miRTarBase - #MIRT000012


—
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
miRNA Oxidation Modification
Oxidation Position Sequence (5'-3') Target Gene Validation Method PMID
3 UGGAGUGUGACAAUGGUGUUUG AKT1S1; IL6ST; TMEM170B; NHLRC2 Luciferase reporter assay 37696949
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Microarrays; Real-time quantitative RT-PCR analysis
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Liver tissue Microarrays; Real-time quantitative RT-PCR analysis
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Liver tissue Quantitative real-time reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Quantitative real-time reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Quantitative reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data expression Increase Serum Quantitative reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression . Blood Polymerase chain reaction
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Quantitative polymerase chain reaction
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Higher Blood Polymerase chain reaction
Gene Information
Gene Symbol CYP7A1   
Synonyms CP7A, CYP7, CYPVII
Description cytochrome P450 family 7 subfamily A member 1
Transcript NM_000780   
Expression
Putative miRNA Targets on CYP7A1
3'UTR of CYP7A1
(miRNA target sites are highlighted)		 
>CYP7A1|NM_000780|3'UTR
   1 ATACATGGCTGGAATAAGAGGACACTAGATGATATTACAGGACTGCAGAACACCCTCACCACACAGTCCCTTTGGACAAA
  81 TGCATTTAGTGGTGGTAGAAATGATTCACCAGGTCCAATGTTGTTCACCAGTGCTTGCTTGTGAATCTTAACATTTTGGT
 161 GACAGTTTCCAGATGCTATCACAGACTCTGCTAGTGAAAAGAACTAGTTTCTAGGAGCACAATAATTTGTTTTCATTTGT
 241 ATAAGTCCATGAATGTTCATATAGCCAGGGATTGAAGTTTATTATTTTCAAAGGAAAACACCTTTATTTTATTTTTTTTC
 321 AAAATGAAGATACACATTACAGCCAGGTGTGGTAGCAGGCACCTGTAGTCTTAGCTACTCGAGAGGCCAAAGAAGGAGGA
 401 TGGCTTGAGCCCAGGAGTTCAAGACCAGCCTGGACAGCTTAGTGAGATCCCGTCTCCGAAGAAAAGATATGTATTCTAAT
 481 TGGCAGATTGTTTTTTCCTAAGGAAACTGCTTTATTTTTATAAAACTGCCTGACAATTATGAAAAAATGTTCAAATTCAC
 561 GTTCTAGTGAAACTGCATTATTTGTTGACTAGATGGTGGGGTTCTTCGGGTGTGATCATATATCATAAAGGATATTTCAA
 641 ATGATTATGATTAGTTATGTCTTTTAATAAAAAGGAAATATTTTTCAACTTCTTCTATATCCAAAATTCAGGGCTTTAAA
 721 CATGATTATCTTGATTTCCCAAAAACACTAAAGGTGGTTTTATTTTCCCTTCATGTTTTAACTTATTGTTGCTGAAAACT
 801 CTATGTCCGGCTTTAACTATCTTCTCTATATTTTTATTTCATTCACATTAATGAGAAGAGTTTTCTCAGAGATTAAAAAA
 881 GGTAGTTTTTCTGTCATTGTTAAATACACATTATCACTGAAAAAATGTAGCTTTTATGTGATATGTTTTAAAGTTAAAAC
 961 TGGATGGAAATAGCCATTTGGAAGCTTTGGTTATGAAACATGTGGAGTGTATTAAGTGCAGCTTGACATTATGTTTTATT
