miRTarBase - #MIRT000026


—
pre-miRNA Information
pre-miRNA hsa-mir-9-1   
Genomic Coordinates chr1: 156420341 - 156420429
Synonyms MIRN9-1, hsa-mir-9-1, miRNA9-1, MIR9-1
Description Homo sapiens miR-9-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-9-2   
Genomic Coordinates chr5: 88666853 - 88666939
Synonyms MIRN9-2, hsa-mir-9-2, miRNA9-2, MIR9-2
Description Homo sapiens miR-9-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-9-3   
Genomic Coordinates chr15: 89368017 - 89368106
Synonyms MIRN9-3, hsa-mir-9-3, miRNA9-3, MIR9-3
Description Homo sapiens miR-9-3 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-9-5p
Sequence 16| UCUUUGGUUAUCUAGCUGUAUGA |38
Evidence Experimental
Experiments Cloned
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BOS25P miR-9 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Real-time reverse transcription PCR
Gene Information
Gene Symbol REST   
Synonyms NRSF, WT6, XBR
Description RE1 silencing transcription factor
Transcript NM_005612   
Expression
Putative miRNA Targets on REST
3'UTR of REST
(miRNA target sites are highlighted)		 
>REST|NM_005612|3'UTR
   1 TGAAACTTTGAACAAGGTTTCAGTTCTTAGTTTGTAAGGTATATTACATTTTATATTCATTTATGATAGCAGACAACCTT
  81 TTAAGATTGCTTTAATTAGTATCTGATGTTGATTTTTAAGTGGCATTCTTTTCCTTAGGACTTTTTATGTATACCTGTTG
 161 ATTGTTGTGTAAATTTTAGTAAATCTAAGAGAGTGTACTAAACCAGCAGGTATCTGTTAGCTTATGTGTTTAATTGAAAT
 241 TAGAAGGCTAAGATGGTATAACAGCATTTTATTGCTTTGTCCAGCTACAACTTGTCATTTTTTTCTCCATGTCTTATCTT
 321 CCTGTTTCACTTTAGTTTATTCTTCGTTTTTTATTGAGATCTATAAAAAATTGGCTTACTTAATAGCAAATTACTTGAAG
 401 AATTTGCCTGCTTTATATAAAGTTAGCACTTTAAGATTTTTTTTTTTAGAGATGAGAAGACATTTAAATTGAAGAAAAAT
 481 TCCCCCAGCAATAGACAGTCTATCAGTCCAAGTATTTACTTCCTGAGTTTTGATCAATATTTTTTATTTGTGTATGTTAA
 561 TCGTCATAAAAACAGTGATTTTGGTGTGTTTTTTATTTTGGTGCTTTAATGGCTTAAGATGTTGCACATTTTTTTTTTCT
 641 TTTGGTTTCTGTTTATGTTTTTTTGCCTATGCAGTTAAATTTTTCCTAGAAATAGCATTTGTGTTGAACAGTAACACTTT
 721 ATACATATATATATGCATGTTTATTTTGTTTGGCGTCTTTGGAGGGATGCTTTTAGACTTGTTTGCAAAAGGGCAGTTTT
 801 CTTTTTCTTTGCTGCAGTTGTCTATTTTGCAGAATAATAGTGTGTGCAAGTTTGTGAGCAAATGAAATATGCAGGTTCAA
 881 TCTATTGATTTTGATTTTTACATCTTATATCTATGCCAGAATCTGTATTTCATATAACTTATTTATTTCGAATGGATGTA
 961 GTAAATTCACAGCTATCAGTTTTGATTTTGCAATAAATAAACCACTAGGTTGCATGTCGAACAAATTTTTATCTCAAATA
1041 CCAACCATCAGTTTTTTTTTTCATGTGTTTTGGTACAGCTAATTCCTAATTGTAGAGTGTTAAATGTTTGAGGAGAACCT
1121 TTTCTCATAGATGGTTGGTGTTCATATGGCTACTTTACAATAAAGAGAACTGTAAGTGATATTTGGAAACTACAAACCTG
1201 GAATTAGGAGATATAATTATTCCTTCAAGTTTTATAGAATATCACTTGGGAGATTCCAAAGCCATAGCTATTACGCGGCA
1281 AACCTAGGATAAGAAAGGTAGTATGAGTGCTGGTAGACCAGCTGCAACTTTCCTATACAGTGAAAAAGGCTGGTGAAACA
1361 AGTACAGTCCAGATTTTTTAAAATCATACTTTCTCAGGGATCTCCACAAACTGGTGGGTGTCCTGGCTGTCTGTGTGATA
1441 GCCTCTTTCTATAGGTGAGGCCTCAAATGAATTGCAGCTATCCTGGTGTTCCTATGAGGGCACTTTGTATGAAAAAGGGC
1521 ATGTACTCCAAAACATTTTTGTAGGTTCTTTGGCCAGTTGCCAAAGAGTGTGAAAGAATCCAATAGAGGATTTTTCTTAC
1601 TGATAGCAGTCATTCATTGCAGTAAAATAAAATATGATCCCATTAGGGAATCTTGAATTCTGACCTCCCATACTCCGTTT
1681 TGAAATAACCACTTTATATTTCATTTTTTAAAAATCTGATGATCTCTTTGAGGCAGGTTTCAGATTTGGCAGTACAACAT
1761 GAAAGATTAGGAAAAGCATTAATAACGTGTGGGTGGAAAGCTTGTTAAAAATCTGAGAGTGAAGTTTGAGTTAAAAGTTG
1841 TTTGAACATGGCATTGACTGGGAGGCCAAAGATTTAAAGAAGCGGAAGATTCTTCTCTTAAGACATGAGGAGTAAGTTGT
1921 GTGATAATGGTATGTGTTTTGTGTGCATGAATGGACATTGTAAATGTTGAATTCTAGGCTCCGACAATCATTGTCAACAG
2001 AAGATCAAGCTGCAAATATTTATGTTTTAAAACTTAAATTATAAAGCTAGTTAAGTCTTTCTAATGACTAGTTTTAATGT
2081 TCATGGGTACATTTTACCTAAGTTACCGTTTACATTGTATAGAAAAAGATACATCTTAAGCACAGATTGGTTATTAGGAA
2161 TTAGTTTGGGGAAGAGGTTTTTTTGTGGATTCTTTCATACTGCAAAGAAAAACCATTTGCCTTTTGGGGAATTGAGCTAA
2241 CTTCTAATCTAGTCTTAAGACTAGAATGCTAAAAACAAAAACATGAAGGAAATTAAAACCCCTTATTATTAAATTGATTT
2321 GTAAAAACATTGTTACTGGAAATTTATTGGACTTGAGGCCTTCCTCCAGAAAATAAGGACTTGATTGTCAGGCCTATATT
2401 AGGTTCTGAACCTTAATGCCATGTATTTGTACTTACTAAAAATTGTTTCAATGAAAAGTACATTAGCAGTATGAACTTCT
2481 GGTCCAGTTGGAAGTTTTTCCATTTGAAAAATGTGATGTTTGCATGGAACTGTTTGAAACTTTTTTATTTTCTAGTCCCC
2561 CTCCCCCACACTGGATAGAATTTAGCCTAGAATTTTCCCTTTGGATAAAAGAACAAAAATTGAACATGTTATTTGTAAAT
2641 TGATGTTTAGTAATTAGTGATAAACTTGAAATACTAGCATATATTATAAGCCTTAATCTTAGGTAGTCTTATGAAAATGA
2721 ATCTCTTAACTATCTTTTGAACCTGTATTCACATTGGTTTTCAAGATATTTTAAGTTATATTTTTTCCTCTTTTCAGAGC
2801 TGCTTCTTATTCTGGGGCTACTTTTTTTTTTAGTTGTGTAATTCACAAAGGGCTGCATTTTTTTTTTTTTTTAATAAGGC
2881 TTATAACTATGGCTGGATCTTTTGCTCTAGTCTTCTAAGAAGGGCCATTTTATTTTTTAGAGTCACTTCTAAAGTCATGT
2961 GGTAATTAACTTTGGAGACTGTTTTGCGTATGAGTGCTGATACAAATTAAAACCCAAGTAGACCTCATTGCATGTCACCC
3041 TATGAATGTTGACAATGGAAGGAATACCTTGCCTGTAGTATACTGTCACTTCTGGATTGATAAGCTGAGGAAGAAAGTTA
3121 AGTTTCTTTTTTACATAAGTCAGAAAAACTTACAGCTGGTGTTCCTAGTTTCCTGGTTGACCTCAGCAGATGAAGTGAAC
3201 AGATAGTGTTAATTCAGATTGAAGAAATTATCTGAATCTTGGTTTGTGTAGATTTACAATCTACATGCAATATTAACTAA
3281 ATCAGATAGCTTTTACAGTTTCACATGTGTACATAGGTTCCCTCCCGGTCCCTTCCATATCCATTAGTTATTGAACTTTC
3361 TAAACTGGCATTGAAACATTACAACAATGTTTTGTTGCACCAATTTTATAAACTTAAGCAGTGCAATACGTGTTACTTTT
3441 CTGAGGCAAACCAAAGGTAAATTTCTCAAGGTTCTTGCTGCCTTCTTTAGCAGCATTTGATGGAAGATCTTTTATACATT
3521 TGTAATAGATAAAAATAAACCAGATTGCAAATCCTTTTTTAAAATCCTAAACCATGTACCAAGTTTTTGGTCCAAATTAT
3601 GTAGGATAAGTTAAACTTAAATTGCATTCTATTAACCAATATGAGTGTATTTCTGTAAGCATAGTTATGTTGAAATAAAG
3681 TTTTAAAAACCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agUAUGU-CGAU-------CU---AUUGGUUUCu 5'
            ||||: |:||       ||    |||||||| 
Target 5' caATACGTGTTACTTTTCTGAGGCAAACCAAAGg 3'
 3424 - 3457 149.00 -13.40
2 
miRNA  3' agUAUGUCGAUCUAUUGGUUUCu 5'
            || :: ||:|: ::|||||| 
Target 5' gcAT-TGACTGGGAGGCCAAAGa 3'
 1851 - 1872 140.00 -16.90
3 
miRNA  3' aguAUGUCGAUCUAUUGGUUUCu 5'
             | ::|| || | :|||||| 
Target 5' ttcTTTGGCCAG-TTGCCAAAGa 3'
 1546 - 1567 139.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1178578 152 ClinVar
COSN31598583 16 COSMIC
COSN7496094 208 COSMIC
COSN26827808 423 COSMIC
COSN9045677 536 COSMIC
COSN21958367 544 COSMIC
COSN31962270 564 COSMIC
COSN31657271 748 COSMIC
COSN28981730 1062 COSMIC
COSN17286607 1546 COSMIC
COSN15912395 1977 COSMIC
COSN21104754 2109 COSMIC
COSN1298708 2586 COSMIC
COSN22698480 3404 COSMIC
COSN24324104 3669 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1336936895 2 dbSNP
rs772278505 7 dbSNP
rs1230728158 9 dbSNP
rs1289068538 14 dbSNP
rs760840538 15 dbSNP
rs200137905 16 dbSNP
rs1257978702 19 dbSNP
rs1336763256 20 dbSNP
rs1470760885 23 dbSNP
rs760970217 25 dbSNP
rs771157425 34 dbSNP
rs777034707 35 dbSNP
rs1409231394 41 dbSNP
rs759954686 42 dbSNP
rs765732930 43 dbSNP
rs1250506393 44 dbSNP
rs762391711 48 dbSNP
rs1043869611 57 dbSNP
rs571466291 60 dbSNP
rs1185291160 61 dbSNP
rs1441729494 66 dbSNP
rs1365923374 68 dbSNP
rs1406735624 70 dbSNP
rs1000173060 71 dbSNP
rs1204318176 73 dbSNP
rs1031013524 75 dbSNP
rs1306078518 77 dbSNP
rs770018766 79 dbSNP
rs1334115375 83 dbSNP
rs1351818364 89 dbSNP
rs536844723 97 dbSNP
rs1441556997 108 dbSNP
rs1013680176 118 dbSNP
rs1327683964 119 dbSNP
rs972824793 120 dbSNP
rs1315147835 125 dbSNP
rs557258216 142 dbSNP
rs1386073119 143 dbSNP
rs1319446146 150 dbSNP
rs781667 152 dbSNP
rs1386906761 156 dbSNP
rs1161190412 158 dbSNP
rs931227818 161 dbSNP
rs1049707640 163 dbSNP
rs1375816483 165 dbSNP
rs536276722 168 dbSNP
rs909034757 169 dbSNP
rs962003504 172 dbSNP
rs1208386148 177 dbSNP
rs1447752650 180 dbSNP
