pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-29b-1 |
Genomic Coordinates | chr7: 130877459 - 130877539 |
Synonyms | MIRN29B1, miRNA29B1, MIR29B1 |
Description | Homo sapiens miR-29b-1 stem-loop |
Comment | Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency. |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
pre-miRNA | hsa-mir-29b-2 |
Genomic Coordinates | chr1: 207802443 - 207802523 |
Synonyms | MIRN29B2, mir-29b-2, MIR29B2 |
Description | Homo sapiens miR-29b-2 stem-loop |
Comment | This sequence was named mir-102-1 in reference . Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency. |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-29b-3p | |||||||||||||||||||||
Sequence | 52| UAGCACCAUUUGAAAUCAGUGUU |74 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Cloned | |||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TGFB3 | ||||||||||||||||||||
Synonyms | ARVD, ARVD1, LDS5, RNHF, TGF-beta3 | ||||||||||||||||||||
Description | transforming growth factor beta 3 | ||||||||||||||||||||
Transcript | NM_003239 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TGFB3 | |||||||||||||||||||||
3'UTR of TGFB3 (miRNA target sites are highlighted) |
>TGFB3|NM_003239|3'UTR 1 GACCCCACGTGCGACAGAGAGAGGGGAGAGAGAACCACCACTGCCTGACTGCCCGCTCCTCGGGAAACACACAAGCAACA 81 AACCTCACTGAGAGGCCTGGAGCCCACAACCTTCGGCTCCGGGCAAATGGCTGAGATGGAGGTTTCCTTTTGGAACATTT 161 CTTTCTTGCTGGCTCTGAGAATCACGGTGGTAAAGAAAGTGTGGGTTTGGTTAGAGGAAGGCTGAACTCTTCAGAACACA 241 CAGACTTTCTGTGACGCAGACAGAGGGGATGGGGATAGAGGAAAGGGATGGTAAGTTGAGATGTTGTGTGGCAATGGGAT 321 TTGGGCTACCCTAAAGGGAGAAGGAAGGGCAGAGAATGGCTGGGTCAGGGCCAGACTGGAAGACACTTCAGATCTGAGGT 401 TGGATTTGCTCATTGCTGTACCACATCTGCTCTAGGGAATCTGGATTATGTTATACAAGGCAAGCATTTTTTTTTTTTTT 481 TTAAAGACAGGTTACGAAGACAAAGTCCCAGAATTGTATCTCATACTGTCTGGGATTAAGGGCAAATCTATTACTTTTGC 561 AAACTGTCCTCTACATCAATTAACATCGTGGGTCACTACAGGGAGAAAATCCAGGTCATGCAGTTCCTGGCCCATCAACT 641 GTATTGGGCCTTTTGGATATGCTGAACGCAGAAGAAAGGGTGGAAATCAACCCTCTCCTGTCTGCCCTCTGGGTCCCTCC 721 TCTCACCTCTCCCTCGATCATATTTCCCCTTGGACACTTGGTTAGACGCCTTCCAGGTCAGGATGCACATTTCTGGATTG 801 TGGTTCCATGCAGCCTTGGGGCATTATGGGTTCTTCCCCCACTTCCCCTCCAAGACCCTGTGTTCATTTGGTGTTCCTGG 881 AAGCAGGTGCTACAACATGTGAGGCATTCGGGGAAGCTGCACATGTGCCACACAGTGACTTGGCCCCAGACGCATAGACT 961 GAGGTATAAAGACAAGTATGAATATTACTCTCAAAATCTTTGTATAAATAAATATTTTTGGGGCATCCTGGATGATTTCA 1041 TCTTCTGGAATATTGTTTCTAGAACAGTAAAAGCCTTATTCTAAGGTGTATGTCTGACTCGATAAATATCCTTCAATTAC 1121 CCTTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | 4T1 | ||||||
Disease | breast cancer | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | previous_study | ||||||
Original Description (Extracted from the article) |
...
The miR-29b seed sequence is in red and the complementary binding sites are in green. The mutations generated within the 3' UTRs for c are in purple. The wild-type and mutant 3 ' UTRs of the indicated miR-29b targets were cloned into dual luciferase reporters and co-transfected with miR-29b or cel-67 control mimic.
