>DNMT1|NM_001130823|3'UTR
   1 TTCTGCCCTCCCGTCACCCCTGTTTCTGGCACCAGGAATCCCCAACATGCACTGATGTTGTGTTTTTAACATGTCAATCT
  81 GTCCGTTCACATGTGTGGTACATGGTGTTTGTGGCCTTGGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAA
 161 TGATTTAGTGATCAAATTGTGCAGTACTTTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTAC
 241 CACTGTATGAGTGGAAATTAAGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTATAAACC
 321 ACCAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uguuucaagacaucACGUGACu 5' ||||||| Target 5' aggaatccccaacaTGCACTGa 3'	34 - 55	140.00	-11.90
2	miRNA 3' ugUUUCAAGACAU--CACGUGAcu 5' ||||||:| || ||||:| Target 5' taAAAGTTTTTTATTATGCATTat 3'	206 - 229	134.00	-7.50
3	miRNA 3' uguuUCAAGACAUCACGUGAcu 5' ||| || | |||||:| Target 5' gtgcAGTACT-TTGTGCATTct 3'	179 - 199	125.00	-8.50

Mutant ID	Mutant Position	Mutant Source
327884	18	ClinVar
327885	18	ClinVar
891737	29	ClinVar
891736	34	ClinVar
327883	126	ClinVar
327882	165	ClinVar
891486	211	ClinVar
891485	253	ClinVar
327881	274	ClinVar
891484	287	ClinVar
COSN31596893	12	COSMIC
COSN26671866	15	COSMIC
COSN31602140	94	COSMIC
COSN1210412	123	COSMIC
COSN31581196	148	COSMIC
COSN20079555	296	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1472228793	2	dbSNP
rs771673787	3	dbSNP
rs1226187929	8	dbSNP
rs375175304	12	dbSNP
rs1303411440	13	dbSNP
rs778467461	18	dbSNP
rs1386092239	19	dbSNP
rs1374673908	20	dbSNP
rs768825123	22	dbSNP
rs1459005103	25	dbSNP
rs770834214	26	dbSNP
rs749247799	29	dbSNP
rs900322306	30	dbSNP
rs201588324	32	dbSNP
rs1416080045	34	dbSNP
rs755991789	35	dbSNP
rs752496910	40	dbSNP
rs1246513292	42	dbSNP
rs1211035851	43	dbSNP
rs1465066670	44	dbSNP
rs781601841	46	dbSNP
rs751646784	47	dbSNP
rs944557336	49	dbSNP
rs766475318	50	dbSNP
rs913291021	60	dbSNP
rs1283949895	62	dbSNP
rs1347441193	68	dbSNP
rs375767390	71	dbSNP
rs558563730	77	dbSNP
rs373395295	79	dbSNP
rs75515773	84	dbSNP
rs576045333	85	dbSNP
rs1482661963	93	dbSNP
rs115729223	96	dbSNP
rs1271011323	99	dbSNP
rs1039871995	102	dbSNP
rs535967897	111	dbSNP
rs943115745	114	dbSNP
rs914363532	122	dbSNP
rs886054126	126	dbSNP
rs568286791	143	dbSNP
rs13784	147	dbSNP
rs1429570087	150	dbSNP
rs1304244525	152	dbSNP
rs1368076013	154	dbSNP
rs1403163901	155	dbSNP
rs192952800	165	dbSNP
rs1362876047	167	dbSNP
rs1216574623	179	dbSNP
rs111234445	190	dbSNP
rs992980906	191	dbSNP
rs772999851	211	dbSNP
rs1250709243	218	dbSNP
rs1246527453	228	dbSNP
rs1014641379	232	dbSNP
rs981743761	244	dbSNP
rs768761819	253	dbSNP
rs1258297772	256	dbSNP
rs887432106	267	dbSNP
rs1242224311	268	dbSNP
rs886054125	274	dbSNP
rs996480936	285	dbSNP
rs1184384000	286	dbSNP
rs189422259	287	dbSNP
rs1449233460	289	dbSNP
rs1164675429	294	dbSNP
rs1387565377	298	dbSNP
rs11488	299	dbSNP
rs1040708437	311	dbSNP
rs1164117279	314	dbSNP