rs911049680 184 dbSNP
rs1208367351 188 dbSNP
rs145052321 196 dbSNP
rs1041088680 198 dbSNP
rs1293123737 205 dbSNP
rs1360591905 207 dbSNP
rs1225443684 208 dbSNP
rs902623197 209 dbSNP
rs533864838 215 dbSNP
rs1362360418 217 dbSNP
rs1296175436 227 dbSNP
rs922963350 228 dbSNP
rs763331656 231 dbSNP
rs999502917 232 dbSNP
rs1181925122 233 dbSNP
rs1327770292 243 dbSNP
rs1321341979 246 dbSNP
rs1404543708 250 dbSNP
rs1366173503 255 dbSNP
rs1054202649 263 dbSNP
rs572986400 264 dbSNP
rs1427703042 265 dbSNP
rs1388427380 268 dbSNP
rs560639617 270 dbSNP
rs774570488 275 dbSNP
rs1185948432 277 dbSNP
rs558648586 283 dbSNP
rs1012910012 290 dbSNP
rs1050040609 292 dbSNP
rs4864608 293 dbSNP
rs150938778 296 dbSNP
rs760637695 298 dbSNP
rs28613467 306 dbSNP
rs1035412021 311 dbSNP
rs1273300999 317 dbSNP
rs370943826 318 dbSNP
rs1272700136 325 dbSNP
rs556136695 326 dbSNP
rs972390071 330 dbSNP
rs1345951278 332 dbSNP
rs1304682219 334 dbSNP
rs1410404805 335 dbSNP
rs1369805251 340 dbSNP
rs763635931 346 dbSNP
rs551502862 347 dbSNP
rs564036650 347 dbSNP
rs952448612 356 dbSNP
rs1421977787 359 dbSNP
rs985329111 360 dbSNP
rs911158935 362 dbSNP
rs1384083580 364 dbSNP
rs1248631961 365 dbSNP
rs1023624013 370 dbSNP
rs943848882 372 dbSNP
rs779444757 375 dbSNP
rs969491698 375 dbSNP
rs1006283329 376 dbSNP
rs1040868936 377 dbSNP
rs1016126110 384 dbSNP
rs923992722 385 dbSNP
rs962144789 388 dbSNP
rs529515427 396 dbSNP
rs1323733484 404 dbSNP
rs1274556080 406 dbSNP
rs1284967661 413 dbSNP
rs1226345500 419 dbSNP
rs1053913829 420 dbSNP
rs1349859851 430 dbSNP
rs1202698501 433 dbSNP
rs893791300 435 dbSNP
rs11336958 437 dbSNP
rs1332220916 437 dbSNP
rs1443072466 437 dbSNP
rs397879276 437 dbSNP
rs1469494998 438 dbSNP
rs1030696398 443 dbSNP
rs542133568 447 dbSNP
rs767469589 447 dbSNP
rs1471805740 452 dbSNP
rs1407948997 463 dbSNP
rs1446007704 467 dbSNP
rs1178245367 471 dbSNP
rs542627366 483 dbSNP
rs1012272757 484 dbSNP
rs1235260946 487 dbSNP
rs985782527 489 dbSNP
rs559281722 497 dbSNP
rs1186459035 498 dbSNP
rs1372239768 501 dbSNP
rs1461546610 501 dbSNP
rs1264603936 503 dbSNP
rs910204702 506 dbSNP
rs1045319238 510 dbSNP
rs1169558258 511 dbSNP
rs947151132 520 dbSNP
rs1376812522 524 dbSNP
rs906798329 529 dbSNP
rs190192306 538 dbSNP
rs200337062 543 dbSNP
rs373699773 543 dbSNP
rs528464115 547 dbSNP
rs1336089455 555 dbSNP
rs180739700 564 dbSNP
rs141330981 567 dbSNP
rs1454740328 567 dbSNP
rs935532783 574 dbSNP
rs898034452 575 dbSNP
rs1326184033 577 dbSNP
rs1421405056 582 dbSNP
rs1412262985 584 dbSNP
rs1182513211 587 dbSNP
rs994317112 588 dbSNP
rs1228851407 600 dbSNP
rs1444694845 601 dbSNP
rs1052615138 603 dbSNP
rs369294506 604 dbSNP
rs1026766029 614 dbSNP
rs1485313220 620 dbSNP
rs1261105986 622 dbSNP
rs952461390 623 dbSNP
rs1319923999 628 dbSNP
rs985107795 628 dbSNP
rs1236737468 629 dbSNP
rs1245395870 629 dbSNP
rs1317194809 629 dbSNP
rs796271772 629 dbSNP
rs1433190517 640 dbSNP
rs143550781 640 dbSNP
rs1272413795 645 dbSNP
rs1320877755 646 dbSNP
rs1222375599 650 dbSNP
rs1263152412 652 dbSNP
rs1462392361 654 dbSNP
rs1018117261 655 dbSNP
rs1206393948 656 dbSNP
rs753343306 657 dbSNP
rs949604457 658 dbSNP
rs1045104435 670 dbSNP
rs965271667 679 dbSNP
rs1386582549 694 dbSNP
rs530762846 696 dbSNP
rs1195325041 697 dbSNP
rs1375867092 698 dbSNP
rs756962604 699 dbSNP
rs1188108914 721 dbSNP
rs1006314462 725 dbSNP
rs905172710 725 dbSNP
rs1016726033 726 dbSNP
rs935212913 729 dbSNP
rs1294051589 731 dbSNP
rs564577801 732 dbSNP
rs1225331661 733 dbSNP
rs1307197686 736 dbSNP
rs1430031914 738 dbSNP
rs1384316657 739 dbSNP
rs993775893 755 dbSNP
rs989953092 756 dbSNP
rs915348445 763 dbSNP
rs1367932506 764 dbSNP
rs948008374 767 dbSNP
rs1373341121 772 dbSNP
rs1045099275 773 dbSNP
rs1172042505 775 dbSNP
rs778550402 780 dbSNP
rs750029901 789 dbSNP
rs1199797060 812 dbSNP
rs1384768177 816 dbSNP
rs1383119528 817 dbSNP
rs939583284 821 dbSNP
rs1249519460 825 dbSNP
rs1036651561 826 dbSNP
rs550475964 830 dbSNP
rs1404826960 840 dbSNP
rs1480332139 843 dbSNP
rs1251924967 859 dbSNP
rs985981629 863 dbSNP
rs1325031192 867 dbSNP
rs1236505142 870 dbSNP
rs1017241679 871 dbSNP
rs968315742 877 dbSNP
rs1327411148 881 dbSNP
rs1350860021 883 dbSNP
rs978390559 884 dbSNP
rs1396626027 885 dbSNP
rs147719648 905 dbSNP
rs934409730 908 dbSNP
rs755332703 909 dbSNP
rs918064507 911 dbSNP
rs1200026980 912 dbSNP
rs1176968172 914 dbSNP
rs1269758786 915 dbSNP
rs1027125011 916 dbSNP
rs1481449711 917 dbSNP
rs949636705 920 dbSNP
rs1181039163 921 dbSNP
rs1045304735 924 dbSNP
rs905200353 926 dbSNP
rs758778395 935 dbSNP
rs1251353844 939 dbSNP
rs1197562610 944 dbSNP
rs1363440298 946 dbSNP
rs1460199710 947 dbSNP
rs386674682 947 dbSNP
rs115752183 950 dbSNP
rs1159084357 950 dbSNP
rs114040635 951 dbSNP
rs1160675813 952 dbSNP
rs186088023 959 dbSNP
rs965053783 961 dbSNP
rs1336807452 962 dbSNP
rs527718486 969 dbSNP
rs1308520280 970 dbSNP
rs1424629882 970 dbSNP
rs1449821707 972 dbSNP
rs1404969402 973 dbSNP
rs112072087 974 dbSNP
rs1030947000 975 dbSNP
rs1157724702 976 dbSNP
rs1346921806 978 dbSNP
rs1454252629 979 dbSNP
rs956722211 985 dbSNP
rs989341768 986 dbSNP
rs915278718 993 dbSNP
rs1184144636 996 dbSNP
rs1442833514 1004 dbSNP
rs571949421 1015 dbSNP
rs1030591767 1017 dbSNP
rs890263026 1019 dbSNP
rs1389182420 1020 dbSNP
rs770418236 1024 dbSNP
rs1305602332 1025 dbSNP
rs980892929 1032 dbSNP
rs778055054 1036 dbSNP
rs1007434045 1040 dbSNP
rs1240697374 1050 dbSNP
rs1017508739 1052 dbSNP
rs1204848384 1052 dbSNP
rs1381449363 1052 dbSNP
rs140595812 1053 dbSNP
rs1315079013 1060 dbSNP
rs999843369 1062 dbSNP
rs1358441662 1063 dbSNP
rs1223214597 1064 dbSNP
rs1031323156 1066 dbSNP
rs1479577521 1068 dbSNP
rs1387108751 1073 dbSNP
rs192197922 1077 dbSNP
rs545602834 1082 dbSNP
rs1037006317 1084 dbSNP
rs1384706509 1087 dbSNP
rs1419926575 1090 dbSNP
rs1180709339 1091 dbSNP
rs1473898906 1091 dbSNP
rs918084333 1098 dbSNP
rs564991109 1102 dbSNP
rs1192982911 1108 dbSNP
rs557237311 1109 dbSNP
rs1264259059 1132 dbSNP
rs930776065 1135 dbSNP
rs1220933398 1144 dbSNP
rs1359278187 1147 dbSNP
rs1049235160 1151 dbSNP
rs1380167442 1154 dbSNP
rs888153582 1160 dbSNP
rs1368018517 1165 dbSNP
rs942239308 1168 dbSNP
rs1431254347 1171 dbSNP
rs1460876405 1182 dbSNP
rs1301007650 1183 dbSNP
rs1404269003 1190 dbSNP
rs1366041159 1192 dbSNP
rs1038135228 1194 dbSNP
rs866706864 1198 dbSNP
rs184080847 1202 dbSNP
rs1396556878 1208 dbSNP
rs1475838919 1211 dbSNP
rs1426251639 1214 dbSNP
rs542866271 1215 dbSNP
rs1312451887 1222 dbSNP
rs1051815983 1227 dbSNP
rs1270218938 1229 dbSNP
rs559610654 1235 dbSNP
rs1435534087 1240 dbSNP
rs1316816012 1241 dbSNP
rs1271628491 1246 dbSNP
rs1059741 1257 dbSNP
rs1059740 1258 dbSNP
rs528500809 1260 dbSNP
rs1340963612 1275 dbSNP
rs1007386751 1276 dbSNP
rs1203683407 1277 dbSNP
rs550288590 1278 dbSNP
rs186053445 1287 dbSNP
rs1352863648 1290 dbSNP
rs1328198047 1296 dbSNP
rs1000090843 1298 dbSNP
rs1402725536 1301 dbSNP
rs1480987411 1304 dbSNP
rs1174798724 1305 dbSNP
rs1714003 1311 dbSNP
rs1200820593 1313 dbSNP
rs1480300558 1320 dbSNP
rs1031773791 1340 dbSNP
rs1193457091 1342 dbSNP
rs1469010010 1356 dbSNP
rs1231822677 1358 dbSNP
rs759754653 1368 dbSNP
rs1014431585 1369 dbSNP
rs1260848370 1380 dbSNP
rs1184617404 1387 dbSNP
rs1416360732 1392 dbSNP
rs1024092988 1396 dbSNP