... - Chou J; Lin JH; Brenot A; Kim JW; Provot S; Werb Z, 2013, Nature cell biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Chou J; Lin JH; Brenot A; Kim JW; Provot S; Werb Z - Nature cell biology, 2013
Despite advances in our understanding of breast cancer, patients with metastatic disease have poor prognoses. GATA3 is a transcription factor that specifies and maintains mammary luminal epithelial cell fate, and its expression is lost in breast cancer, correlating with a worse prognosis in human patients. Here, we show that GATA3 promotes differentiation, suppresses metastasis and alters the tumour microenvironment in breast cancer by inducing microRNA-29b (miR-29b) expression. Accordingly, miR-29b is enriched in luminal breast cancers and loss of miR-29b, even in GATA3-expressing cells, increases metastasis and promotes a mesenchymal phenotype. Mechanistically, miR-29b inhibits metastasis by targeting a network of pro-metastatic regulators involved in angiogenesis, collagen remodelling and proteolysis, including VEGFA, ANGPTL4, PDGF, LOX and MMP9, and targeting ITGA6, ITGB1 and TGFB, thereby indirectly affecting differentiation and epithelial plasticity. The discovery that a GATA3-miR-29b axis regulates the tumour microenvironment and inhibits metastasis opens up possibilities for therapeutic intervention in breast cancer.
LinkOut: [PMID: 23354167]
|
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
248 hsa-miR-29b-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT000095 | TGFB3 | transforming growth factor beta 3 | ![]() |
![]() |
2 | 1 | ||||||
MIRT000096 | HDAC4 | histone deacetylase 4 | ![]() |
![]() |
![]() |
![]() |
4 | 4 | ||||
MIRT000097 | CTNNBIP1 | catenin beta interacting protein 1 | ![]() |
![]() |
![]() |
![]() |
4 | 4 | ||||
MIRT000098 | COL5A3 | collagen type V alpha 3 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT000099 | COL4A2 | collagen type IV alpha 2 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT000100 | COL1A1 | collagen type I alpha 1 chain | ![]() |
![]() |
8 | 8 | ||||||
MIRT000101 | ACVR2A | activin A receptor type 2A | ![]() |
1 | 1 | |||||||
MIRT000445 | SP1 | Sp1 transcription factor | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 6 | |||
MIRT000684 | CDK6 | cyclin dependent kinase 6 | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
6 | 5 | ||
MIRT000930 | BACE1 | beta-secretase 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT002310 | SFPQ | splicing factor proline and glutamine rich | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT002316 | DNAJB11 | DnaJ heat shock protein family (Hsp40) member B11 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003026 | DNMT3B | DNA methyltransferase 3 beta | ![]() |
![]() |
![]() |
![]() |
4 | 7 | ||||
MIRT003029 | DNMT3A | DNA methyltransferase 3 alpha | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 9 | |||
MIRT003287 | MCL1 | MCL1, BCL2 family apoptosis regulator | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
7 | 20 | |
MIRT003290 | BCL2 | BCL2, apoptosis regulator | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT003661 | DNMT1 | DNA methyltransferase 1 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT003736 | S100B | S100 calcium binding protein B | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT003813 | VEGFA | vascular endothelial growth factor A | ![]() |
![]() |
![]() |
9 | 9 | |||||
MIRT004308 | ESR1 | estrogen receptor 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT004312 | NCOA3 | nuclear receptor coactivator 3 | ![]() |
![]() |
2 | 1 | ||||||
MIRT004419 | TET1 | tet methylcytosine dioxygenase 1 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT004510 | TCL1A | T-cell leukemia/lymphoma 1A | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 4 | |||
MIRT005381 | Mmp15 | matrix metallopeptidase 15 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT005383 | MMP15 | matrix metallopeptidase 15 | ![]() |
![]() |
2 | 1 | ||||||
MIRT005385 | MMP24 | matrix metallopeptidase 24 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT005387 | Mmp24 | matrix metallopeptidase 24 | ![]() |
![]() |
2 | 1 | ||||||
MIRT005486 | GRN | granulin precursor | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT005522 | FGG | fibrinogen gamma chain | ![]() |
![]() |
2 | 1 | ||||||
MIRT005533 | FGA | fibrinogen alpha chain | ![]() |
![]() |
2 | 1 | ||||||
MIRT005534 | FGB | fibrinogen beta chain | ![]() |
![]() |
2 | 1 | ||||||
MIRT005567 | COL3A1 | collagen type III alpha 1 chain | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 4 | |||
MIRT005568 | COL4A1 | collagen type IV alpha 1 chain | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
7 | 9 | |
MIRT005570 | MMP2 | matrix metallopeptidase 2 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 8 | |||