1041 TAAATGCTTTTTATCGCTAAATGACTTGCAGATGAAAAAAACTAAGGTGACTCGAGTGTTTAAATGCTGTGTACAACAAT
1121 GCTTTGATAAAATATTTTAAGTATGAGTTATCAGCTCTATGTCAATTGATATTTCTGTGTAGTATTTATATTTAAATTAT
1201 ATTTACCTTTTTGCTTATTTTACAAATATTAAGAAAATATTCTAACATTTGATAATTTTGAAATGATTCATCTTTCAGAA
1281 ATAAAAGTATGAATCTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guUUGUGGUAACAGUGUG--AGGu 5'
            |||||| |   |||||  ||| 
Target 5' agAACACCCTCACCACACAGTCCc 3'
 47 - 70 128.00 -14.90
2 
miRNA  3' guUUGUGGUAACAGUGU--GAGGu 5'
            ||||:: | || |||  :||| 
Target 5' ttAACATTTTGGTGACAGTTTCCa 3'
 148 - 171 112.00 -12.80
3 
miRNA  3' guUUGUGGUAACAG-----UGUGAGGu 5'
            ||| ::|||||:     | ||||: 
Target 5' ttAAC-TTATTGTTGCTGAAAACTCTa 3'
 778 - 803 111.00 -9.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
500154 5 ClinVar
598241 7 ClinVar
COSN31522535 4 COSMIC
COSN30450536 11 COSMIC
COSN30109623 48 COSMIC
COSN30126826 76 COSMIC
COSN28750038 89 COSMIC
COSN6700796 145 COSMIC
COSN20091816 159 COSMIC
COSN1366498 191 COSMIC
COSN31605439 222 COSMIC
COSN23483971 223 COSMIC
COSN6700795 463 COSMIC
COSN15327812 561 COSMIC
COSN9662492 713 COSMIC
COSN25329403 801 COSMIC
COSN32058771 808 COSMIC
COSN21079724 1012 COSMIC
COSN21369161 1036 COSMIC
COSN19276459 1109 COSMIC
COSN26896699 1163 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs994759816 3 dbSNP
rs778327081 13 dbSNP
rs202095133 14 dbSNP
rs906672889 16 dbSNP
rs756395581 20 dbSNP
rs1185494218 22 dbSNP
rs753038760 29 dbSNP
rs1273612066 31 dbSNP
rs1197424370 36 dbSNP
rs1337373695 40 dbSNP
rs767569293 41 dbSNP
rs377678679 45 dbSNP
rs1357580326 49 dbSNP
rs894225424 54 dbSNP
rs960213485 55 dbSNP
rs1227326117 57 dbSNP
rs1296030624 59 dbSNP
rs1036368934 63 dbSNP
rs1055417207 68 dbSNP
rs1461685090 75 dbSNP
rs951464486 77 dbSNP
rs1471379514 82 dbSNP
rs1026975346 84 dbSNP
rs935650904 90 dbSNP
rs1181458586 91 dbSNP
rs1420700850 105 dbSNP
rs925891021 117 dbSNP
rs372791681 118 dbSNP
rs1168945628 126 dbSNP
rs1400296402 133 dbSNP
rs530421749 134 dbSNP
rs1335635372 137 dbSNP
rs1356865673 141 dbSNP
rs964118034 145 dbSNP
rs1289034275 150 dbSNP
rs561468580 151 dbSNP
rs977282279 163 dbSNP
rs945881161 172 dbSNP
rs922423034 175 dbSNP
rs1277323086 176 dbSNP
rs1324208305 211 dbSNP
rs1225199089 222 dbSNP
rs1431399333 243 dbSNP
rs890927790 245 dbSNP
rs1440725793 247 dbSNP
rs1209481578 250 dbSNP
rs1052785106 257 dbSNP
rs976990236 273 dbSNP
rs1192023640 282 dbSNP
rs1265167898 292 dbSNP
rs964193657 301 dbSNP
rs903765200 305 dbSNP
rs1174787862 316 dbSNP
rs1422470026 320 dbSNP
rs1413458308 322 dbSNP
rs142956490 330 dbSNP