- Hepatology (Baltimore, Md.), 2010

UNLABELLED: Although the inflammation-associated cytokine interleukin-6 (IL-6) has been implicated in cholangiocarcinoma growth, the relationship between IL-6 and oncogenic changes is unknown. IL-6 can increase expression of DNA methyltransferase-1 (DNMT-1) and epigenetically regulate the expression of several genes, including microRNAs (miRNAs). DNMT-1 up-regulation occurs in hepatobiliary cancers and is associated with a poor prognosis. To understand the potential regulation of DNMT-1 by IL-6-dependent miRNAs, we examined the expression of a group of miRNAs which have sequence complementarity to the 3'-untranslated region of DNMT-1, namely miR-148a, miR-152, and miR-301. The expression of these miRNAs was decreased in cholangiocarcinoma cells. Moreover, the expression of all three miRNAs was decreased in IL-6-overexpressing malignant cholangiocytes in vitro and in tumor cell xenografts. There was a concomitant decrease in expression of the methylation-sensitive tumor suppressor genes Rassf1a and p16INK4a. Using luciferase reporter constructs, DNMT-1 was verified as a target for miR-148a and miR-152. Precursors to miR-148a and miR-152 decreased DNMT-1 protein expression, increased Rassf1a and p16INK4a expression, and reduced cell proliferation. CONCLUSION: These data indicate that IL-6 can regulate the activity of DNMT-1 and expression of methylation-dependent tumor suppressor genes by modulation of miR-148a and miR-152, and provide a link between this inflammation-associated cytokine and oncogenesis in cholangiocarcinoma.

- Journal of immunology (Baltimore, Md. : 1950), 2010

Systemic lupus erythematosus is a complex autoimmune disease caused by genetic and epigenetic alterations. DNA methylation abnormalities play an important role in systemic lupus erythematosus disease processes. MicroRNAs (miRNAs) have been implicated as fine-tuning regulators controlling diverse biological processes at the level of posttranscriptional repression. Dysregulation of miRNAs has been described in various disease states, including human lupus. Whereas previous studies have shown miRNAs can regulate DNA methylation by targeting the DNA methylation machinery, the role of miRNAs in aberrant CD4+ T cell DNA hypomethylation of lupus is unclear. In this study, by using high-throughput microRNA profiling, we identified that two miRNAs (miR-21 and miR-148a) overexpressed in CD4+ T cells from both patients with lupus and lupus-prone MRL/lpr mice, which promote cell hypomethylation by repressing DNA methyltransferase 1 (DNMT1) expression. This in turn leads to the overexpression of autoimmune-associated methylation-sensitive genes, such as CD70 and LFA-1, via promoter demethylation. Further experiments revealed that miR-21 indirectly downregulated DNMT1 expression by targeting an important autoimmune gene, RASGRP1, which mediated the Ras-MAPK pathway upstream of DNMT1; miR-148a directly downregulated DNMT1 expression by targeting the protein coding region of its transcript. Additionally, inhibition of miR-21 and miR-148a expression in CD4+ T cells from patients with lupus could increase DNMT1 expression and attenuate DNA hypomethylation. Together, our data demonstrated a critical functional link between miRNAs and the aberrant DNA hypomethylation in lupus CD4+ T cells and could help to develop new therapeutic approaches.

- Medical oncology (Northwood, London, England), 2012

Studies have shown that microRNA-148a (miR-148a) was proved to be silenced while DNA methyltransferase 1 (DNMT1) was over-expressed in gastric cancer. But the mechanism of aberrant expression of miR-148a and DNMT1 and their relationships in gastric cancer are still unknown. The aims of this study were to investigate the expression profile of miR-148a and DNMT1 and reveal whether they have any relationships. We used reverse-transcriptase quantitative real-time PCR, methylation-specific PCR and Western blot to measure the level of miR-148a expression, DNA methylation level and DNMT1 expression, respectively. Gastric cancer cells were transfected with plasmid or siRNA or treated with 5-aza-2'-deoxycytidine. Cell proliferation and apoptosis were detected by cell counting and flow cytometric analysis. In this study, we demonstrated that gastric cancer tissues and cell lines displayed a consistent down-regulation of miR-148a and hypermethylation of promoter region. DNMT1 was over-expressed in primary tumors and cell lines, while knockdown of DNMT1 using siRNA could decrease methylation level of miR-148a promoter and restore its expression. Furthermore, ectopic over-expression of miR-148a in cancer cell lines caused reduction in DNMT1 expression and inhibited cell proliferation, but no obvious change was found in apoptosis rate. These results suggest that miR-148a is inactivated by DNA hypermethylation of promoter region in gastric cancer, which is mediated through DNMT1 over-expression. Additionally, the silence of miR-148a reduces its suppression to DNMT1 in gastric cancer, and this may in turn result in over-expression of DNMT1 and promote DNA hypermethylation.

- Medical oncology (Northwood, London, England), 2014

The long non-coding RNA MEG3 has been reported to be a tumor suppressor in a number of malignant tumors including gastric cancer. Several studies have shown that the regulation of MEG3 may attribute to the promoter hypermethylation. However, the mechanism of MEG3 regulation in gastric cancer is still not well understood. MiR-148a can suppress gastric tumorigenesis through regulating the expression of target genes such as DNA methyltransferase 1(DNMT-1). We examined the expression of MEG3 in 52 gastric cancer samples using quantitative real-time PCR and found the down-regulation of MEG3 in both gastric cancer tissues and cell lines. The positive correlation of MEG3 and miR-148a was further confirmed in SGC-7901 and BGC-823 gastric cancer cell lines. Hypermethylation of MEG3 differentially methylated regions was identified by methylation-specific PCR, and MEG3 expression was increased with the inhibition of methylation with siRNA to DNMT-1 in gastric cancer cells. In addition, transfection of MEG3 siRNA into gastric cancer cells diminished the suppression of proliferation induced by overexpression of miR-148a. Our results suggest that the suppression of miR-148a may contribute to the down-regulation of MEG3 in gastric cancer by modulation of DNMT-1.