MIRT005614 | BBC3 | BCL2 binding component 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT005667 | ADAM12 | ADAM metallopeptidase domain 12 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 3 | |||
MIRT005669 | NID1 | nidogen 1 | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT006054 | HMGA2 | high mobility group AT-hook 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT006058 | TGFB2 | transforming growth factor beta 2 | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT006059 | TGFB1 | transforming growth factor beta 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT006060 | BMP1 | bone morphogenetic protein 1 | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT006098 | PTEN | phosphatase and tensin homolog | ![]() |
![]() |
![]() |
7 | 3 | |||||
MIRT006251 | NASP | nuclear autoantigenic sperm protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT006486 | PPP1R13B | protein phosphatase 1 regulatory subunit 13B | ![]() |
![]() |
2 | 1 | ||||||
MIRT006488 | CDC42 | cell division cycle 42 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT006753 | GSK3B | glycogen synthase kinase 3 beta | ![]() |
1 | 1 | |||||||
MIRT006815 | PIK3CG | phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT006915 | NKIRAS2 | NFKB inhibitor interacting Ras like 2 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 3 | |||
MIRT007011 | RAX | retina and anterior neural fold homeobox | ![]() |
![]() |
2 | 1 | ||||||
MIRT007033 | TBX21 | T-box 21 | ![]() |
1 | 1 | |||||||
MIRT007034 | IFNG | interferon gamma | ![]() |
1 | 1 | |||||||
MIRT007102 | DUSP2 | dual specificity phosphatase 2 | ![]() |
![]() |
![]() |
3 | 3 | |||||
MIRT007254 | FOS | Fos proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
![]() |
3 | 3 | |||||
MIRT027237 | PIK3R1 | phosphoinositide-3-kinase regulatory subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT027238 | IMPDH1 | inosine monophosphate dehydrogenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT027239 | MYCN | MYCN proto-oncogene, bHLH transcription factor | ![]() |
![]() |
![]() |
3 | 3 | |||||
MIRT048359 | SCAF8 | SR-related CTD associated factor 8 | ![]() |
1 | 1 | |||||||
MIRT048360 | CLDN1 | claudin 1 | ![]() |
1 | 1 | |||||||
MIRT048361 | MRPS35 | mitochondrial ribosomal protein S35 | ![]() |
1 | 1 | |||||||
MIRT048362 | RSL24D1 | ribosomal L24 domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT048363 | LRP10 | LDL receptor related protein 10 | ![]() |
1 | 1 | |||||||
MIRT048364 | HP1BP3 | heterochromatin protein 1 binding protein 3 | ![]() |
1 | 1 | |||||||
MIRT048365 | B4GALT5 | beta-1,4-galactosyltransferase 5 | ![]() |
1 | 1 | |||||||
MIRT048366 | KIAA1671 | KIAA1671 | ![]() |
1 | 1 | |||||||
MIRT048367 | NNT | nicotinamide nucleotide transhydrogenase | ![]() |
1 | 1 | |||||||
MIRT048368 | IFIH1 | interferon induced with helicase C domain 1 | ![]() |
1 | 1 | |||||||
MIRT048369 | TPT1 | tumor protein, translationally-controlled 1 | ![]() |
1 | 1 | |||||||
MIRT048370 | RUNDC3B | RUN domain containing 3B | ![]() |
1 | 1 | |||||||
MIRT048371 | CECR2 | CECR2, histone acetyl-lysine reader | ![]() |
1 | 1 | |||||||
MIRT048372 | TPD52L2 | tumor protein D52 like 2 | ![]() |
1 | 1 | |||||||
MIRT048373 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | ![]() |
1 | 1 | |||||||
MIRT048374 | CIT | citron rho-interacting serine/threonine kinase | ![]() |
1 | 1 | |||||||
MIRT048375 | GNB2L1 | receptor for activated C kinase 1 | ![]() |
1 | 1 | |||||||
MIRT048376 | SMARCC1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 | ![]() |
1 | 1 | |||||||
MIRT048377 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | ![]() |
1 | 1 | |||||||
MIRT048378 | PIGN | phosphatidylinositol glycan anchor biosynthesis class N | ![]() |
1 | 1 | |||||||
MIRT048379 | RPS4X | ribosomal protein S4, X-linked | ![]() |
1 | 1 | |||||||
MIRT048380 | CCSAP | centriole, cilia and spindle associated protein | ![]() |
1 | 1 | |||||||
MIRT048381 | CALU | calumenin | ![]() |
1 | 1 | |||||||
MIRT048382 | NREP | neuronal regeneration related protein | ![]() |
1 | 1 | |||||||
MIRT048383 | MKI67 | marker of proliferation Ki-67 | ![]() |
1 | 1 | |||||||
MIRT053293 | TDG | thymine DNA glycosylase | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 5 | |||
MIRT053581 | CCND2 | cyclin D2 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 3 | |||
MIRT053738 | COL4A5 | collagen type IV alpha 5 chain | ![]() |
1 | 1 | |||||||
MIRT053739 | COL7A1 | collagen type VII alpha 1 chain | ![]() |
1 | 1 | |||||||
MIRT053740 | COL15A1 | collagen type XV alpha 1 chain | ![]() |
1 | 1 | |||||||
MIRT053741 | COL2A1 | collagen type II alpha 1 chain | ![]() |
1 | 1 | |||||||
MIRT053742 | COL4A6 | collagen type IV alpha 6 chain | ![]() |
1 | 1 | |||||||
