836 3134 dbSNP
rs549654405 3135 dbSNP
rs1182372076 3136 dbSNP
rs1049420792 3138 dbSNP
rs932308335 3141 dbSNP
rs1476182466 3142 dbSNP
rs914291178 3144 dbSNP
rs1186811345 3146 dbSNP
rs1054220830 3170 dbSNP
rs1406901851 3178 dbSNP
rs527984759 3185 dbSNP
rs934466169 3197 dbSNP
rs1038969892 3198 dbSNP
rs1321288693 3213 dbSNP
rs1469229593 3213 dbSNP
rs943252281 3218 dbSNP
rs911736701 3223 dbSNP
rs1345503776 3226 dbSNP
rs186596607 3228 dbSNP
rs1361556386 3231 dbSNP
rs1217142879 3238 dbSNP
rs1398837205 3240 dbSNP
rs981712495 3241 dbSNP
rs545402733 3246 dbSNP
rs1275887388 3248 dbSNP
rs1448265320 3252 dbSNP
rs971333442 3254 dbSNP
rs3177423 3264 dbSNP
rs3177424 3266 dbSNP
rs3177425 3268 dbSNP
rs963098286 3270 dbSNP
rs973134924 3270 dbSNP
rs1481154508 3271 dbSNP
rs915870142 3273 dbSNP
rs990744957 3277 dbSNP
rs1429814412 3278 dbSNP
rs760223446 3278 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.616 1.9e-3 -0.746 8.0e-5 20 Click to see details
GSE38226 Liver fibrosis 0.594 2.3e-3 0.534 6.3e-3 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.432 1.6e-2 -0.287 8.2e-2 25 Click to see details
GSE32688 Pancreatic cancer 0.347 2.6e-2 0.465 3.7e-3 32 Click to see details
GSE42095 Differentiated embryonic stem cells 0.408 2.7e-2 0.391 3.3e-2 23 Click to see details
GSE19783 ER+ ER+ breast cancer -0.342 7.0e-2 -0.392 4.4e-2 20 Click to see details
GSE28260 Renal cortex and medulla -0.362 1.1e-1 -0.368 1.1e-1 13 Click to see details
GSE14794 Lymphoblastoid cells 0.107 1.6e-1 0.058 2.9e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.173 2.0e-1 0.270 9.6e-2 25 Click to see details
GSE21687 Ependynoma primary tumors -0.105 2.0e-1 -0.091 2.4e-1 64 Click to see details
GSE17306 Multiple myeloma -0.1 2.5e-1 -0.117 2.1e-1 49 Click to see details
GSE19536 Breast cancer -0.065 2.6e-1 -0.055 2.9e-1 100 Click to see details
GSE21849 B cell lymphoma -0.118 2.7e-1 -0.148 2.2e-1 29 Click to see details
GSE27834 Pluripotent stem cells 0.131 3.1e-1 -0.015 4.8e-1 16 Click to see details
GSE19350 CNS germ cell tumors -0.104 3.7e-1 -0.301 1.7e-1 12 Click to see details
GSE19783 ER- ER- breast cancer -0.036 3.8e-1 0.010 4.7e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells -0.054 4.0e-1 -0.042 4.2e-1 24 Click to see details
GSE21032 Prostate cancer -0.023 4.2e-1 0.017 4.4e-1 83 Click to see details
GSE28544 Breast cancer 0.012 4.8e-1 0.077 3.6e-1 24 Click to see details
GSE17498 Multiple myeloma -0.009 4.8e-1 -0.199 1.1e-1 40 Click to see details
GSE17498 Multiple myeloma -0.009 4.8e-1 -0.199 1.1e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.368 0 0.378 0 84 Click to see details
LUAD -0.63 0.01 -0.566 0.03 12 Click to see details
LUSC -0.246 0.07 -0.282 0.04 38 Click to see details
CHOL -0.502 0.08 -0.517 0.08 9 Click to see details
BLCA -0.321 0.1 -0.271 0.14 18 Click to see details
KIRP -0.156 0.2 -0.095 0.3 32 Click to see details
KIRC 0.084 0.25 0.027 0.41 68 Click to see details
PRAD -0.095 0.26 -0.056 0.35 50 Click to see details
PCPG -0.682 0.26 -0.500 0.33 3 Click to see details
UCEC -0.155 0.26 -0.253 0.15 19 Click to see details
COAD 0.247 0.28 0.238 0.29 8 Click to see details
KICH 0.114 0.29 0.260 0.1 25 Click to see details
HNSC -0.066 0.34 -0.106 0.25 42 Click to see details
LIHC 0.056 0.35 0.126 0.19 49 Click to see details
ESCA -0.101 0.38 -0.264 0.22 11 Click to see details
PAAD -0.225 0.39 0.400 0.3 4 Click to see details
THCA -0.014 0.46 -0.016 0.45 59 Click to see details
STAD 0.016 0.47 0.032 0.43 32 Click to see details
CESC -0.079 0.47 -0.500 0.33 3 Click to see details
CESC -0.079 0.47 -0.500 0.33 3 Click to see details
CESC -0.079 0.47 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*