rs1284911682 1397 dbSNP
rs771809574 1400 dbSNP
rs1222024369 1402 dbSNP
rs781031215 1403 dbSNP
rs1372444827 1409 dbSNP
rs969791607 1410 dbSNP
rs980958211 1413 dbSNP
rs926763737 1414 dbSNP
rs963634429 1417 dbSNP
rs1407326324 1418 dbSNP
rs1178614165 1426 dbSNP
rs973656146 1428 dbSNP
rs919253429 1431 dbSNP
rs929289011 1444 dbSNP
rs530876526 1446 dbSNP
rs550763721 1450 dbSNP
rs912000710 1451 dbSNP
rs943444502 1452 dbSNP
rs1038857885 1456 dbSNP
rs1463068981 1459 dbSNP
rs904343287 1460 dbSNP
rs760674050 1467 dbSNP
rs1316328025 1472 dbSNP
rs1284844683 1478 dbSNP
rs1241012367 1481 dbSNP
rs1053009411 1491 dbSNP
rs1338490024 1495 dbSNP
rs567424680 1498 dbSNP
rs1383711516 1500 dbSNP
rs1359563449 1507 dbSNP
rs1059739 1519 dbSNP
rs1213963367 1521 dbSNP
rs891701163 1531 dbSNP
rs1160515230 1541 dbSNP
rs1422007033 1548 dbSNP
rs1296191564 1549 dbSNP
rs1308223856 1550 dbSNP
rs1013958763 1552 dbSNP
rs1444938813 1557 dbSNP
rs1220558637 1562 dbSNP
rs1257824873 1564 dbSNP
rs1261284016 1573 dbSNP
rs1184616035 1574 dbSNP
rs1461064437 1581 dbSNP
rs1204515052 1582 dbSNP
rs150493651 1584 dbSNP
rs1357113590 1601 dbSNP
rs1289683743 1610 dbSNP
rs1485091824 1616 dbSNP
rs1322613875 1633 dbSNP
rs1315079152 1636 dbSNP
rs1213217469 1638 dbSNP
rs1186519440 1640 dbSNP
rs905638732 1641 dbSNP
rs753717050 1643 dbSNP
rs1402403202 1647 dbSNP
rs1033864930 1649 dbSNP
rs1173660386 1656 dbSNP
rs1424721327 1664 dbSNP
rs1427936836 1669 dbSNP
rs546954356 1671 dbSNP
rs963537457 1676 dbSNP
rs974070779 1677 dbSNP
rs138269723 1678 dbSNP
rs1343273015 1679 dbSNP
rs1429763919 1691 dbSNP
rs566754619 1692 dbSNP
rs1026600883 1693 dbSNP
rs1402984507 1694 dbSNP
rs867530596 1696 dbSNP
rs951015120 1697 dbSNP
rs1281502988 1704 dbSNP
rs761321874 1704 dbSNP
rs538653869 1710 dbSNP
rs558238778 1711 dbSNP
rs1224418912 1717 dbSNP
rs1344229132 1719 dbSNP
rs1283174199 1725 dbSNP
rs1280996855 1728 dbSNP
rs1392284060 1730 dbSNP
rs1315287968 1733 dbSNP
rs1295884592 1753 dbSNP
rs1215531115 1755 dbSNP
rs1354744055 1757 dbSNP
rs911863181 1759 dbSNP
rs1479320521 1760 dbSNP
rs1489572971 1774 dbSNP
rs1428562090 1775 dbSNP
rs1197852587 1779 dbSNP
rs943473884 1787 dbSNP
rs974757569 1788 dbSNP
rs1258932979 1802 dbSNP
rs1480470065 1809 dbSNP
rs1192633345 1818 dbSNP
rs1321897103 1819 dbSNP
rs1262854447 1821 dbSNP
rs925794537 1822 dbSNP
rs935881162 1823 dbSNP
rs1053362760 1835 dbSNP
rs891737681 1840 dbSNP
rs949997397 1846 dbSNP
rs1045439715 1847 dbSNP
rs1467865072 1860 dbSNP
rs1405102600 1870 dbSNP
rs1362185998 1872 dbSNP
rs1467582885 1883 dbSNP
rs1422724112 1884 dbSNP
rs1179813516 1885 dbSNP
rs1418551338 1886 dbSNP
rs1001288850 1891 dbSNP
rs905504801 1891 dbSNP
rs1242922070 1895 dbSNP
rs1345041206 1895 dbSNP
rs1201381717 1896 dbSNP
rs1405638523 1897 dbSNP
rs1347814421 1898 dbSNP
rs1276626964 1905 dbSNP
rs1237752897 1907 dbSNP
rs1353835405 1911 dbSNP
rs1310748584 1927 dbSNP
rs1450020774 1929 dbSNP
rs1016660291 1931 dbSNP
rs898231897 1952 dbSNP
rs1223389023 1958 dbSNP
rs995039165 1974 dbSNP
rs1382754956 1976 dbSNP
rs1157963809 1979 dbSNP
rs1420182486 1980 dbSNP
rs1381014415 1983 dbSNP
rs1160458138 1984 dbSNP
rs1026884715 1997 dbSNP
rs1242741450 2002 dbSNP
rs568947939 2013 dbSNP
rs1285437517 2017 dbSNP
rs1356267151 2026 dbSNP
rs562930220 2035 dbSNP
rs1444457431 2042 dbSNP
rs1260036117 2044 dbSNP
rs1205081738 2050 dbSNP
rs537503780 2056 dbSNP
rs1287626682 2064 dbSNP
rs1490637153 2065 dbSNP
rs1223158457 2068 dbSNP
rs987659190 2069 dbSNP
rs1018903152 2072 dbSNP
rs1469344830 2080 dbSNP
rs1324492565 2084 dbSNP
rs1317305935 2085 dbSNP
rs1400537998 2090 dbSNP
rs1177402104 2091 dbSNP
rs1362370853 2096 dbSNP
rs1382001088 2097 dbSNP
rs1300174055 2099 dbSNP
rs557135900 2100 dbSNP
rs1422793899 2105 dbSNP
rs1442536453 2108 dbSNP
rs1473869439 2109 dbSNP
rs964646258 2109 dbSNP
rs1371713061 2115 dbSNP
rs974705151 2118 dbSNP
rs1478469155 2131 dbSNP
rs149192051 2139 dbSNP
rs866660640 2148 dbSNP
rs1490053615 2154 dbSNP
rs957917416 2157 dbSNP
rs1211281893 2170 dbSNP
rs79178673 2172 dbSNP
rs1406973264 2178 dbSNP
rs1342341593 2181 dbSNP
rs1281267054 2189 dbSNP
rs1404216301 2198 dbSNP
rs988692511 2200 dbSNP
rs1324219329 2201 dbSNP
rs1407361770 2202 dbSNP
rs145032340 2205 dbSNP
rs1170474050 2215 dbSNP
rs1466441832 2217 dbSNP
rs1426183385 2220 dbSNP
rs1352809933 2233 dbSNP
rs950017797 2243 dbSNP
rs1441819871 2248 dbSNP
rs138876445 2253 dbSNP
rs1435774463 2264 dbSNP
rs57467543 2265 dbSNP
rs1379664086 2268 dbSNP
rs1244243531 2280 dbSNP
rs190469406 2281 dbSNP
rs1319772614 2284 dbSNP
rs1260969571 2294 dbSNP
rs1222836817 2295 dbSNP
rs565094052 2311 dbSNP
rs1368131413 2318 dbSNP
rs905535895 2324 dbSNP
rs781474291 2330 dbSNP
rs1334245222 2332 dbSNP
rs1330970187 2334 dbSNP
rs1038039294 2339 dbSNP
rs1402928962 2348 dbSNP
rs1174650796 2351 dbSNP
rs898273196 2356 dbSNP
rs994294030 2360 dbSNP
rs1173866903 2382 dbSNP
rs1270332547 2385 dbSNP
rs1436708293 2386 dbSNP
rs1047908842 2394 dbSNP
rs1178890153 2397 dbSNP
rs1458773426 2403 dbSNP
rs1239620139 2404 dbSNP
rs1459653309 2409 dbSNP
rs1209151129 2412 dbSNP
rs1182786429 2416 dbSNP
rs1280612079 2420 dbSNP
rs1221965226 2422 dbSNP
rs1348663972 2437 dbSNP
rs886566220 2438 dbSNP
rs1009110821 2450 dbSNP
rs1473761581 2455 dbSNP
rs1166070236 2456 dbSNP
rs1019187573 2465 dbSNP
rs1417535200 2470 dbSNP
rs1360286291 2482 dbSNP
rs1336749493 2484 dbSNP
rs964926677 2488 dbSNP
rs1379170247 2489 dbSNP
rs141926610 2491 dbSNP
rs544429034 2494 dbSNP
rs1382983427 2495 dbSNP
rs1450671427 2500 dbSNP
rs957491946 2501 dbSNP
rs989280202 2505 dbSNP
rs778425134 2513 dbSNP
rs1213580166 2515 dbSNP
rs1487885802 2517 dbSNP
rs1247696546 2518 dbSNP
rs749772043 2523 dbSNP
rs1285489577 2526 dbSNP
rs561356399 2530 dbSNP
rs529945966 2531 dbSNP
rs1356178168 2535 dbSNP
rs1313147989 2536 dbSNP
rs750159884 2541 dbSNP
rs971186656 2541 dbSNP
rs1268927822 2556 dbSNP
rs1339220449 2561 dbSNP
rs546793039 2568 dbSNP
rs1298331648 2573 dbSNP
rs1259370792 2575 dbSNP
rs1420954665 2576 dbSNP
rs1321015555 2579 dbSNP
rs1202610255 2580 dbSNP
rs927235179 2583 dbSNP
rs1423975229 2595 dbSNP
rs34341200 2597 dbSNP
rs560470495 2599 dbSNP
rs1184561014 2601 dbSNP
rs567183828 2608 dbSNP
rs1263782489 2612 dbSNP
rs532271391 2625 dbSNP
rs1489328880 2627 dbSNP
rs1038052667 2636 dbSNP
rs1221126974 2649 dbSNP
rs374292810 2651 dbSNP
rs929743622 2678 dbSNP
rs1047216060 2687 dbSNP
rs1340493978 2691 dbSNP
rs775482448 2696 dbSNP
rs1425830457 2700 dbSNP
rs527842667 2702 dbSNP
rs1402347720 2708 dbSNP
rs890869320 2712 dbSNP
rs1343112868 2714 dbSNP
rs1468478315 2718 dbSNP
rs1175956799 2728 dbSNP
rs749048078 2733 dbSNP
rs1398158487 2743 dbSNP
rs779027505 2746 dbSNP
rs1464878055 2748 dbSNP
rs1424017436 2749 dbSNP
rs1040499252 2751 dbSNP
rs1479381787 2753 dbSNP
rs1265363154 2769 dbSNP
rs900795015 2776 dbSNP
rs996358054 2780 dbSNP
rs1033034902 2781 dbSNP
rs1196940528 2788 dbSNP
rs1401105805 2791 dbSNP
rs1279591110 2803 dbSNP
rs957563541 2804 dbSNP
rs552158151 2806 dbSNP
rs1300068544 2810 dbSNP
rs1477028151 2820 dbSNP
rs568713231 2821 dbSNP
rs1020822516 2822 dbSNP
rs1369330360 2822 dbSNP
rs1328906252 2830 dbSNP
rs1346604938 2832 dbSNP
rs1445514334 2841 dbSNP
rs971469822 2845 dbSNP
rs1172467773 2852 dbSNP
rs537844004 2853 dbSNP
rs1203178728 2854 dbSNP