rs1362134858 333 dbSNP
rs1397691479 335 dbSNP
rs1335204884 337 dbSNP
rs1345870515 338 dbSNP
rs1438551947 340 dbSNP
rs947684205 346 dbSNP
rs78764820 347 dbSNP
rs186006436 349 dbSNP
rs545931947 352 dbSNP
rs1218792153 359 dbSNP
rs1056199230 362 dbSNP
rs952665619 366 dbSNP
rs1348725096 368 dbSNP
rs1025914676 379 dbSNP
rs780769821 380 dbSNP
rs983345618 381 dbSNP
rs994396394 387 dbSNP
rs776462170 417 dbSNP
rs906696133 430 dbSNP
rs1239843974 431 dbSNP
rs1338112827 434 dbSNP
rs117214002 451 dbSNP
rs560099891 452 dbSNP
rs539896835 454 dbSNP
rs760324946 457 dbSNP
rs8192879 458 dbSNP
rs999832017 460 dbSNP
rs1406720449 462 dbSNP
rs1018321187 466 dbSNP
rs1321337605 466 dbSNP
rs1330510320 467 dbSNP
rs904165019 470 dbSNP
rs1470877224 481 dbSNP
rs1379156776 486 dbSNP
rs139749104 491 dbSNP
rs538023814 509 dbSNP
rs1030868702 514 dbSNP
rs1285633446 514 dbSNP
rs1360394891 526 dbSNP
rs1042031350 528 dbSNP
rs999754143 530 dbSNP
rs903796571 534 dbSNP
rs561226849 539 dbSNP
rs894780753 540 dbSNP
rs1056622034 547 dbSNP
rs1177435238 548 dbSNP
rs922504643 559 dbSNP
rs1040910771 560 dbSNP
rs1473568466 561 dbSNP
rs558591940 565 dbSNP
rs1206526188 573 dbSNP
rs1445553826 581 dbSNP
rs1389660859 596 dbSNP
rs942491079 601 dbSNP
rs180955836 605 dbSNP
rs368181476 607 dbSNP
rs189709089 608 dbSNP
rs748716326 621 dbSNP
rs1341355369 623 dbSNP
rs762121244 632 dbSNP
rs546967036 640 dbSNP
rs1356037153 645 dbSNP
rs1199644602 652 dbSNP
rs911261784 654 dbSNP
rs987197708 659 dbSNP
rs1344308156 665 dbSNP
rs973141283 692 dbSNP
rs1425190058 695 dbSNP
rs1318534838 697 dbSNP
rs1184905389 698 dbSNP
rs536288411 701 dbSNP
rs1367701188 703 dbSNP
rs567930133 704 dbSNP
rs1401990213 718 dbSNP
rs1475646406 723 dbSNP
rs955513914 725 dbSNP
rs1373118800 728 dbSNP
rs1031485784 741 dbSNP
rs971037551 748 dbSNP
rs1025630759 749 dbSNP
rs1012434674 752 dbSNP
rs1402955657 760 dbSNP
rs1398030349 769 dbSNP
rs977971627 770 dbSNP
rs959504512 782 dbSNP
rs1034072246 788 dbSNP
rs999864767 793 dbSNP
rs904281116 805 dbSNP
rs551014467 808 dbSNP
rs1010301816 809 dbSNP
rs1218489970 813 dbSNP
rs901111184 814 dbSNP
rs1041334984 817 dbSNP
rs1256105955 828 dbSNP
rs1483918446 834 dbSNP
rs1198207826 847 dbSNP
rs1255091082 849 dbSNP
rs185745374 853 dbSNP
rs181448815 860 dbSNP
rs911023743 869 dbSNP
rs1048510881 870 dbSNP
rs1177013546 872 dbSNP
rs1379279905 876 dbSNP
rs1467686473 881 dbSNP
rs1034718525 883 dbSNP
rs781125469 883 dbSNP
rs931424696 900 dbSNP
rs1448920508 907 dbSNP
rs918658307 909 dbSNP
rs552258414 914 dbSNP
rs1401837745 917 dbSNP
rs189057253 926 dbSNP