MIRT053743 | CSGALNACT2 | chondroitin sulfate N-acetylgalactosaminyltransferase 2 | ![]() |
1 | 1 | |||||||
MIRT053744 | SOX12 | SRY-box 12 | ![]() |
1 | 1 | |||||||
MIRT053745 | MAP2K6 | mitogen-activated protein kinase kinase 6 | ![]() |
1 | 1 | |||||||
MIRT053746 | TGIF2 | TGFB induced factor homeobox 2 | ![]() |
1 | 1 | |||||||
MIRT053747 | SERPINH1 | serpin family H member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT053748 | NOTCH2 | notch 2 | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT053749 | PPARD | peroxisome proliferator activated receptor delta | ![]() |
1 | 1 | |||||||
MIRT054045 | SNAI3 | snail family transcriptional repressor 3 | ![]() |
![]() |
2 | 1 | ||||||
MIRT054192 | AKT2 | AKT serine/threonine kinase 2 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT054574 | PER1 | period circadian clock 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT060983 | LAMC1 | laminin subunit gamma 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT061662 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT067385 | TMTC3 | transmembrane and tetratricopeptide repeat containing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT079942 | RNF138 | ring finger protein 138 | ![]() |
![]() |
2 | 2 | ||||||
MIRT080798 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT081893 | KCTD15 | potassium channel tetramerization domain containing 15 | ![]() |
![]() |
2 | 8 | ||||||
MIRT082515 | CALM3 | calmodulin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT085293 | CCNT2 | cyclin T2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT102856 | INSIG1 | insulin induced gene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT207249 | TET3 | tet methylcytosine dioxygenase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT207755 | VHL | von Hippel-Lindau tumor suppressor | ![]() |
![]() |
2 | 4 | ||||||
MIRT210969 | TET2 | tet methylcytosine dioxygenase 2 | ![]() |
1 | 1 | |||||||
MIRT211650 | ABCE1 | ATP binding cassette subfamily E member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT213230 | REST | RE1 silencing transcription factor | ![]() |
![]() |
2 | 10 | ||||||
MIRT225103 | GOLGA7 | golgin A7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT250481 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT264266 | FAM102B | family with sequence similarity 102 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT267090 | ZFP91 | ZFP91 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT303363 | MXD1 | MAX dimerization protein 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT316344 | ULBP2 | UL16 binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT401476 | AIM1 | crystallin beta-gamma domain containing 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437369 | LAMC2 | laminin subunit gamma 2 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT437372 | ITGA6 | integrin subunit alpha 6 | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT437552 | COL5A2 | collagen type V alpha 2 chain | ![]() |
1 | 1 | |||||||
MIRT437553 | COL10A1 | collagen type X alpha 1 chain | ![]() |
1 | 1 | |||||||
MIRT437554 | SPARC | secreted protein acidic and cysteine rich | ![]() |
1 | 1 | |||||||
MIRT437555 | FBN1 | fibrillin 1 | ![]() |
1 | 1 | |||||||
MIRT437556 | LOX | lysyl oxidase | ![]() |
![]() |
2 | 2 | ||||||
MIRT437557 | PDGFRB | platelet derived growth factor receptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT437710 | PHACTR2 | phosphatase and actin regulator 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437713 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 1 | ||||||
MIRT437716 | EMP1 | epithelial membrane protein 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437719 | SNX24 | sorting nexin 24 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437722 | AMFR | autocrine motility factor receptor | ![]() |
![]() |
2 | 1 | ||||||
MIRT437725 | RIOK3 | RIO kinase 3 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437728 | WDR26 | WD repeat domain 26 | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT437731 | DSC2 | desmocollin 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437870 | IL32 | interleukin 32 | ![]() |
1 | 1 | |||||||
MIRT438911 | GATA3 | GATA binding protein 3 | ![]() |
![]() |
2 | 1 | ||||||
MIRT438912 | PDGFRA | platelet derived growth factor receptor alpha | ![]() |
![]() |
2 | 1 | ||||||
MIRT438913 | PDGFC | platelet derived growth factor C | ![]() |
![]() |
2 | 1 | ||||||
MIRT438914 | PDGFB | platelet derived growth factor subunit B | ![]() |
![]() |
2 | 1 | ||||||
MIRT438915 | PDGFA | platelet derived growth factor subunit A | ![]() |
![]() |
2 | 1 | ||||||
MIRT438916 | MMP9 | matrix metallopeptidase 9 | ![]() |
![]() |
2 | 1 | ||||||
MIRT438917 | LOXL4 | lysyl oxidase like 4 | ![]() |
![]() |
2 | 1 | ||||||