rs1172461555 2858 dbSNP
rs1309733547 2858 dbSNP
rs532015797 2858 dbSNP
rs56283756 2858 dbSNP
rs981295934 2858 dbSNP
rs1283236912 2869 dbSNP
rs1239243859 2871 dbSNP
rs1447553719 2873 dbSNP
rs1195725358 2874 dbSNP
rs1265499246 2875 dbSNP
rs1343556484 2881 dbSNP
rs1479493846 2885 dbSNP
rs927083476 2888 dbSNP
rs78136248 2890 dbSNP
rs1313459389 2893 dbSNP
rs1306378784 2898 dbSNP
rs1238980228 2902 dbSNP
rs974356659 2910 dbSNP
rs919609109 2914 dbSNP
rs929663988 2918 dbSNP
rs1157219538 2926 dbSNP
rs183044198 2933 dbSNP
rs1420891197 2952 dbSNP
rs1300574427 2953 dbSNP
rs1303380307 2957 dbSNP
rs1467470568 2963 dbSNP
rs912332380 2979 dbSNP
rs1156930906 2985 dbSNP
rs536471342 2988 dbSNP
rs1381131305 2989 dbSNP
rs1180948406 2995 dbSNP
rs1343175068 2998 dbSNP
rs943779677 3002 dbSNP
rs774868994 3003 dbSNP
rs1301290541 3004 dbSNP
rs900657569 3005 dbSNP
rs1332485202 3006 dbSNP
rs553117287 3015 dbSNP
rs1278788395 3018 dbSNP
rs1055084267 3024 dbSNP
rs1218787822 3030 dbSNP
rs766686644 3031 dbSNP
rs1339669757 3033 dbSNP
rs1313081681 3039 dbSNP
rs1289507483 3045 dbSNP
rs1358535184 3047 dbSNP
rs760477823 3050 dbSNP
rs866077415 3055 dbSNP
rs1361207102 3056 dbSNP
rs573493147 3057 dbSNP
rs866959505 3068 dbSNP
rs907299164 3073 dbSNP
rs1268090254 3075 dbSNP
rs1368254483 3077 dbSNP
rs1188671166 3081 dbSNP
rs776891408 3095 dbSNP
rs1179902959 3099 dbSNP
rs187055162 3115 dbSNP
rs559203164 3122 dbSNP
rs1207706645 3123 dbSNP
rs374331644 3123 dbSNP
rs958492066 3127 dbSNP
rs768373846 3134 dbSNP
rs544599688 3136 dbSNP
rs1424529843 3140 dbSNP
rs1027353821 3154 dbSNP
rs192732621 3155 dbSNP
rs1400477757 3157 dbSNP
rs982881907 3162 dbSNP
rs1320292631 3163 dbSNP
rs1392231613 3165 dbSNP
rs1403876214 3176 dbSNP
rs912202739 3182 dbSNP
rs868580797 3184 dbSNP
rs1389375510 3186 dbSNP
rs1463314322 3192 dbSNP
rs1421884504 3196 dbSNP
rs146294652 3214 dbSNP
rs776585304 3229 dbSNP
rs540442682 3230 dbSNP
rs1243413686 3236 dbSNP
rs1196119152 3238 dbSNP
rs1450734201 3239 dbSNP
rs1290111867 3242 dbSNP
rs1377096677 3252 dbSNP
rs1242064483 3264 dbSNP
rs1315865802 3267 dbSNP
rs975095545 3269 dbSNP
rs560347654 3270 dbSNP
rs1272057447 3273 dbSNP
rs1434369295 3278 dbSNP
rs1358675045 3296 dbSNP
rs1324492178 3298 dbSNP
rs570414848 3301 dbSNP
rs922113085 3302 dbSNP
rs1170406551 3304 dbSNP
rs534157866 3306 dbSNP
rs1266165369 3309 dbSNP
rs932176263 3314 dbSNP
rs1489500546 3316 dbSNP
rs532439851 3317 dbSNP
rs1422248126 3321 dbSNP
rs1054627999 3322 dbSNP
rs1237809737 3323 dbSNP
rs1458340384 3326 dbSNP
rs182754814 3327 dbSNP
rs562787052 3328 dbSNP
rs1383730054 3329 dbSNP
rs1423786306 3330 dbSNP
rs1199021044 3331 dbSNP
rs531236479 3337 dbSNP
rs1276378758 3352 dbSNP
rs764706277 3355 dbSNP
rs1344427391 3367 dbSNP
rs907163293 3370 dbSNP
rs1369762591 3372 dbSNP
rs772749731 3379 dbSNP
rs1297049877 3381 dbSNP
rs9055 3388 dbSNP
rs1447945816 3393 dbSNP
rs1356605251 3395 dbSNP
rs1338030163 3402 dbSNP
rs1448476682 3411 dbSNP
rs1334487422 3421 dbSNP
rs1332801217 3428 dbSNP
rs555861786 3430 dbSNP
rs1381746522 3431 dbSNP
rs1174966284 3435 dbSNP
rs1396598766 3438 dbSNP
rs995768958 3441 dbSNP
rs1379278303 3461 dbSNP
rs1179065042 3465 dbSNP
rs187782640 3481 dbSNP
rs1235472614 3483 dbSNP
rs1305631143 3484 dbSNP
rs951391195 3486 dbSNP
rs1225352828 3487 dbSNP
rs982699676 3489 dbSNP
rs1213084487 3494 dbSNP
rs1351837237 3508 dbSNP
rs1257452688 3513 dbSNP
rs1019244635 3515 dbSNP
rs756575199 3517 dbSNP
rs1200727035 3527 dbSNP
rs1448024507 3543 dbSNP
rs570907911 3547 dbSNP
rs921053940 3548 dbSNP
rs1182736897 3549 dbSNP
rs1417283855 3555 dbSNP
rs936415884 3578 dbSNP
rs28740801 3579 dbSNP
rs1420444434 3582 dbSNP
rs1411439987 3583 dbSNP
rs1427205008 3590 dbSNP
rs1169377007 3603 dbSNP
rs1423678080 3604 dbSNP
rs1043215 3605 dbSNP
rs1173801045 3609 dbSNP
rs1191369201 3611 dbSNP
rs1405173724 3611 dbSNP
rs1285320546 3617 dbSNP
rs946293619 3627 dbSNP
rs778925050 3630 dbSNP
rs1041956669 3632 dbSNP
rs1228088588 3639 dbSNP
rs1304316501 3642 dbSNP
rs928863800 3647 dbSNP
rs1398641782 3648 dbSNP
rs539216777 3655 dbSNP
rs1298270236 3662 dbSNP
rs1339293147 3662 dbSNP
rs1455075722 3668 dbSNP
rs559017822 3669 dbSNP
rs1163858401 3677 dbSNP
rs1405768998 3693 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293 , NT2
Location of target site 3'UTR
Original Description (Extracted from the article) ... "miR-9 targets the 3'UTR of REST.//Cotransfection of 15 nM pre-miR-9 with luciferase reporters containing the 3'UTR of REST significantly reduced reporter gene expression (F(2 ...

- Packer AN; Xing Y; Harper SQ; Jones L; Davidson BL, 2008, The Journal of neuroscience : the official journal of the Society for Neuroscience.

Article - Packer AN; Xing Y; Harper SQ; Jones L; Davidson BL
- The Journal of neuroscience : the official journal of the Society for Neuroscience, 2008
The transcription factor REST silences neuronal gene expression in non-neuronal cells. In neurons, the protein is sequestered in the cytoplasm in part through binding to huntingtin. Polyglutamine expansions in huntingtin, which causes Huntington's disease (HD), abrogates REST-huntingtin binding. Consequently, REST translocates to the nucleus, occupies RE1 repressor sequences and decreases neuronal gene expression. In this work, we found that levels of several microRNAs (miRNAs) with upstream RE1 sites are decreased in HD patient cortices relative to healthy controls. Interestingly, one of these, the bifunctional brain enriched miR-9/miR-9*, targets two components of the REST complex: miR-9 targets REST and miR-9* targets CoREST. These data provide evidence for a double negative feedback loop between the REST silencing complex and the miRNAs it regulates.
LinkOut: [PMID: 19118166]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Article - Chen X; Guo X; Zhang H; Xiang Y; Chen J; et al.
- Oncogene, 2009
Dysregulated expression of microRNAs (miRNAs) is associated with a variety of diseases, including colorectal cancer. By comparing more than 200 miRNAs in 13 pairs of matched colorectal cancer and normal adjacent tissue samples through qRT-PCR and microarray analysis, we found a widespread disruption of miRNA expression during colorectal tumorigenesis. In particular, among a panel of presumed targets generated by in silico analysis that may interact with these aberrantly expressed miRNAs, KRAS oncogene has been further experimentally validated as the target of miR-143. First, an inverse correlation between KRAS protein and miR-143 in vivo was found. Second, KRAS expression in Lovo cells was significantly abolished by treatment with miR-143 mimic, whereas miR-143 inhibitor increased KRAS protein level. Third, luciferase reporter assay confirmed that miR-143 directly recognize the 3'-untranslated region of KRAS transcripts. Four, Lovo cells treated with miR-143 inhibitor showed a stimulated cell proliferation, whereas miR-143 overexpression had an opposite effect. Finally, inhibition of KRAS expression by miR-143 inhibits constitutive phosphorylation of ERK1/2. Taken together, the present study provides the first evidences that miR-143 is significant in suppressing colorectal cancer cell growth through inhibition of KRAS translation.