rs879916345 926 dbSNP
rs867326531 927 dbSNP
rs1400780344 932 dbSNP
rs1300440569 936 dbSNP
rs560031004 944 dbSNP
rs1003600453 967 dbSNP
rs1302645414 970 dbSNP
rs1314424747 971 dbSNP
rs1278292980 980 dbSNP
rs1210184395 981 dbSNP
rs886206971 982 dbSNP
rs1047904778 996 dbSNP
rs567109509 1002 dbSNP
rs972783580 1002 dbSNP
rs1260798803 1005 dbSNP
rs1487869445 1007 dbSNP
rs572623842 1018 dbSNP
rs1269462126 1024 dbSNP
rs918190242 1026 dbSNP
rs1283085040 1028 dbSNP
rs1377076314 1032 dbSNP
rs990998511 1039 dbSNP
rs959537186 1047 dbSNP
rs1032512942 1055 dbSNP
rs574379542 1056 dbSNP
rs1271088148 1057 dbSNP
rs1432464626 1058 dbSNP
rs184686288 1063 dbSNP
rs1311807382 1075 dbSNP
rs968471361 1078 dbSNP
rs1419522628 1080 dbSNP
rs1294480515 1083 dbSNP
rs1434793590 1085 dbSNP
rs1038500116 1091 dbSNP
rs1020433077 1093 dbSNP
rs1009920491 1094 dbSNP
rs779374933 1098 dbSNP
rs544115148 1099 dbSNP
rs193237767 1109 dbSNP
rs986843723 1117 dbSNP
rs867552656 1118 dbSNP
rs1352526859 1120 dbSNP
rs1222106155 1122 dbSNP
rs933962623 1127 dbSNP
rs1487467842 1133 dbSNP
rs866976347 1134 dbSNP
rs1187979420 1135 dbSNP
rs1006772647 1139 dbSNP
rs1252473686 1140 dbSNP
rs544650578 1145 dbSNP
rs889704127 1146 dbSNP
rs1048291925 1150 dbSNP
rs769052834 1152 dbSNP
rs558334185 1157 dbSNP
rs146855239 1159 dbSNP
rs1165941948 1163 dbSNP
rs1351910242 1169 dbSNP
rs1456865035 1170 dbSNP
rs1293511938 1183 dbSNP
rs1401624821 1185 dbSNP
rs1037495597 1188 dbSNP
rs1187402366 1189 dbSNP
rs949422394 1193 dbSNP
rs1486022763 1197 dbSNP
rs1306443308 1199 dbSNP
rs917873382 1200 dbSNP
rs573275244 1206 dbSNP
rs868479803 1213 dbSNP
rs959297677 1229 dbSNP
rs1319647725 1239 dbSNP
rs1258674553 1242 dbSNP
rs553223766 1247 dbSNP
rs1035322719 1253 dbSNP
rs1003222261 1265 dbSNP
rs1236367382 1266 dbSNP
rs1480431030 1268 dbSNP
rs1182624190 1270 dbSNP
rs780042271 1287 dbSNP
rs1422481923 1293 dbSNP
rs1164660760 1295 dbSNP
rs990779316 1297 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HepG2
Disease hyperlipidemia;
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan , miRBase Target Database
Original Description (Extracted from the article) ... "In this study we focused on miR-122a and miR-422a since putative binding sites for those two miRNAs are localized in the 3芒鈧鈩-UTR of CYP7A1 mRNA. Inhibition of CYP7A1 mRNA expression by miR-122a-mimic and miR-422a-mimic "Target validation of miR-122a and miR-422a on the 3芒鈧鈩-UTR of human CYP7A1 mRNA//The miR-122a- and miR-422a-mimics nhibited ...

- Song KH; Li T; Owsley E; Chiang JY, 2010, Journal of lipid research.