MIRT438918 | LOXL2 | lysyl oxidase like 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT438919 | ITGB1 | integrin subunit beta 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT438920 | ANGPTL4 | angiopoietin like 4 | ![]() |
![]() |
2 | 1 | ||||||
MIRT454812 | NEDD9 | neural precursor cell expressed, developmentally down-regulated 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456827 | MORF4L2 | mortality factor 4 like 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT462151 | RPL22 | ribosomal protein L22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465314 | TRAM2 | translocation associated membrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467808 | SLC2A14 | solute carrier family 2 member 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467829 | SLC29A2 | solute carrier family 29 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467971 | SLC16A1 | solute carrier family 16 member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT468225 | SGK1 | serum/glucocorticoid regulated kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469448 | REL | REL proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT469723 | RAB40C | RAB40C, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT469841 | R3HDM4 | R3H domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472643 | NAA40 | N(alpha)-acetyltransferase 40, NatD catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT474209 | LEPRE1 | prolyl 3-hydroxylase 1 | ![]() |
1 | 1 | |||||||
MIRT474576 | KLHDC3 | kelch domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475837 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT476721 | FRK | fyn related Src family tyrosine kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT477473 | ELMSAN1 | ELM2 and Myb/SANT domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478668 | CTC1 | CST telomere replication complex component 1 | ![]() |
![]() |
2 | 14 | ||||||
MIRT478710 | CSRNP2 | cysteine and serine rich nuclear protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478985 | COMMD2 | COMM domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479826 | CCNA2 | cyclin A2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT479901 | CCDC117 | coiled-coil domain containing 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480066 | CAND1 | cullin associated and neddylation dissociated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482012 | AMER1 | APC membrane recruitment protein 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT489024 | C1QTNF6 | C1q and TNF related 6 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 2 | |||
MIRT492513 | RAET1L | retinoic acid early transcript 1L | ![]() |
![]() |
2 | 2 | ||||||
MIRT493825 | FSCN1 | fascin actin-bundling protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495936 | SLC7A5P2 | solute carrier family 7 member 5 pseudogene 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496358 | PPY | pancreatic polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT496662 | TMEM237 | transmembrane protein 237 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497644 | GLDN | gliomedin | ![]() |
![]() |
2 | 2 | ||||||
MIRT501878 | MORF4L1 | mortality factor 4 like 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT502932 | CDC42SE1 | CDC42 small effector 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506750 | LDOC1L | retrotransposon Gag like 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507168 | GAS2L3 | growth arrest specific 2 like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT514918 | MDM2 | MDM2 proto-oncogene | ![]() |
![]() |
2 | 6 | ||||||
MIRT523962 | DYNLT1 | dynein light chain Tctex-type 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT527675 | CASP8 | caspase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536936 | HECW1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537359 | FJX1 | four jointed box 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537687 | ENPP2 | ectonucleotide pyrophosphatase/phosphodiesterase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538124 | DDX6 | DEAD-box helicase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538813 | C21orf91 | chromosome 21 open reading frame 91 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546938 | PTP4A1 | protein tyrosine phosphatase type IVA, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547104 | PLAG1 | PLAG1 zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT547823 | ISG20L2 | interferon stimulated exonuclease gene 20 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548237 | FEM1B | fem-1 homolog B | ![]() |
![]() |
2 | 2 | ||||||