LinkOut: [PMID: 19137007]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.763 7.3e-6 0.741 1.7e-5 24 Click to see details
GSE28260 Renal cortex and medulla 0.655 7.6e-3 0.643 8.9e-3 13 Click to see details
GSE17498 Multiple myeloma -0.296 3.2e-2 -0.089 2.9e-1 40 Click to see details
GSE27834 Pluripotent stem cells 0.437 4.5e-2 0.503 2.4e-2 16 Click to see details
GSE17306 Multiple myeloma -0.239 4.9e-2 0.049 3.7e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.151 7.8e-2 0.185 4.0e-2 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.275 1.2e-1 0.002 5.0e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.401 1.4e-1 0.500 8.5e-2 9 Click to see details
GSE32688 Pancreatic cancer -0.16 1.9e-1 -0.120 2.6e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.165 2.2e-1 0.005 4.9e-1 24 Click to see details
GSE38226 Liver fibrosis -0.176 2.2e-1 -0.253 1.3e-1 21 Click to see details
GSE19536 Breast cancer -0.072 2.4e-1 -0.042 3.4e-1 100 Click to see details
GSE21849 B cell lymphoma 0.134 2.4e-1 0.164 2.0e-1 29 Click to see details
GSE42095 Differentiated embryonic stem cells 0.132 2.7e-1 0.186 2.0e-1 23 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.119 2.9e-1 0.339 4.9e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.128 3.0e-1 0.056 4.1e-1 20 Click to see details
GSE19783 ER- ER- breast cancer -0.061 3.0e-1 -0.024 4.2e-1 79 Click to see details
GSE21687 Ependynoma primary tumors -0.063 3.1e-1 -0.164 9.8e-2 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.075 3.6e-1 -0.131 2.7e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.032 4.6e-1 0.191 2.8e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.242 0.05 -0.141 0.17 49 Click to see details
KIRC -0.189 0.06 -0.115 0.18 68 Click to see details
CESC 0.975 0.07 1.000 0.5 3 Click to see details
STAD -0.249 0.08 -0.297 0.05 32 Click to see details
LUSC 0.212 0.1 0.020 0.45 38 Click to see details
BLCA 0.305 0.11 0.296 0.12 18 Click to see details
THCA 0.151 0.13 0.170 0.1 59 Click to see details
KIRP 0.202 0.13 0.257 0.08 32 Click to see details
BRCA 0.106 0.17 0.114 0.15 84 Click to see details
PRAD -0.113 0.22 0.101 0.24 50 Click to see details
CHOL -0.167 0.33 -0.250 0.26 9 Click to see details
ESCA 0.119 0.36 0.018 0.48 11 Click to see details
UCEC 0.073 0.38 -0.051 0.42 19 Click to see details
COAD -0.114 0.39 0.214 0.31 8 Click to see details
PCPG 0.295 0.4 0.500 0.33 3 Click to see details
KICH 0.042 0.42 0.176 0.2 25 Click to see details
HNSC 0.02 0.45 -0.011 0.47 42 Click to see details
LUAD 0.022 0.47 0.231 0.24 12 Click to see details
PAAD -0.032 0.48 0.400 0.3 4 Click to see details
PAAD -0.032 0.48 0.400 0.3 4 Click to see details
PAAD -0.032 0.48 0.400 0.3 4 Click to see details
329 hsa-miR-9-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000025 MMP13 matrix metallopeptidase 13 2 1
MIRT000026 REST RE1 silencing transcription factor 3 2
MIRT000029 CDH1 cadherin 1 4 3
MIRT000639 POU2F2 POU class 2 homeobox 2 2 1
MIRT000640 BCL6 B-cell CLL/lymphoma 6 2 1
MIRT000641 ETS1 ETS proto-oncogene 1, transcription factor 3 2
MIRT001202 RAB34 RAB34, member RAS oncogene family 5 2
MIRT001736 BACE1 beta-secretase 1 2 1
MIRT001937 PRDM1 PR/SET domain 1 4 3
MIRT003193 NFKB1 nuclear factor kappa B subunit 1 4 7
MIRT003300 FOXO1 forkhead box O1 4 2
MIRT003323 NTRK3 neurotrophic receptor tyrosine kinase 3 3 5
MIRT004982 NR2E1 nuclear receptor subfamily 2 group E member 1 4 1
MIRT005390 ONECUT2 one cut homeobox 2 5 2
MIRT005783 CDX2 caudal type homeobox 2 2 1
MIRT006781 AP3B1 adaptor related protein complex 3 beta 1 subunit 4 1
MIRT006782 CCNG1 cyclin G1 4 2
MIRT006833 SRF serum response factor 2 1
MIRT006892 SIRT1 sirtuin 1 3 2
MIRT006894 TGFBI transforming growth factor beta induced 1 1
MIRT007035 SOCS5 suppressor of cytokine signaling 5 3 2
MIRT007060 ID2 inhibitor of DNA binding 2, HLH protein 2 1
MIRT007326 FOXO3 forkhead box O3 3 1
MIRT007372 CCND1 cyclin D1 1 1
MIRT021318 KLRC1 killer cell lectin like receptor C1 1 1
MIRT021319 DSP desmoplakin 1 1
MIRT021320 POGZ pogo transposable element derived with ZNF domain 1 1
MIRT021321 CCL19 C-C motif chemokine ligand 19 1 1
MIRT021322 EFNA1 ephrin A1 1 1
MIRT021323 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT021324 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT021325 MYF6 myogenic factor 6 1 1
MIRT021326 LRP1 LDL receptor related protein 1 1 1
MIRT021327 SLC35E2 solute carrier family 35 member E2 1 1
MIRT021328 HOXC12 homeobox C12 1 1
MIRT021329 SYNE1 spectrin repeat containing nuclear envelope protein 1 1 1
MIRT021330 STK3 serine/threonine kinase 3 1 1
MIRT021331 SLC7A2 solute carrier family 7 member 2 1 1
MIRT021332 PLEKHB1 pleckstrin homology domain containing B1 1 1
MIRT021333 RASSF8 Ras association domain family member 8 1 1
MIRT021334 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT021335 ATG10 autophagy related 10 1 1
MIRT021336 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT021337 C7orf31 chromosome 7 open reading frame 31 1 1
MIRT021338 CMTM2 CKLF like MARVEL transmembrane domain containing 2 1 1
MIRT021339 CERS4 ceramide synthase 4 1 1
MIRT021340 PPAP2A phospholipid phosphatase 1 1 1
MIRT021341 KCNJ15 potassium voltage-gated channel subfamily J member 15 1 1
MIRT021342 SUMF2 sulfatase modifying factor 2 1 1
MIRT021343 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT021344 CXXC5 CXXC finger protein 5 1 1
MIRT021345 TCL1B T-cell leukemia/lymphoma 1B 1 1
MIRT021346 EP300 E1A binding protein p300 1 1
MIRT021347 AUH AU RNA binding methylglutaconyl-CoA hydratase 1 1
MIRT021348 TRRAP transformation/transcription domain associated protein 1 1
MIRT021349 DMXL1 Dmx like 1 1 1
MIRT021350 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 1 1
MIRT021351 RCC2 regulator of chromosome condensation 2 1 1
MIRT021352 PIGB phosphatidylinositol glycan anchor biosynthesis class B 1 1
MIRT021353 NAV1 neuron navigator 1 1 1
MIRT021354 ATP6V1C2 ATPase H+ transporting V1 subunit C2 1 1
MIRT021355 PLCB4 phospholipase C beta 4 1 1
MIRT021356 IGF2R insulin like growth factor 2 receptor 1 1
MIRT021357 MDM4 MDM4, p53 regulator 1 1
MIRT021358 AVIL advillin 1 1
MIRT021359 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT021360 CA13 carbonic anhydrase 13 1 1
MIRT021361 FLNB filamin B 1 1
MIRT021362 IREB2 iron responsive element binding protein 2 1 1
MIRT021363 KLRK1 killer cell lectin like receptor K1 1 1
MIRT021364 CDH3 cadherin 3 1 1
MIRT021365 MCC mutated in colorectal cancers 1 1
MIRT021366 SYNE2 spectrin repeat containing nuclear envelope protein 2 1 1
MIRT021367 MAP1B microtubule associated protein 1B 1 1
MIRT021368 NFATC3 nuclear factor of activated T-cells 3 1 1
MIRT021369 SPAG9 sperm associated antigen 9 1 1
MIRT021370 ZNF407 zinc finger protein 407 1 1
MIRT021371 SEC23IP SEC23 interacting protein 1 1
MIRT021372 NBEA neurobeachin 1 1
MIRT021373 SLC2A5 solute carrier family 2 member 5 1 1
MIRT021374 PQLC3 PQ loop repeat containing 3 1 1
MIRT021375 C9orf89 caspase recruitment domain family member 19 1 1
MIRT021376 NCOR2 nuclear receptor corepressor 2 1 1
MIRT021377 P4HA2 prolyl 4-hydroxylase subunit alpha 2 1 1
MIRT021378 MYLK myosin light chain kinase 1 1
MIRT021379 NIN ninein 1 1
MIRT021380 FERMT1 fermitin family member 1 1 1
MIRT021381 PRKD3 protein kinase D3 1 1
MIRT021382 SYAP1 synapse associated protein 1 3 3
MIRT021383 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT021384 GPBP1L1 GC-rich promoter binding protein 1 like 1 1 1
MIRT021385 UHMK1 U2AF homology motif kinase 1 1 1
MIRT021386 SLC39A14 solute carrier family 39 member 14 1 1
MIRT021387 SNX7 sorting nexin 7 1 1
MIRT021388 LMNA lamin A/C 1 1
MIRT021389 FBN2 fibrillin 2 1 1
MIRT021390 PXDN peroxidasin 1 1
MIRT021391 TBPL1 TATA-box binding protein like 1 1 1
MIRT021392 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 1
MIRT021393 FAIM Fas apoptotic inhibitory molecule 1 1
MIRT021394 KMT2D lysine methyltransferase 2D 1 1
MIRT021395 VIM vimentin 1 1
MIRT021396 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT021397 XRN2 5'-3' exoribonuclease 2 1 1
MIRT021398 HIST1H4H histone cluster 1 H4 family member h 2 6
MIRT021399 TWISTNB TWIST neighbor 2 2
MIRT021400 ZBED3 zinc finger BED-type containing 3 3 3
MIRT021401 VEGFA vascular endothelial growth factor A 2 1
MIRT021402 CHMP2B charged multivesicular body protein 2B 2 1
MIRT021403 STMN1 stathmin 1 3 2
MIRT021404 GRN granulin precursor 1 1
MIRT021405 TTC7B tetratricopeptide repeat domain 7B 1 1
MIRT021406 TAGLN transgelin 1 1
MIRT021407 EFCAB14 EF-hand calcium binding domain 14 1 1
MIRT021408 FSTL3 follistatin like 3 1 1
MIRT021409 BIK BCL2 interacting killer 1 1
MIRT021410 SPI1 Spi-1 proto-oncogene 1 1
MIRT021411 HLA-A major histocompatibility complex, class I, A 1 1
MIRT021412 CALML5 calmodulin like 5 1 1
MIRT021413 HTR3A 5-hydroxytryptamine receptor 3A 1 1
MIRT021414 F2 coagulation factor II, thrombin 1 1
MIRT021415 LPXN leupaxin 1 1
MIRT021416 LINC00483 long intergenic non-protein coding RNA 483 1 1
MIRT021417 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT021418 MTX3 metaxin 3 1 1
MIRT021419 AKR1CL1 aldo-keto reductase family 1 member C8, pseudogene 1 1
MIRT021420 IDS iduronate 2-sulfatase 1 1
MIRT021421 ELF3 E74 like ETS transcription factor 3 1 1
MIRT021422 GNAT2 G protein subunit alpha transducin 2 1 1
MIRT021423 SLC30A4 solute carrier family 30 member 4 1 1
MIRT021424 IPO7 importin 7 1 1
MIRT021425 WNT8A Wnt family member 8A 1 1
MIRT021426 GIP gastric inhibitory polypeptide 1 1
MIRT021427 SLC22A5 solute carrier family 22 member 5 1 1
MIRT021428 SPON2 spondin 2 1 1
MIRT021429 MAGEA2B MAGE family member A2B 1 1
MIRT021430 ATL1 atlastin GTPase 1 1 1
MIRT021431 RHOV ras homolog family member V 1 1
MIRT021432 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT021433 LRRTM1 leucine rich repeat transmembrane neuronal 1 1 1
MIRT021434 WNT6 Wnt family member 6 1 1
MIRT021435 NKX2-2 NK2 homeobox 2 1 1
MIRT021436 SLC25A30 solute carrier family 25 member 30 1 1
MIRT021437 CUEDC1 CUE domain containing 1 1 1
MIRT021438 ALDH1A3 aldehyde dehydrogenase 1 family member A3 1 1
MIRT021439 MN1 MN1 proto-oncogene, transcriptional regulator 1 1
MIRT021440 ABCC1 ATP binding cassette subfamily C member 1 1 1
MIRT021441 SLC22A3 solute carrier family 22 member 3 1 1
MIRT021442 AKR1B10 aldo-keto reductase family 1 member B10 1 1
MIRT021443 KIF1B kinesin family member 1B 1 1
MIRT021444 E2F7 E2F transcription factor 7 1 1
MIRT021445 HN1L Jupiter microtubule associated homolog 2 1 1
MIRT021446 SNHG16 small nucleolar RNA host gene 16 1 1
MIRT021447 CYP39A1 cytochrome P450 family 39 subfamily A member 1 1 1
MIRT021448 MORF4L1 mortality factor 4 like 1 1 1
MIRT021449 ARHGEF10 Rho guanine nucleotide exchange factor 10 1 1