- International journal of oncology, 2014

In general, microRNAs, a class of small (~21 nucleotide) non-coding RNAs, negatively regulate the expression of their target genes. Dysregulation of miRNAs is a common feature in human cancers, but this phenomenon has not been studied extensively in hepatocellular carcinoma (HCC). miR148a, a member of the miR-148/152 family, has been found to be downregulated in several tumor types and has been suggested to be a tumor suppressor gene; however, its function in HCC remains unclear. Herein, we describe the epigenetic regulation of miR-148a and its impact on HCC cells. We found that, due to the hypermethylation of its CpG island, miR-148a undergoes methylation-mediated silencing in HCC cell lines. Additionally, DNMT1, the DNA methyltransferase that maintains methylation patterns, is aberrantly upregulated in HCC cell lines, and its overexpression is responsible for hypermethylation of the miR-148a promoter. Intriguingly, the expression of DNMT1, which is a target of miR-148a, is inversely correlated with the expression of miR-148a in HCC cells. These results lead us to propose the existence of a negative feedback regulatory loop between miR-148a and DNMT1 in HCC. Importantly, we demonstrate that the overexpression of miR-148a significantly inhibits HCC cell proliferation and cell cycle progression. Our results suggest the existence of a novel miR-148a-DNMT1 regulatory circuit and indicate that miR-148a acts as a tumor suppressor during hepatocellular carcinogenesis. These results may provide a promising alterative strategy for the therapeutic treatment of HCC.

- Oncotarget, 2016

Laryngeal squamous cell carcinoma (LSCC) is a highly aggressive malignant cancer. The regulation of LSCC progression by long non-coding RNA (lncRNA) was not well understood. In this study, we reported that the lncRNA H19 was upregulated in LSCC. The expression levels of H19 were inversely correlated with the survival rate of LSCC patients. Knockdown of H19 expression inhibited LSCC cell migration, invasion and proliferation. We identified microRNA miR-148a-3p as an inhibitory target for H19. Overexpression of miR-148a-3p reduced LSCC migration, invasion and proliferation cell, while inhibition of miR-148a-3p did the opposite. The inhibition of LSCC progression induced by H19 knockdown required the activity of miR-148a-3p. We also identified DNA methyltransferase enzyme DNMT1 as a target of miR-148a-3p. Cellular DNA methylation levels were inhibited by both miR-148a-3p overexpression and H19 knockdown. In summary, our study demonstrated that the lncRNA H19 promoted LSCC progression via miR-148a-3p and DNMT1.

- Cell biochemistry and function, 2016

Laryngeal squamous cell carcinoma (LSCC) is a highly aggressive malignant cancer and accounts for 1% to 2% of all malignancies diagnosed worldwide. Runt-related transcription factor 3 (RUNX3), an important tumor suppressor, is known to related to lymph node metastasis and the development of LSCC. However, the biological roles and potential mechanisms RUNX3 expression was not well understood. In this study, we reported that the RUNX3 was significantly downregulated and highly methylated in LSCC compared with their matched normal. The enforced expression of RUNX3 inhibited LSCC cell migration, invasion, and proliferation, whereas the inhibition of RUNX3 did the opposite. We identified that RUNX3 was regulated by miR-148a-3p and found that the expression level of miR-148-3p was significantly decreased and positively related with the expression of RUNX3 in LSCC. We also identified that DNA methyltransferase enzyme DNA (cytosine-5-)-methyltransferase 1 (DNMT1) was targeted by miR-148a-3p in LSCC. The knockdown of DNMT1 promoted the expression of RUNX3 and inhibited migration, invasion, and proliferation in LSCC cells. In summary, our study demonstrated that miR-148a-3p may regulate RUNX3 expression through the modulation of DNMT1-dependent DNA methylation in LSCC, providing a novel target and a potential therapeutic pathway against LSCC. LSCC is a highly aggressive malignant cancer and accounts for 1% to 2% of all malignancies diagnosed worldwide. In this study, we reported that RUNX3, an important tumor suppressor, was significantly downregulated and highly methylated in LSCC compared with their matched normal. The overexpression of RUNX3 inhibited LSCC cell migration, invasion, and proliferation, whereas the inhibition of RUNX3 did the opposite. Moreover, RUNX3 was regulated by miR-148a-3p, which targeted DNA methyltransferase enzyme DNMT1 in LSCC cells. Therefore, miR-148a-3p may regulate RUNX3 expression through the modulation of DNMT1-dependent DNA methylation in LSCC, providing a novel target and a potential therapeutic pathway against LSCC.