MIRT550036 | WWTR1 | WW domain containing transcription regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552619 | ZBTB5 | zinc finger and BTB domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556562 | LIMS1 | LIM zinc finger domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558857 | CDC23 | cell division cycle 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565485 | SPRTN | SprT-like N-terminal domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT568205 | CBX6 | chromobox 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576774 | Tmem127 | transmembrane protein 127 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576958 | Pigs | phosphatidylinositol glycan anchor biosynthesis, class S | ![]() |
![]() |
2 | 3 | ||||||
MIRT610003 | PIGS | phosphatidylinositol glycan anchor biosynthesis class S | ![]() |
![]() |
2 | 3 | ||||||
MIRT616511 | COX7A2L | cytochrome c oxidase subunit 7A2 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT640887 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641350 | RAB11FIP1 | RAB11 family interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642978 | TESPA1 | thymocyte expressed, positive selection associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643634 | YY2 | YY2 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT644386 | ZNF286A | zinc finger protein 286A | ![]() |
![]() |
2 | 2 | ||||||
MIRT650749 | YAE1D1 | Yae1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661585 | EPHX2 | epoxide hydrolase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664287 | RNMTL1 | mitochondrial rRNA methyltransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689393 | ZNF850 | zinc finger protein 850 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693815 | SEC31A | SEC31 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT694532 | TRIM72 | tripartite motif containing 72 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694628 | ZFPM1 | zinc finger protein, FOG family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695135 | PRY2 | PTPN13-like, Y-linked 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695152 | PRY | PTPN13-like, Y-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT703640 | FBRS | fibrosin | ![]() |
![]() |
2 | 2 | ||||||
MIRT704551 | CNBP | CCHC-type zinc finger nucleic acid binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT704967 | CBX2 | chromobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705497 | ASXL2 | additional sex combs like 2, transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT707993 | OTUD4 | OTU deubiquitinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708741 | FAM71F2 | family with sequence similarity 71 member F2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710621 | COLEC10 | collectin subfamily member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713056 | IFRD1 | interferon related developmental regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715515 | MAPKBP1 | mitogen-activated protein kinase binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720770 | FAM193A | family with sequence similarity 193 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT731925 | AQP4 | aquaporin 4 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT732673 | HMGB1 | high mobility group box 1 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT734350 | IL6 | interleukin 6 | ![]() |
1 | 0 | |||||||
MIRT734351 | TP53 | tumor protein p53 | ![]() |
1 | 0 | |||||||
MIRT734565 | BCL2L11 | BCL2 like 11 | ![]() |
![]() |
2 | 0 | ||||||
MIRT734770 | TRIM44 | tripartite motif containing 44 | ![]() |
![]() |
2 | 0 | ||||||
MIRT734771 | CCNE1 | cyclin E1 | ![]() |
![]() |
2 | 0 | ||||||
MIRT735260 | STAT3 | signal transducer and activator of transcription 3 | 6 | 1 | ||||||||
MIRT735414 | HBP1 | HMG-box transcription factor 1 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT735537 | HIF3A | hypoxia inducible factor 3 alpha subunit | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT735639 | HUWE1 | HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT735641 | AKT3 | AKT serine/threonine kinase 3 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT735943 | DNM3OS | DNM3 opposite strand/antisense RNA | ![]() |
![]() |
![]() |
![]() |
4 | 0 | ||||
MIRT737493 | SMAD3 | SMAD family member 3 | ![]() |
1 | 0 | |||||||
MIRT737577 | SNAI1 | snail family transcriptional repressor 1 | ![]() |
![]() |
2 | 0 | ||||||
MIRT755941 | SLMAP | sarcolemma associated protein | 4 | 1 | ||||||||
MIRT755963 | ROBO1 | roundabout guidance receptor 1 | 5 | 1 | ||||||||
MIRT755964 | SRGAP2 | SLIT-ROBO Rho GTPase activating protein 2 | 5 | 1 | ||||||||
MIRT756271 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | 3 | 1 | ||||||||
MIRT756364 | LIN7A | lin-7 homolog A, crumbs cell polarity complex component | 2 | 1 | ||||||||
MIRT756474 | COL5A1 | collagen type V alpha 1 chain | 3 | 1 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|