MIRT021450 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT021451 TBC1D9 TBC1 domain family member 9 1 1
MIRT021452 ATP11C ATPase phospholipid transporting 11C 1 1
MIRT021453 FRMD4B FERM domain containing 4B 1 1
MIRT021454 SNAI2 snail family transcriptional repressor 2 1 1
MIRT021455 OPTN optineurin 1 1
MIRT021456 FNBP1 formin binding protein 1 1 1
MIRT021457 PTPRK protein tyrosine phosphatase, receptor type K 1 1
MIRT021459 SDC1 syndecan 1 1 1
MIRT021460 EEF2K eukaryotic elongation factor 2 kinase 1 1
MIRT021461 ATP7A ATPase copper transporting alpha 1 1
MIRT021462 CERS2 ceramide synthase 2 1 1
MIRT021463 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT021464 COL12A1 collagen type XII alpha 1 chain 1 1
MIRT021465 PDZK1 PDZ domain containing 1 1 1
MIRT021466 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 1 1
MIRT021467 PPP4R2 protein phosphatase 4 regulatory subunit 2 1 1
MIRT021468 SERAC1 serine active site containing 1 1 1
MIRT021469 TESK2 testis-specific kinase 2 1 1
MIRT021470 LDLRAP1 low density lipoprotein receptor adaptor protein 1 1 1
MIRT021471 MYH9 myosin heavy chain 9 3 3
MIRT021472 KLF5 Kruppel like factor 5 1 1
MIRT021473 FAM46A family with sequence similarity 46 member A 1 1
MIRT021474 CCNDBP1 cyclin D1 binding protein 1 1 1
MIRT021475 RBFOX2 RNA binding protein, fox-1 homolog 2 1 1
MIRT021476 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT021477 POU2F1 POU class 2 homeobox 1 1 1
MIRT021478 SYNGR2 synaptogyrin 2 2 2
MIRT021479 SYPL1 synaptophysin like 1 1 1
MIRT021480 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT021481 RNF44 ring finger protein 44 1 1
MIRT021482 TC2N tandem C2 domains, nuclear 1 1
MIRT021483 COLEC12 collectin subfamily member 12 1 1
MIRT021484 ID4 inhibitor of DNA binding 4, HLH protein 1 1
MIRT021485 CNOT6 CCR4-NOT transcription complex subunit 6 1 1
MIRT021486 CD34 CD34 molecule 1 1
MIRT021487 MESDC1 talin rod domain containing 1 1 1
MIRT045780 BOD1L1 biorientation of chromosomes in cell division 1 like 1 1 1
MIRT045781 ITGB3BP integrin subunit beta 3 binding protein 1 1
MIRT045782 QARS glutaminyl-tRNA synthetase 1 1
MIRT045783 KIF1A kinesin family member 1A 1 1
MIRT053098 PPARA peroxisome proliferator activated receptor alpha 1 1
MIRT053115 PRTG protogenin 1 1
MIRT053212 KLF17 Kruppel like factor 17 2 1
MIRT053357 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 1
MIRT053358 CYFIP2 cytoplasmic FMR1 interacting protein 2 2 1
MIRT053359 ENDOD1 endonuclease domain containing 1 2 1
MIRT053360 HBP1 HMG-box transcription factor 1 2 1
MIRT053361 JAK1 Janus kinase 1 2 1
MIRT053362 KLF6 Kruppel like factor 6 2 1
MIRT053363 LHFPL2 LHFPL tetraspan subfamily member 2 2 1
MIRT053364 MAP3K8 mitogen-activated protein kinase kinase kinase 8 2 1
MIRT053365 RAB8B RAB8B, member RAS oncogene family 2 1
MIRT053366 RHAG Rh-associated glycoprotein 2 1
MIRT053367 RHOH ras homolog family member H 2 1
MIRT053368 RYBP RING1 and YY1 binding protein 2 1
MIRT053369 SERPINB9 serpin family B member 9 2 1
MIRT053370 TAL1 TAL bHLH transcription factor 1, erythroid differentiation factor 2 1
MIRT053371 TFRC transferrin receptor 2 1
MIRT053372 TRAK2 trafficking kinesin protein 2 2 1
MIRT053373 VAMP5 vesicle associated membrane protein 5 2 1
MIRT053481 MMP2 matrix metallopeptidase 2 1 1
MIRT053482 MMP9 matrix metallopeptidase 9 1 1
MIRT053793 CREB1 cAMP responsive element binding protein 1 3 1
MIRT053794 NF1 neurofibromin 1 3 1
MIRT054041 ELAVL1 ELAV like RNA binding protein 1 3 1
MIRT054042 DICER1 dicer 1, ribonuclease III 5 3
MIRT054196 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 4 1
MIRT054369 Cthrc1 collagen triple helix repeat containing 1 3 1
MIRT054715 CXCR4 C-X-C motif chemokine receptor 4 3 3
MIRT054798 FOXP1 forkhead box P1 3 1
MIRT100125 HIST1H2AI histone cluster 1 H2A family member i 2 6
MIRT251627 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT303632 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 4 3
MIRT437375 PRTG protogenin 3 1
MIRT437469 ACAT1 acetyl-CoA acetyltransferase 1 3 1
MIRT437956 HDAC4 histone deacetylase 4 1 1
MIRT437986 DRD2 dopamine receptor D2 1 1
MIRT438117 MIRLET7D microRNA let-7d 1 1
MIRT438536 TGFBR2 transforming growth factor beta receptor 2 3 2
MIRT438746 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 3 1
MIRT438753 BCL2L11 BCL2 like 11 3 1
MIRT442709 UBE4B ubiquitination factor E4B 2 2
MIRT442743 SERINC5 serine incorporator 5 2 2
MIRT444344 GALNTL6 polypeptide N-acetylgalactosaminyltransferase like 6 2 2
MIRT445645 NPY4R neuropeptide Y receptor Y4 2 2
MIRT447217 ATXN7 ataxin 7 2 2
MIRT468282 SFT2D2 SFT2 domain containing 2 2 2
MIRT468533 SERPINH1 serpin family H member 1 2 2
MIRT482004 AMOTL1 angiomotin like 1 2 12
MIRT485305 NFAT5 nuclear factor of activated T-cells 5 2 6
MIRT492094 TAOK1 TAO kinase 1 2 6
MIRT493465 IPPK inositol-pentakisphosphate 2-kinase 2 4
MIRT493883 FAM73B mitoguardin 2 2 4
MIRT497210 CDH7 cadherin 7 2 2
MIRT507388 EN2 engrailed homeobox 2 2 4
MIRT511642 HIST1H3F histone cluster 1 H3 family member f 2 4
MIRT511782 HIST1H2AE histone cluster 1 H2A family member e 2 4
MIRT513555 IL5 interleukin 5 2 2
MIRT517439 HIST2H2AC histone cluster 2 H2A family member c 2 2
MIRT526994 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT530210 NSUN7 NOP2/Sun RNA methyltransferase family member 7 2 2
MIRT534703 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 4
MIRT538532 CHMP3 charged multivesicular body protein 3 2 4
MIRT547741 KIAA1468 KIAA1468 2 2
MIRT548083 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT553524 TMEM245 transmembrane protein 245 2 4
MIRT555487 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT558992 CA8 carbonic anhydrase 8 2 2
MIRT609369 SOD2 superoxide dismutase 2 2 2
MIRT609845 ZNF557 zinc finger protein 557 2 2
MIRT610639 PIGM phosphatidylinositol glycan anchor biosynthesis class M 2 2
MIRT620230 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT622432 NUDT19 nudix hydrolase 19 2 2
MIRT624367 CDK12 cyclin dependent kinase 12 2 2
MIRT624796 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT626462 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT626610 ACAA2 acetyl-CoA acyltransferase 2 2 4
MIRT629750 SCD5 stearoyl-CoA desaturase 5 2 2
MIRT630036 MTL5 testis expressed metallothionein like protein 2 2
MIRT634055 NUP155 nucleoporin 155 2 2
MIRT637896 SLC19A3 solute carrier family 19 member 3 2 2
MIRT640384 EMC1 ER membrane protein complex subunit 1 2 4
MIRT641973 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 2
MIRT643403 PAX1 paired box 1 2 2
MIRT645378 MKX mohawk homeobox 2 2
MIRT646920 TRIM14 tripartite motif containing 14 2 2
MIRT649452 WDR70 WD repeat domain 70 2 2
MIRT650621 UMPS uridine monophosphate synthetase 2 2
MIRT651245 ZMAT4 zinc finger matrin-type 4 2 2
MIRT653306 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT653594 SLC35B3 solute carrier family 35 member B3 2 2
MIRT655095 PI4K2A phosphatidylinositol 4-kinase type 2 alpha 2 2
MIRT656624 LRRC15 leucine rich repeat containing 15 2 2
MIRT656891 KIF1C kinesin family member 1C 2 2
MIRT658522 ESR1 estrogen receptor 1 5 2
MIRT660676 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT663674 TMEM216 transmembrane protein 216 2 2
MIRT679093 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT682590 CPA4 carboxypeptidase A4 2 2
MIRT690125 ZFAND1 zinc finger AN1-type containing 1 2 2
MIRT704058 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT705652 ANP32B acidic nuclear phosphoprotein 32 family member B 2 2
MIRT707304 PRRX1 paired related homeobox 1 2 2
MIRT711360 VPS8 VPS8, CORVET complex subunit 2 2
MIRT712224 RNF146 ring finger protein 146 2 2
MIRT719696 STX6 syntaxin 6 2 2
MIRT722385 TRMT13 tRNA methyltransferase 13 homolog 2 2
MIRT723019 MSR1 macrophage scavenger receptor 1 2 2
MIRT723398 OAF out at first homolog 2 2
MIRT731146 ATG5 autophagy related 5 1 1
MIRT731304 CUL4A cullin 4A 3 1
MIRT731346 IL6 interleukin 6 2 1
MIRT731560 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT731562 PDGFRB platelet derived growth factor receptor beta 1 1
MIRT731820 NRP1 neuropilin 1 3 1
MIRT731992 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 3 1
MIRT732216 BCL2 BCL2, apoptosis regulator 2 1
MIRT732359 SOX7 SRY-box 7 3 1
MIRT732970 ADIPOQ adiponectin, C1Q and collagen domain containing 3 0
MIRT732971 TUG1 taurine up-regulated 1 (non-protein coding) 3 0
MIRT735865 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736698 PTEN phosphatase and tensin homolog 3 0
MIRT736828 THBS2 thrombospondin 2 2 0
MIRT737142 EIF5A2 eukaryotic translation initiation factor 5A2 3 0
MIRT755614 SHMT1 serine hydroxymethyltransferase 1 2 1
MIRT755615 KCNMA1 potassium calcium-activated channel subfamily M alpha 1 1 1
MIRT755618 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 1
MIRT755732 Pdgfrb platelet derived growth factor receptor beta 2 1
MIRT755979 TLR4 toll-like receptor 4 3 1
MIRT756027 CPEB3 cytoplasmic polyadenylation element binding protein 3 5 1
MIRT756101 DACT3 dishevelled binding antagonist of beta catenin 3 3 1
MIRT756215 TOP2B DNA topoisomerase II beta 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-9 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-9 Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-9 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-9 Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-9 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-9 Iron-sulfates and Aluminum-sulfates NULL NULL Northern blot human neural cells 17629564 2007 up-regulated
miR-9 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 down-regulated
miR-9 N-(4-hydroxyphenyl)-retinamide (4HPR) NULL 5288209 Quantitative real-time PCR human retinal pigment epithelial (ARPE-19) cells 20806079 2010 up-regulated
miR-9 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-9 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-9 Sulindac sulfide approved 5352624 Quantitative real-time PCR HCT116 colon tumor cells 22286762 2012 down-regulated
miR-9 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-9 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-9 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-9 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-9 All-trans-retinoic acid (ATRA) approved 444795 Northern blot spina bifida rat fetus 17962954 2007 down-regulated
miR-9 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-9 Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-9 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-9 Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-9-5p (11E)-11-(2-aminoethylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 11452147 NSC725665 sensitive