Article - Song KH; Li T; Owsley E; Chiang JY
- Journal of lipid research, 2010
Cholesterol 7alpha-hydroxylase (CYP7A1) plays a critical role in regulation of bile acid synthesis in the liver. CYP7A1 mRNAs have very short half-lives, and bile acids destabilize CYP7A1 mRNA via the 3'-untranslated region (3'-UTR). However, the underlying mechanism of translational regulation of CYP7A1 mRNA remains unknown. Screening of a human micro RNA (miRNA) microarray has identified five differentially expressed miRNAs in human primary hepatocytes treated with chenodeoxycholic acid, GW4064, or fibroblast growth factor (FGF)19. These compounds also significantly induced the expression of miR-122a, a liver-specific and the predominant miRNA in human hepatocytes. The putative recognition sequences for miR-122a and miR-422a were localized in the 3'-UTR of human CYP7A1 mRNA. The miR-122a and miR-422a mimics inhibited, whereas their inhibitors stimulated CYP7A1 mRNA expression. These miRNAs specifically inhibited the activity of the CYP7A1-3'-UTR reporter plasmids, and mutations of miRNA binding sites in 3'-UTR abrogated miRNA inhibition of reporter activity. These results suggest that miR-122a and miR-422a may destabilize CYP7A1 mRNA to inhibit CYP7A1 expression. However, these miRNAs did not play a role in mediating FGF19 inhibition of CYP7A1 transcription. Under certain conditions, miRNA may reduce CYP7A1 mRNA stability to inhibit bile acid synthesis, and the miR-122a antagomirs may stimulate bile acid synthesis to reduce serum cholesterol and triglycerides.
LinkOut: [PMID: 20351063]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19350 CNS germ cell tumors -0.668 8.8e-3 -0.357 1.3e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.358 4.3e-2 -0.463 1.1e-2 24 Click to see details
GSE38226 Liver fibrosis 0.365 5.2e-2 0.513 8.7e-3 21 Click to see details
GSE28260 Renal cortex and medulla 0.389 9.4e-2 0.297 1.6e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.249 1.2e-1 0.116 2.9e-1 25 Click to see details
GSE17306 Multiple myeloma -0.138 1.7e-1 -0.073 3.1e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.073 2.5e-1 0.071 2.5e-1 90 Click to see details
GSE27834 Pluripotent stem cells -0.177 2.6e-1 -0.256 1.7e-1 16 Click to see details
GSE28544 Breast cancer -0.089 3.4e-1 -0.009 4.8e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.069 3.7e-1 0.220 1.5e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.037 3.9e-1 -0.037 3.9e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.036 4.2e-1 0.092 3.1e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.045 4.3e-1 -0.110 3.2e-1 20 Click to see details
GSE21849 B cell lymphoma 0.013 4.7e-1 0.274 7.5e-2 29 Click to see details
GSE17498 Multiple myeloma 0.008 4.8e-1 -0.097 2.8e-1 40 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.015 4.9e-1 0.029 4.8e-1 6 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP -0.896 0 -0.733 0.01 9 Click to see details
LIHC 0.356 0.01 0.054 0.36 49 Click to see details
CHOL 0.613 0.04 0.450 0.11 9 Click to see details
KICH 0.365 0.19 0.500 0.1 8 Click to see details
ESCA -0.396 0.25 -0.400 0.25 5 Click to see details
THCA -0.361 0.28 0.000 0.5 5 Click to see details
STAD 0.218 0.3 0.262 0.27 8 Click to see details
HNSC 0.375 0.38 -0.500 0.33 3 Click to see details
KIRC -0.01 0.48 -0.077 0.35 29 Click to see details
KIRC -0.01 0.48 -0.077 0.35 29 Click to see details
KIRC -0.01 0.48 -0.077 0.35 29 Click to see details
KIRC -0.01 0.48 -0.077 0.35 29 Click to see details
KIRC -0.01 0.48 -0.077 0.35 29 Click to see details
KIRC -0.01 0.48 -0.077 0.35 29 Click to see details
548 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 7 5
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 4 3
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
MIRT755352 IGFBP4 insulin like growth factor binding protein 4 6 1
MIRT755559 DLAT dihydrolipoamide S-acetyltransferase 1 1
MIRT755560 RIMS1 regulating synaptic membrane exocytosis 1 1 1
MIRT756173 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 4 1
MIRT756174 DGAT1 diacylglycerol O-acyltransferase 1 4 1
MIRT756175 TG thyroglobulin 4 1
MIRT756400 SMAD3 SMAD family member 3 3 1
MIRT756415 MUC1 mucin 1, cell surface associated 3 1
MIRT756436 BCL9 B-cell CLL/lymphoma 9 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-122 Quercetin NULL 5280343 Quantitative real-time PCR liver 22402395 2012 up-regulated
miR-122 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Quantitative real-time PCR thymus 23024791 2012 up-regulated
miR-122 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-122 Streptozotocin (STZ) NULL 29327 Microarray streptozotocin (STZ)-induced type 1 diabetic mice 19372595 2009 down-regulated