hsa-miR-9-5p (1r,2s,6e,10s,11r,13s,17r)-11-hydroxy-2,6,10-trimethyl-14-methylidene-16,18-dioxatricyclo[8.6.2.013,17]octadec-6-en-15-one 5469628 NSC690970 resistant
hsa-miR-9-5p (1S,2R,6S)-1,4,10,12-tetraphenyl-4,8,10,11-tetrazatricyclo[6.4.0.02,6]dodec-11-ene-3,5-dione 394280 NSC697646 resistant
hsa-miR-9-5p (1S,2S,4R,7Z,11S)-4,8-dimethyl-12-methylidene-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-ene-9,13-dione 5459262 NSC672120 resistant
hsa-miR-9-5p (2s,3s,7as)-3-hydroxy-2-[(e)-prop-1-enyl]-2,3,7,7a-tetrahydrofuro[3,4-b]pyran-5-one 24202877 NSC726146 resistant
hsa-miR-9-5p (3-hydroxy-4-methoxyphenyl)-(7-methoxy-1,3-benzodioxol-5-yl)methanone 46949031 NSC758027 sensitive
hsa-miR-9-5p (3E)-3,4-dichloro-2,4-dinitro-1-N,1-N'-diphenylbuta-1,3-diene-1,1-diamine 5470211 NSC698398 resistant
hsa-miR-9-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-9-5p (3r,3as)-3-phenyl-3a,4-dihydrochromeno[4,3-c]pyrazole-2(3h)-carboxamide 374676 NSC652810 sensitive
hsa-miR-9-5p (3R,5R)-3,5-bis(4-methylphenyl)spiro[cyclohexane-4,2'-indene]-1,1',3'-trione 385845 NSC677244 sensitive
hsa-miR-9-5p (3z)-1-(2,6-dichlorophenyl)-3-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]indol-2-one 60147866 NSC752703 sensitive
hsa-miR-9-5p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-hydroxy-1-methylindol-2-one 24205836 NSC736818 sensitive
hsa-miR-9-5p (5E)-2-benzyl-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 6516829 NSC639521 sensitive
hsa-miR-9-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-9-5p (e)-1-(2,4-dimethoxyphenyl)-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 16753966 NSC751956 sensitive
hsa-miR-9-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-9-5p (Z)-(2,4-dinitrophenoxy)imino-oxido-(4-phenylmethoxycarbonylpiperazin-1-yl)azanium 11626484 NSC731700 resistant
hsa-miR-9-5p (Z)-(4-butoxycarbonylpiperazin-1-yl)-(2,4-dinitrophenoxy)imino-oxidoazanium 11495269 NSC731701 resistant
hsa-miR-9-5p .alpha.-chloro-n-(p-methoxyphenyl)succinimide 99724 NSC191909 resistant
hsa-miR-9-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 resistant
hsa-miR-9-5p [(5r,9e,14s,15r,15ar)-5-hydroxy-10,14-dimethyl-3,6-dimethylidene-2-oxo-4,5,7,8,11,12,13,14,15,15a-decahydro-3ah-cyclotetradeca[b]furan-15-yl] acetate 24204960 NSC733752 resistant
hsa-miR-9-5p [(8R,9S,10R,13S,14S,17S)-13-methyl-3-oxo-2,6,7,8,9,10,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl] N-(2-chloroethyl)-N-nitrosocarbamate 320801 NSC269719 sensitive
hsa-miR-9-5p [(E)-(1-chloro-2-methylpropylidene)amino] N-(4-cyanophenyl)carbamate 5466030 NSC672058 resistant
hsa-miR-9-5p [(E)-1-chloropropylideneamino] N-(4-methoxyphenyl)carbamate 5466263 NSC682833 resistant
hsa-miR-9-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(5-fluoro-2-methylphenyl)carbamate 9556257 NSC682835 resistant
hsa-miR-9-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-9-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-9-5p [3-[(2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoyl]oxy-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl (2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohe 5468409 NSC669728 sensitive
hsa-miR-9-5p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(4-methoxyphenyl)methanone 399621 NSC710530 sensitive
hsa-miR-9-5p 1-(2,5,8,11,14,17-hexaoxabicyclo[16.4.0]docosa-1(18),19,21-trien-20-yl)prop-2-en-1-one 375484 NSC655266 resistant
hsa-miR-9-5p 1-(3-chlorophenyl)-2-hexyl-2h-1,3,5-triazine-4,6-diamine;hydrochloride 24180956 NSC3083 sensitive
hsa-miR-9-5p 1-(benzylsulfinyl)-2,4-dinitrobenzene 275684 NSC122656 resistant
hsa-miR-9-5p 1-[(3E)-3,4-dichloro-2,4-dinitro-1-piperidin-1-ylbuta-1,3-dienyl]piperidine 3107921 NSC698394 resistant
hsa-miR-9-5p 1-[(e)-1,3-benzodioxol-5-ylmethylideneamino]-3-(2-chlorophenyl)urea 9572409 NSC715192 sensitive
hsa-miR-9-5p 1-[(Z)-2-cyano-1-pyrrolidin-1-ylethenyl]-3-phenylurea 5468918 NSC679095 sensitive
hsa-miR-9-5p 1-[[2-(2-chloroethyl)-4,5-dimethoxyphenyl]methyl]-6-methoxy-3,4-dihydroisoquinoline;hydrochloride 392600 NSC693142 resistant
hsa-miR-9-5p 1-[3-chloro-4-(4-phenylbutyl)phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine;hydrochloride 24191814 NSC128184 sensitive
hsa-miR-9-5p 1-[4-fluoro-3-(trifluoromethyl)phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine 425379 NSC173516 sensitive
hsa-miR-9-5p 1-adamantyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 387401 NSC681151 resistant
hsa-miR-9-5p 1-benzyl-3-[[5-(4-chlorophenyl)-7-(p-tolyl)pyrrolo[2,3-d]pyrimidin-4-yl]amino]thiourea 3001721 NSC667707 sensitive
hsa-miR-9-5p 10,16-bis[2-(dimethylamino)ethyl]-5-methoxy-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2(7),3,5,8,11(19),12,14(18)-heptaene-15,17-dione 399630 NSC710547 sensitive
hsa-miR-9-5p 11-hydroxyusambarine chlorhydrate 401426 NSC715082 sensitive
hsa-miR-9-5p 11,16-diphenyl-11,16-diazapentacyclo[6.5.5.02,7.09,13.014,18]octadeca-2,4,6-triene-10,12,15,17-tetrone 363087 NSC627652 sensitive
hsa-miR-9-5p 14-[2-(dimethylamino)ethyl]-n-[3-[3-[[14-[2-(dimethylamino)ethyl]-4-methoxy-8,14,15-triazatetracyclo[7.6.1.02,7.013,16]hexadeca-1(15),2(7),3,5,9,11,13(16)-heptaene-10-carbonyl]amino]propyl-methylamino 135426710 NSC710552 sensitive
hsa-miR-9-5p 16-methoxy-4-(4-methoxyphenyl)-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390916 NSC689137 sensitive
hsa-miR-9-5p 2-((2,7-dimethoxy-9-acridinyl)sulfinyl)-n,n-diethylethanamine 395392 NSC699928 resistant
hsa-miR-9-5p 2-(1-propynyl)-3,17.beta.-estradiol 388008 NSC682429 sensitive
hsa-miR-9-5p 2-(2-chlorophenyl)-3-[5-(1,2,4-triazol-4-ylmethyl)-1,3,4-oxadiazol-2-yl]-1,3-thiazolidin-4-one 45029357 NSC746513 sensitive
hsa-miR-9-5p 2-(2-hydroxyethyl)-8-phenyl-5,12,14-trioxa-2-azatetracyclo[7.7.0.03,7.011,15]hexadeca-1(16),3(7),9,11(15)-tetraen-6-one 50900736 NSC750211 sensitive
hsa-miR-9-5p 2-(naphthalen-2-yl)-1-(3,4,5-trimethoxyphenyl)-1h-imidazole 11559546 NSC736993 sensitive
hsa-miR-9-5p 2-[(e)-[2-chloro-6-(4-nitrophenyl)imidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572530 NSC720135 sensitive
hsa-miR-9-5p 2-[(e)-[6-(2,4-dichloro-5-nitrophenyl)-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine 16099260 NSC722867 sensitive
hsa-miR-9-5p 2-[(Z)-2-[3-[3-methoxy-5-(trifluoromethyl)phenyl]-1,2,4-triazol-1-yl]ethenyl]-1,3,4-oxadiazole 57524026 NSC757569 sensitive
hsa-miR-9-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 resistant
hsa-miR-9-5p 2-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]-1-morpholin-4-ylethanone;ethanesulfonic acid 284536 NSC140380 sensitive
hsa-miR-9-5p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-9-5p 2-ethylaminoestradiol 384235 NSC673652 sensitive
hsa-miR-9-5p 2-methoxy-4-(3,4,5-trimethoxybenzyl)phenol 368064 NSC638388 sensitive
hsa-miR-9-5p 2-methylthieno[3,2-f][1]benzothiole-4,8-dione 375901 NSC656238 sensitive
hsa-miR-9-5p 2-methylthio-1,4-naphthoquinone 96324 NSC67209 resistant
hsa-miR-9-5p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 resistant
hsa-miR-9-5p 2,3-dichloro-5,6,7,8-tetrahydronaphthalene-1,4-diol 320303 NSC267319 resistant
hsa-miR-9-5p 2,4-dimethylpentan-3-yl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 387690 NSC681719 resistant
hsa-miR-9-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-9-5p 2,5-bis[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368963 NSC131233 resistant
hsa-miR-9-5p 2,6-dimethoxy-4-(7-methyl-6-(1-piperidinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 383126 NSC671167 sensitive
hsa-miR-9-5p 2,7-dimethoxy-9-[[2-(diethylamino)ethyl]thio]acridine 395391 NSC699927 resistant
hsa-miR-9-5p 3-(1H-indol-3-yl)-N-[[3-[[[3-(1H-indol-3-yl)-2-bicyclo[2.2.1]heptanyl]amino]methyl]phenyl]methyl]bicyclo[2.2.1]heptan-2-amine 397159 NSC704562 sensitive
hsa-miR-9-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-9-5p 3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)benzonitrile 271921 NSC115928 sensitive
hsa-miR-9-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-9-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-9-5p 3-[3-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]propylcarbamoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 275314 NSC122060 sensitive
hsa-miR-9-5p 3-[3-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]propanoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 270820 NSC113908 sensitive
hsa-miR-9-5p 3-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride;ethanesulfonic acid 277387 NSC126228 sensitive
hsa-miR-9-5p 3-[5-(4-amino-2,6-dibromophenyl)-1,3,4-oxadiazol-2-yl]-1-(1H-benzimidazol-2-yl)propan-1-one 71451481 NSC761980 sensitive
hsa-miR-9-5p 3-benzyl-2-[(2e)-2-[(4-bromophenyl)methylidene]hydrazinyl]-5,6,7,8-tetrahydro-[1]benzothiolo[2,3-d]pyrimidin-4-one 45028588 NSC743399 sensitive
hsa-miR-9-5p 3-bromo-n-[(5-chloro-2-hydroxyphenyl)carbamothioyl]benzamide 3967840 NSC215721 sensitive
hsa-miR-9-5p 3-chloro-4-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride;ethanesulfonic acid 278058 NSC127157 sensitive
hsa-miR-9-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-9-5p 3-piperidinone, 3,5-bis[(3,4-dichlorophenyl)methylene]- 5388806 NSC638643 sensitive
hsa-miR-9-5p 4-(6-hydrazino-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)-2,6-dimethoxyphenol 383133 NSC671174 sensitive
hsa-miR-9-5p 4-[(3E)-3,4-dichloro-1-morpholin-4-yl-2,4-dinitrobuta-1,3-dienyl]morpholine 1618703 NSC698395 resistant
hsa-miR-9-5p 4-amino-5-(5-chloro-1-benzofuran-2-carbonyl)-2-(4-chloro-2-methylanilino)thiophene-3-carbonitrile 328931 NSC309895 sensitive
hsa-miR-9-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-9-5p 4-piperidinone, 1-methyl-2,6-bis[(2-nitrophenyl)methylene]- 5468197 NSC673650 resistant
hsa-miR-9-5p 5-amino-10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2(7),3,5,8,11(19),12,14(18)-heptaene-15,17-dione 399633 NSC710550 sensitive
hsa-miR-9-5p 5-fluoranyl-7-nitro-quinolin-8-ol 260644 NSC92207 sensitive
hsa-miR-9-5p 5-fluoro-4-methoxy-1-(5-oxo-2H-furan-2-yl)pyrimidin-2-one 330094 NSC315844 resistant
hsa-miR-9-5p 5-iodo-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 45029271 NSC745962 sensitive
hsa-miR-9-5p 5-phenoxysulfonyl-1-methyl-4-nitroimidazole 81400 NSC38087 resistant
hsa-miR-9-5p 5,6-bis[(5-methyl-1,3,4-thiadiazol-2-yl)sulfanyl]pyrazine-2,3-dicarbonitrile 395616 NSC700361 resistant
hsa-miR-9-5p 6-(2-fluorophenyl)-5H-[1,3]dioxolo[4,5-g]quinoline-8-thione 3910131 NSC700269 sensitive
hsa-miR-9-5p 6-(3-aminopropyl)-3-nitro-9-phenylindeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 17755120 NSC737671 sensitive
hsa-miR-9-5p 6-(4-methylphenyl)-2-(4-methylsulfonylphenyl)-4,5-dihydropyridazin-3-one 72375194 NSC762908 sensitive
hsa-miR-9-5p 6-(pyridin-3-yl)[1,3]dioxolo[4,5-g]quinolin-8(5h)-one 375864 NSC656162 sensitive
hsa-miR-9-5p 6-[(3,5-dimethoxy-N-methylanilino)methyl]-5-methylpyrido[2,3-d]pyrimidine-2,4-diamine;hydrochloride 382164 NSC669615 sensitive
hsa-miR-9-5p 6-amino-5,6-dihydrocyclopenta[c]thiophen-4-one hydrochloride 396928 NSC704113 resistant
hsa-miR-9-5p 6,7-bis(hydroxymethyl)-8-(3,4,5-trimethoxyphenyl)-5,6,7,8-tetrahydrobenzo[f][1,3]benzodioxol-5-ol 235235 NSC36373 sensitive
hsa-miR-9-5p 7-chloro-1-methyl-phenothiazone 369386 NSC641150 sensitive
hsa-miR-9-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-9-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-9-5p 8-(3,4-dimethoxyphenyl)-2-(2-hydroxyethyl)-5-oxa-2-azatetracyclo[7.7.0.03,7.011,15]hexadeca-1(9),3(7),10,15-tetraen-6-one 54579427 NSC751500 sensitive
hsa-miR-9-5p 8-(4-hydroxy-3,5-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-ol 383128 NSC671169 sensitive
hsa-miR-9-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-9-5p 8-[(2e)-2-(3-butyl-4-oxo-1,3-thiazolidin-2-ylidene)hydrazinyl]-1,3-dimethyl-7h-purine-2,6-dione 9572578 NSC720616 sensitive
hsa-miR-9-5p 8-[4-(4-fluorophenyl)-4-oxobutyl]-1-phenyl-3-propan-2-yl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380261 NSC665740 resistant
hsa-miR-9-5p 8-benzyl-1-phenyl-3-oxa-1,8-diazaspiro[4.5]decan-4-one 380263 NSC665741 sensitive
hsa-miR-9-5p 8-hydroxy-5-iodoquinoline 96111 NSC53183 sensitive
hsa-miR-9-5p 9-(2-chloroethylsulfinyl)-2,7-dimethoxy-acridine 395390 NSC699926 resistant
hsa-miR-9-5p 9-benzyl-6-chloro-8-ethenyl-9h-purine 401179 NSC714380 resistant
hsa-miR-9-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-9-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-9-5p 9-tert-butyl-4-(4-nitrophenyl)-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14,16,18-tetraene-3,5-dione 381785 NSC668851 resistant
hsa-miR-9-5p Acnistin f 495538 NSC657923 resistant
hsa-miR-9-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-9-5p Antineoplastic-643001 5351386 NSC643001 sensitive
hsa-miR-9-5p Basic fuchsin 12447 NSC10466 sensitive
hsa-miR-9-5p Bc 76 246230 NSC58905 sensitive
hsa-miR-9-5p Benzo[1,2-b:4,5-b']dithiophene-4,8-diol, diacetate 393649 NSC695914 sensitive
hsa-miR-9-5p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 sensitive
hsa-miR-9-5p Bioxiran 11254 NSC629 sensitive
hsa-miR-9-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-9-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-9-5p Chemdivam_000505 403081 NSC717553 sensitive
hsa-miR-9-5p Chloroform;(1S,12R)-20-methyl-16-nitro-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13(18),14,16-hexaene-11,19-dione 45027874 NSC730009 sensitive
hsa-miR-9-5p Chromeno[2,3-f]quinolin-7-one 385093 NSC676028 resistant
hsa-miR-9-5p Di-n-octyl-secalonsaure a 430141 NSC268925 sensitive
hsa-miR-9-5p Di-p-tolyliodinium bromide 54601177 NSC8985 sensitive
hsa-miR-9-5p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 sensitive
hsa-miR-9-5p Diethyl (E)-2-(5-methyl-2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469887 NSC693986 resistant
hsa-miR-9-5p Diethylcyanine 5717105 NSC97374 sensitive
hsa-miR-9-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 sensitive
hsa-miR-9-5p Dimethyl 3-bromo-3-(bromomethyl)cyclopropane-1,2-dicarboxylate 395481 NSC700122 resistant
hsa-miR-9-5p Dndi1417002 395921 NSC701016 resistant
hsa-miR-9-5p Emd-534085 23634407 NSC763564 sensitive
hsa-miR-9-5p Ethyl (2Z)-2-[(2-chlorophenyl)methylidene]-5-methyl-3-oxo-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-6-carboxylate 5478638 NSC658291 sensitive
hsa-miR-9-5p Ethyl 2-ethyl-1-oxo-1,2-dihydropyrimido[1,6-a]benzimidazole-4-carboxylate 395848 NSC700851 resistant
hsa-miR-9-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-9-5p Go-y032 1714173 NSC751465 sensitive
hsa-miR-9-5p Gw832467x 6539439 NSC756401 resistant
hsa-miR-9-5p Hexachlorophene 3598 NSC757055 sensitive
hsa-miR-9-5p Iodine green 54605107 NSC8673 sensitive
hsa-miR-9-5p Kijanimicin sodium salt 54707591 NSC329515 sensitive
hsa-miR-9-5p L-cysteine, s-[(4-chlorophenyl)diphenylmethyl]- 275977 NSC123138 sensitive
hsa-miR-9-5p L-cysteine, s-[(4-methylphenyl)diphenylmethyl]- (9ci) 275978 NSC123139 sensitive
hsa-miR-9-5p L-cysteine, s-[bis(4-methylphenyl)phenylmethyl]- 275979 NSC123140 sensitive
hsa-miR-9-5p Lmpk12050091 165203 NSC646923 sensitive
hsa-miR-9-5p Ls-144126 135538372 NSC42369 sensitive
hsa-miR-9-5p Methyl (e)-3-[2-[[methyl-(4-methylphenyl)-oxo-lambda6-sulfanylidene]amino]phenyl]prop-2-enoate 24202623 NSC716715 sensitive
hsa-miR-9-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-9-5p Methyl (Z)-4,4-dicyano-4-(thiophen-2-ylmethylideneamino)but-2-enoate 5470184 NSC698280 resistant
hsa-miR-9-5p Methyl (Z)-4,4-dicyano-4-[(3-methylthiophen-2-yl)methylideneamino]but-2-enoate 5470185 NSC698281 resistant
hsa-miR-9-5p Methyl 5-(3,5-dimethoxybenzyl)-2-hydroxy-5h-benzo[b]carbazole-1-carboxylate 404480 NSC720716 sensitive
hsa-miR-9-5p Methyl 5-(hydroxyamino)-2,6-dimethyl-4-[2-(trifluoromethyl)phenyl]pyridine-3-carboxylate 382124 NSC669517 resistant
hsa-miR-9-5p N'-carbamimidoyl-2-chloro-6-(2,5-dimethoxy-4-nitrophenyl)imidazo[2,1-b][1,3]thiazole-5-carboximidamide;hydrochloride 24202932 NSC726311 sensitive
hsa-miR-9-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-9-5p N-[(e)-[6-(2,5-dimethylanilino)-1-(4-hydroxyphenyl)-2-methyl-1,6-dioxohexan-3-ylidene]amino]-2-hydroxynaphthalene-1-carboxamide 9555801 NSC630357 sensitive
hsa-miR-9-5p N-[2-(dimethylamino)ethyl]-1-[3-[3-[[4-[2-(dimethylamino)ethylcarbamoyl]-9-oxo-10h-acridin-1-yl]amino]propyl-methylamino]propylamino]-9-oxo-10h-acridine-4-carboxamide 399637 NSC710554 sensitive
hsa-miR-9-5p N-[4-[[[2-(4-chloroanilino)pyridine-3-carbonyl]amino]sulfamoyl]phenyl]acetamide 16126694 NSC737147 sensitive
hsa-miR-9-5p N-anthracen-2-yl-8-chloro-5,5-dioxoimidazo[1,2-b][1,4,2]benzodithiazine-7-carboxamide 403255 NSC717956 sensitive
hsa-miR-9-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-9-5p N-cyclohexyl-4-[(2,4-diaminopteridin-6-yl)methyl-methylamino]benzamide 393097 NSC694482 sensitive
hsa-miR-9-5p N,N'-bis[(6-methoxynaphthalen-2-yl)methyl]hexane-1,6-diamine;hydrochloride 385310 NSC676426 sensitive
hsa-miR-9-5p N~2~,n~4~-di(1-adamantyl)-6-chloro-1,3,5-triazine-2,4-diamine 394865 NSC698954 sensitive
hsa-miR-9-5p Neuro_000210 435731 NSC374979 sensitive
hsa-miR-9-5p NSC644919 NSC644919 sensitive
hsa-miR-9-5p NSC688995 NSC688995 sensitive
hsa-miR-9-5p NSC751830 NSC751830 resistant
hsa-miR-9-5p Pipamperone 4830 NSC759178 sensitive
hsa-miR-9-5p Sanguilutine pseudobase 371258 NSC645317 sensitive
hsa-miR-9-5p Sb-223133 22464120 NSC756420 resistant
hsa-miR-9-5p Simvastatin 54454 NSC633782 approved sensitive
hsa-miR-9-5p Sphinxolide f 5470536 NSC702924 resistant
hsa-miR-9-5p Spiropitan 5265 NSC170983 resistant
hsa-miR-9-5p Stereoisomer of nsc 674066-o NSC674067 sensitive
hsa-miR-9-5p Suavedol 65631 NSC141545 sensitive
hsa-miR-9-5p Tiazofurin 323701 NSC286193 sensitive
hsa-miR-9-5p Timtec1_008492 397075 NSC704388 sensitive
hsa-miR-9-5p Triciribine phosphate 43860 NSC280594 resistant
hsa-miR-9-5p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-9-5p Waol a fd-211 10354084 NSC726144 resistant
hsa-miR-9-5p Trail sensitive High Non-Small Cell Lung Cancer cell line (CALU-1, A459, H460)
hsa-miR-9-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-9-5p Daunorubicin 30323 NSC82151 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Prednisolone 5755 NSC9120 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Vincristine 5978 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p L-Asparaginase resistant High Lymphoblastic Leukemia tissue
hsa-miR-9-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SUIT-2, CAPAN-1)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer tissue and cell line (SKOV3)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87, T98G, BT145, BT164)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (C13, OV2008, A2780)
hsa-miR-9-5p Rucaparib phosphate 9931953 sensitive Low Ovarian Cancer tissue and cell line (C13)
hsa-miR-9-5p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87, T98G)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Primary Epithelial Ovarian Cancer Primary Epithelial Ovarian Cancer Single Cells
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved sensitive Low Epithelial Ovarian Cancer tissue and cell line (SKOV3, A2780)
hsa-miR-9-5p Dexamethasone 5743 NSC34521 approved resistant High Myeloma cell line (MM1R, MM1S)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer tissue
hsa-miR-9-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-9-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (A172, U-251MG)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-9-5p Gemcitabine 60750 NSC613327 approved resistant Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-9-5p Cetuximab sensitive Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-9-5p [5-[2,4-Bis((3S)-3-methylmorpholin-4-yl)pyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol 25262965 NSC758871 resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-9-5p Sunitinib 5329102 NSC750690 approved resistant High Renal Cell Cancer tissue
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-9-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-9-5p Daunorubicin 30323 NSC82151 approved sensitive Low Myeloid Leukemia cell line (THP-1, KG-1, HL60, Kasumi-1F)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U251)
hsa-miR-9-5p Alkannin 72521 resistant Low Oral Cancer cell line (CAL-27, SCC-9)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (MKN45, HGC-27)
hsa-miR-9-5p Etoposide 36462 NSC141540 approved resistant Low Leukemia cell line (K562)
hsa-miR-9-5p Imatinib 5291 NSC743414 approved resistant Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-9-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-miR-9-5p Regorafenib 11167602 NSC763932 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Hep3B, Huh-7, SNU387, SNU449)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (MGC803)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant Low Triple-Negative Breast Cancer cell line (HEK-293T, MDA-MB-468)
hsa-miR-9-5p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-116, HT-29)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U87, U251)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251)
hsa-miR-9-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-9-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-9-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-9-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-9-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-9-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-9-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-9-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)

Error report submission