miR-122 Streptozotocin (STZ) NULL 29327 Quantitative real-time PCR streptozotocin (STZ)-induced type 1 diabetic mice 19372595 2009 down-regulated
miR-122 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-122 Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 down-regulated
miR-122 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-122 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-122 Bortezomib approved 387447 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 Doxorubicin approved 31703 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 MG132 NULL 462382 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 Microcystin-LR (MC-LR) NULL 445434 Quantitative real-time PCR WRL-68 Cells 22265967 2012 down-regulated
miR-122 Furan NULL 8029 Quantitative real-time PCR liver 22079235 2011 down-regulated
miR-122 Proanthocyanidins approved 108065 Quantitative real-time PCR liver cells 23922812 2013 down-regualted
miR-122 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miR-122 Dexamethasone approved 5743 Quantitative real-time PCR adrenals and granulosa cells 24205079 2014 down-regulated
miR-122 Proanthocyanidins approved 108065 Quantitative real-time PCR postprandial lipemia and liver 24445039 2014 down-regulated
miR-122 Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 down-regualted
miR-122 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-122 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-122 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-122 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-122 Decitabine 451668 approved resistant tissue (esopheageal cancer)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Hep3B, SK-Hep-1)
hsa-miR-122-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma tissue and cell line (Huh-7)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma tissue and cell line (Huh-7)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (Hep3B, HepG2, Huh7, PLC/PRF/5, HEK293)
hsa-miR-122-5p Vincristine 5978 approved sensitive Low Hepatocellular Carcinoma cell line (Hep3B, HepG2, Huh7, PLC/PRF/5, HEK293)
hsa-miR-122-5p Bortezomib 387447 NSC681239 approved resistant Low Cutaneous T-Cell Lymphoma cell line (SeAx, MyLa2000)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved resistant Low Cutaneous T-Cell Lymphoma cell line (SeAx, MyLa2000)
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatoblastoma cell line (BEL-7402)
hsa-miR-122-5p Pegifn/Rbv Therapy sensitive Low Chronic Hepatitis C tissue
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer tissue
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-122-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-122-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer tissue and cell line (HCT-116, HCT-29)
hsa-miR-122-5p Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-122-5p Pegylated Alpha Interferon + Ribavirin sensitive Low Hepatitis C Virus Injection tissue
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (PLC, Huh7)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved resistant Low Hepatocellular Carcinoma cell line (SNU-449, MHCC97, HepG2, SMMC-7721)
hsa-miR-122-5p Taxol 36314 NSC125973 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-122-5p Cisplatin 5460033 NSC119875 approved resistant Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-122-5p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (SW480, HT-29)
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Hepatocellular Carcinoma cell line (Bel-7402, SMMC-7721)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Hep3B, Huh-7)
hsa-miR-122-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-TT)
hsa-miR-122-5p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-122-5p Bromocriptine 31101 NSC169774 approved sensitive High Prolactinoma tissue
hsa-miR-122-5p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-122-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-122-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-122-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-122-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-122-5p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-122-5p Ribavirin+Pegylated IFNa-2b sensitive tissue (chronic hepatitis C)
hsa-miR-122-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-122-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-122-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-122-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-122-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-122-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-122-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission