miRTarBase - #MIRT000098


—
pre-miRNA Information
pre-miRNA hsa-mir-29b-1   
Genomic Coordinates chr7: 130877459 - 130877539
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-29b-2   
Genomic Coordinates chr1: 207802443 - 207802523
Synonyms MIRN29B2, mir-29b-2, MIR29B2
Description Homo sapiens miR-29b-2 stem-loop
Comment This sequence was named mir-102-1 in reference . Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Sequence 52| UAGCACCAUUUGAAAUCAGUGUU |74
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 7 - 130877488 29233923 MiREDiBase
A-to-I 2 1 - 207802471 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs773555186 20 dbSNP
rs1390817128 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol COL5A3   
Synonyms -
Description collagen type V alpha 3 chain
Transcript NM_015719   
Expression
Putative miRNA Targets on COL5A3
3'UTR of COL5A3
(miRNA target sites are highlighted)		 
>COL5A3|NM_015719|3'UTR
   1 GAGTGTCCGGGGTGGGAGGGACCATGAGGGAGCCCCAGAATGGGGTGCATTTGGTGCTGAGGCTTTGAAGCCACCGTATT
  81 TTTCGTTACCTGTGACTATGGAGCCAATGGGATGTGACTTCGCTCATCACGGACAGTCATTCCTTCTCCTTTCCAGGGTG
 161 CTGGGGGCTGGGGTTCCCTGGCCCAAGGGTCCAGCCTCCTCTCACCCCATTCCAGGTGGCATACTGCAGTCTGGCTCTTT
 241 CTCCCCTCCCTCCCCACCCAAGCCTCACCTCCCCACCCCTTGAACCCCCATGCAATGAGCTTCTAACTCAGAGCTGATGA
 321 ACAAAAGCCCCCCCACCCCCAATGCCTGCCTCCTCACTCCTCCGTCGCTGCCCTTCACACCTTTTGGTGCTACCCCTCCC
 401 CAGAGTTAAGCACTGGATGTCTCCTGATCCCAGGCTGGGACCCCTACCCCCACCCCCTTTGATCCTTTCTACTTCCACGG
 481 TGAAAGGACTGAGGTCGGACTACAGAGGGAAGAGGGACTTCCCTTGACTGGGTTGTGTTTCTTTTCCTGCCTCAGCCCAG
 561 CTCTGCAAATCCCCTCCCCCTGCCCCCCACCTCCCCAGGCTCACCTTGCCATGCCAGGTGGTTTGGGGACCAAGATGTTG
 641 GGGGGGTGAATCAGGATCCTAATGGTGCTGCCCTATTTATACCTGGGTCTGTATTAAAAGGGAAAGTCCCCCCTGTTGTA
 721 GATTTCATCTGCTTCCTCCTTAGGGAAGGCTGGGATATGATGAGAGATTCCAGCCCAAGCCTGGCCCCCCACCGCCAGGC
 801 CATAGGGCATAATTTGCATCTCAAATCTGAGAATAAACTGATGAACTGTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuguGACUAAAGUUUACCACGAu 5'
              | |: | | ||||||||| 
Target 5' gaatCAGGATCCTAATGGTGCTg 3'
 648 - 670 159.00 -14.40
2 
miRNA  3' uuGUGAC-UAAAGUUU-----ACCACGAu 5'
            |:|||   |||| |     ||||||| 
Target 5' gtCGCTGCCCTTCACACCTTTTGGTGCTa 3'
 364 - 392 153.00 -16.80
3 
miRNA  3' uugUGACUAAAGUUUACCACGAu 5'
             |: |: | ||  ||||||| 
Target 5' agaATGGGGTGCATTTGGTGCTg 3'
 37 - 59 152.00 -15.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30525119 1 COSMIC
COSN9347175 2 COSMIC
COSN30127529 8 COSMIC
COSN31512220 14 COSMIC
COSN30460862 20 COSMIC
COSN13776551 84 COSMIC
COSN31498343 109 COSMIC
COSN30166949 122 COSMIC
COSN31581285 132 COSMIC
COSN28755197 384 COSMIC
COSN31552597 389 COSMIC
COSN20255337 566 COSMIC
COSN28798545 586 COSMIC
COSN28655658 587 COSMIC
COSN31591571 618 COSMIC
COSN31566911 634 COSMIC
COSN26465728 648 COSMIC
COSN30166660 661 COSMIC
COSN31595439 678 COSMIC
COSN27833688 703 COSMIC
COSN28799352 759 COSMIC
COSN24306666 796 COSMIC
COSN21337453 822 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs769910548 2 dbSNP
rs747608741 4 dbSNP
rs369674786 5 dbSNP
rs1355148636 7 dbSNP
rs374926094 8 dbSNP
rs371498623 9 dbSNP
rs369236503 11 dbSNP
rs758738260 12 dbSNP
rs1190628746 14 dbSNP
rs374836707 18 dbSNP
rs765724915 20 dbSNP
rs1159737735 22 dbSNP
rs762390903 23 dbSNP
rs10406152 24 dbSNP
rs1368004396 26 dbSNP
rs368612762 28 dbSNP
rs1476286934 33 dbSNP
rs1051718074 35 dbSNP
rs1258449636 36 dbSNP
rs375617796 37 dbSNP
rs775752009 38 dbSNP
rs772473205 43 dbSNP
rs200938535 45 dbSNP
rs75339267 48 dbSNP
rs1326064135 54 dbSNP
rs868455616 57 dbSNP
rs1177620651 64 dbSNP
rs1426300115 73 dbSNP
rs539576929 75 dbSNP
rs1023864284 76 dbSNP
rs370477121 79 dbSNP
rs1221589339 80 dbSNP
rs1286609825 84 dbSNP
rs1489135013 97 dbSNP
rs1013768576 98 dbSNP
rs1184544470 109 dbSNP
rs1255188411 121 dbSNP
rs188181882 122 dbSNP
rs1035484810 125 dbSNP
rs1443356175 127 dbSNP
rs772807518 128 dbSNP
rs182768899 130 dbSNP
rs1287484687 131 dbSNP
rs889129 133 dbSNP
rs73020030 135 dbSNP
rs386806739 136 dbSNP
rs546825998 146 dbSNP
rs1380726376 148 dbSNP
rs1245309367 151 dbSNP
rs749890637 156 dbSNP
rs1220739230 157 dbSNP
rs996095172 158 dbSNP
rs1312680616 165 dbSNP
rs1415875170 168 dbSNP
rs1404990661 170 dbSNP
rs995106502 172 dbSNP
rs1297034145 174 dbSNP
rs778574580 174 dbSNP
rs1205126095 180 dbSNP
rs528095148 190 dbSNP
rs1460529328 191 dbSNP
rs570393410 195 dbSNP
rs552187023 209 dbSNP
rs1381550848 219 dbSNP
rs1004624727 222 dbSNP
rs1372047389 224 dbSNP
rs1039558909 225 dbSNP
rs1170909459 233 dbSNP
rs1478615771 243 dbSNP
rs943927769 245 dbSNP
rs1388993272 246 dbSNP
rs1363535405 247 dbSNP
rs1051872550 250 dbSNP
rs1338997725 251 dbSNP
rs1452092998 255 dbSNP
rs965843247 256 dbSNP
rs1375455581 260 dbSNP
rs1221952670 270 dbSNP
rs1306058307 272 dbSNP
rs912956202 275 dbSNP
rs530651438 276 dbSNP
rs563370293 278 dbSNP
rs988525619 280 dbSNP
rs1042955958 281 dbSNP
rs1480333042 285 dbSNP
rs1198735784 286 dbSNP
rs551238510 287 dbSNP
rs1481920893 289 dbSNP
rs1175951267 290 dbSNP
rs935393574 290 dbSNP
rs1258836825 292 dbSNP
rs925332380 293 dbSNP
rs979439259 298 dbSNP
rs913055160 309 dbSNP
rs988890838 319 dbSNP
rs969342702 329 dbSNP
rs1356311191 330 dbSNP
rs916835806 331 dbSNP
rs1368204927 335 dbSNP
rs1406616771 335 dbSNP
rs576683390 335 dbSNP
rs1234279727 336 dbSNP
rs1281070062 341 dbSNP
rs970060042 342 dbSNP
rs1218812333 356 dbSNP
rs1027671033 359 dbSNP
rs1203190976 363 dbSNP
rs992816587 364 dbSNP
rs1305462789 366 dbSNP
rs974306909 367 dbSNP
rs961569550 370 dbSNP
rs1187365369 371 dbSNP
rs1391362557 372 dbSNP
rs1015766132 380 dbSNP
rs1408341657 388 dbSNP
rs868487597 393 dbSNP
rs1169827014 394 dbSNP
rs115689201 395 dbSNP
rs1426412130 396 dbSNP
rs562249517 398 dbSNP
rs1301090657 402 dbSNP
rs1331468123 403 dbSNP
rs1466806357 414 dbSNP
rs556540201 419 dbSNP
rs1030054046 422 dbSNP
rs1472994660 424 dbSNP
rs201950607 430 dbSNP
rs1312735476 433 dbSNP
rs1179526326 442 dbSNP
rs768467338 444 dbSNP
rs1225314774 445 dbSNP
rs35522591 447 dbSNP
rs1238812009 449 dbSNP
rs573174477 451 dbSNP
rs1043396896 453 dbSNP
rs749160193 455 dbSNP
rs142921712 456 dbSNP
rs957251606 464 dbSNP
rs899507656 472 dbSNP
rs1385889797 479 dbSNP
rs891670970 487 dbSNP
rs1210713408 491 dbSNP
rs1161640892 494 dbSNP
rs1052891215 496 dbSNP
rs1319960372 502 dbSNP
rs1259366984 505 dbSNP
rs1039632879 507 dbSNP
rs1008546831 509 dbSNP
rs1343085687 511 dbSNP
rs890982915 524 dbSNP
rs536612811 526 dbSNP
rs1309267965 529 dbSNP
rs928729306 530 dbSNP
rs545786846 537 dbSNP
rs1359349365 538 dbSNP
rs1052715029 543 dbSNP
rs1286717919 548 dbSNP
rs775118380 550 dbSNP
rs1445521619 560 dbSNP
rs1448343442 572 dbSNP
rs1243942426 580 dbSNP
rs980192173 586 dbSNP
rs13822 587 dbSNP
rs116575929 589 dbSNP
rs948074424 600 dbSNP
rs974359059 611 dbSNP
rs1405467835 616 dbSNP
rs961623257 619 dbSNP
rs916577091 634 dbSNP
rs535271487 641 dbSNP
rs992447097 642 dbSNP
rs961267379 645 dbSNP
rs1015822011 646 dbSNP
rs986981571 647 dbSNP
rs78629295 648 dbSNP
rs747257656 656 dbSNP
rs1201865883 664 dbSNP
rs1180495864 665 dbSNP
rs1030519601 686 dbSNP
rs1438356350 693 dbSNP
rs1183947488 706 dbSNP
rs1231077151 707 dbSNP
rs780159683 708 dbSNP
rs1252491910 710 dbSNP
rs984035028 711 dbSNP
rs1176874636 714 dbSNP
rs1430985067 715 dbSNP
rs1467853144 727 dbSNP
rs952176850 733 dbSNP
rs1372854969 756 dbSNP
rs1175120016 758 dbSNP
rs778084024 761 dbSNP
rs964766537 762 dbSNP
rs758555932 764 dbSNP
rs963712356 768 dbSNP
rs1018336819 775 dbSNP
rs1011163202 777 dbSNP
rs891726924 779 dbSNP
rs10425011 782 dbSNP
rs1347643022 783 dbSNP
rs189686848 790 dbSNP
rs1204916947 791 dbSNP
rs145090626 791 dbSNP
rs1030883207 793 dbSNP
rs771023315 794 dbSNP
rs903685198 800 dbSNP
rs907020624 802 dbSNP
rs1270722334 810 dbSNP
rs534952164 812 dbSNP
rs1198289077 824 dbSNP
rs1044907874 831 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Li Z; Hassan MQ; Jafferji M; Aqeilan RI; et al.
- The Journal of biological chemistry, 2009
Bone tissue arises from mesenchymal cells induced into the osteoblast lineage by essential transcription factors and signaling cascades. MicroRNAs regulate biological processes by binding to mRNA 3'-untranslated region (UTR) sequences to attenuate protein synthesis. Here we performed microRNA profiling and identified miRs that are up-regulated through stages of osteoblast differentiation. Among these are the miR-29, miR-let-7, and miR-26 families that target many collagens and extracellular matrix proteins. We find that miR-29b supports osteoblast differentiation through several mechanisms. miR-29b decreased and anti-miR-29b increased activity of COL1A1, COL5A3, and COL4A2 3'-UTR sequences in reporter assays, as well as endogenous gene expression. These results support a mechanism for regulating collagen protein accumulation during the mineralization stage when miR-29b reaches peak levels. We propose that this mechanism prevents fibrosis and facilitates mineral deposition. Our studies further demonstrate that miR-29b promotes osteogenesis by directly down-regulating known inhibitors of osteoblast differentiation, HDAC4, TGFbeta3, ACVR2A, CTNNBIP1, and DUSP2 proteins through binding to target 3'-UTR sequences in their mRNAs. Thus, miR-29b is a key regulator of development of the osteoblast phenotype by targeting anti-osteogenic factors and modulating bone extracellular matrix proteins.
LinkOut: [PMID: 19342382]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions hMSCs
Disease MIMAT0000100
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... "Transfecting cells with the LMWP/miR-29b complex showed that ectopic miR-29b in human MSCs signi茂卢聛cantly repressed the luciferase activity of reporter plasmids carrying the COL1A1 and COL5A3 ...

- Suh JS; Lee JY; Choi YS; Chung CP; Park YJ, 2013, Biomaterials.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uugugacuaaaguuuACCACGAu 5'
                         ||||||| 
Target 5' ---------------UGGUGCU- 3'
 		1 - 7
Article - Suh JS; Lee JY; Choi YS; Chung CP; Park YJ
- Biomaterials, 2013
Stem cell differentiation is modulated by several key molecules, including cytokines, hormones, and engineered peptides. Emerging evidence suggests that microRNA has potential applications in stem cell engineering, such as in osteoblastic differentiation. MicroRNAs (miRNAs) bind to the 3'-untranslated region (UTR) sequence of target mRNA, thereby attenuating protein synthesis. Our goal was to evaluate the delivery of miRNA, i.e., miRNA-29b, to stem cells to promote osteoblastic differentiation because this miRNA is known to target anti-osteogenic factors gene expression. Despite the important role of miRNAs, their application has been limited due to poor cell/tissue penetration. The authors attempted to overcome this limitation by using a cell-penetrating peptide (CPP) carrier. Herein, the arginine-rich CPP, called the lowmolecular weight protamine (LMWP), is the sequence from natural protamine. We worked out the difficult problem to transfect into hMSCs by the complex with LMWP, and then we investigated synthetic double-stranded miR-29b could be induced osteoblast differentiation.
LinkOut: [PMID: 23478036]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE14794 Lymphoblastoid cells -0.271 4.9e-3 -0.236 1.3e-2 90 Click to see details
GSE42095 Differentiated embryonic stem cells 0.496 8.0e-3 0.480 1.0e-2 23 Click to see details
GSE21849 B cell lymphoma -0.399 1.6e-2 -0.209 1.4e-1 29 Click to see details
GSE19536 Breast cancer -0.197 2.5e-2 -0.173 4.3e-2 100 Click to see details
GSE28260 Renal cortex and medulla 0.54 2.8e-2 0.511 3.7e-2 13 Click to see details
GSE17306 Multiple myeloma -0.255 3.9e-2 -0.176 1.1e-1 49 Click to see details
GSE21032 Prostate cancer -0.192 4.1e-2 -0.134 1.1e-1 83 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.729 5.0e-2 -0.086 4.4e-1 6 Click to see details
GSE19783 ER- ER- breast cancer -0.175 6.1e-2 -0.130 1.3e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.258 1.1e-1 -0.195 1.8e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.149 1.2e-1 0.086 2.5e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.363 1.2e-1 -0.308 1.7e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.233 1.6e-1 -0.192 2.1e-1 20 Click to see details
GSE27834 Pluripotent stem cells -0.238 1.9e-1 0.097 3.6e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.146 2.5e-1 0.036 4.3e-1 24 Click to see details
GSE38226 Liver fibrosis 0.093 3.4e-1 0.083 3.6e-1 21 Click to see details
GSE32688 Pancreatic cancer -0.065 3.6e-1 0.045 4.0e-1 32 Click to see details
GSE17498 Multiple myeloma 0.054 3.7e-1 -0.009 4.8e-1 40 Click to see details
GSE28544 Breast cancer 0.061 3.9e-1 -0.014 4.7e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.049 4.1e-1 0.065 3.8e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.013 4.8e-1 -0.027 4.6e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.991 0 -1.000 0.5 4 Click to see details
HNSC -0.36 0.01 -0.319 0.02 42 Click to see details
STAD -0.402 0.01 -0.426 0.01 32 Click to see details
ESCA -0.582 0.03 -0.727 0.01 11 Click to see details
KIRP 0.306 0.04 0.272 0.07 32 Click to see details
PCPG -0.976 0.07 -0.500 0.33 3 Click to see details
LIHC -0.167 0.13 -0.191 0.09 49 Click to see details
BRCA -0.124 0.13 0.003 0.49 84 Click to see details
CESC 0.911 0.14 0.500 0.33 3 Click to see details
UCEC -0.261 0.14 -0.323 0.09 19 Click to see details
KICH 0.195 0.18 -0.052 0.4 25 Click to see details
LUAD -0.243 0.22 -0.105 0.37 12 Click to see details
THCA -0.093 0.24 -0.141 0.14 59 Click to see details
BLCA -0.142 0.29 0.015 0.48 18 Click to see details
CHOL 0.21 0.29 0.383 0.15 9 Click to see details
KIRC -0.066 0.3 -0.076 0.27 68 Click to see details
PRAD 0.07 0.31 -0.004 0.49 50 Click to see details
COAD -0.095 0.41 0.048 0.46 8 Click to see details
LUSC 0 0.5 0.088 0.3 38 Click to see details
LUSC 0 0.5 0.088 0.3 38 Click to see details
LUSC 0 0.5 0.088 0.3 38 Click to see details
248 hsa-miR-29b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000095 TGFB3 transforming growth factor beta 3 2 1
MIRT000096 HDAC4 histone deacetylase 4 4 4
MIRT000097 CTNNBIP1 catenin beta interacting protein 1 4 4
MIRT000098 COL5A3 collagen type V alpha 3 chain 2 2
MIRT000099 COL4A2 collagen type IV alpha 2 chain 2 2
MIRT000100 COL1A1 collagen type I alpha 1 chain 8 8
MIRT000101 ACVR2A activin A receptor type 2A 1 1
MIRT000445 SP1 Sp1 transcription factor 5 6
MIRT000684 CDK6 cyclin dependent kinase 6 6 5
MIRT000930 BACE1 beta-secretase 1 3 1
MIRT002310 SFPQ splicing factor proline and glutamine rich 3 1
MIRT002316 DNAJB11 DnaJ heat shock protein family (Hsp40) member B11 3 1
MIRT003026 DNMT3B DNA methyltransferase 3 beta 4 7
MIRT003029 DNMT3A DNA methyltransferase 3 alpha 5 9
MIRT003287 MCL1 MCL1, BCL2 family apoptosis regulator 7 20
MIRT003290 BCL2 BCL2, apoptosis regulator 4 3
MIRT003661 DNMT1 DNA methyltransferase 1 4 2
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 9 9
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet methylcytosine dioxygenase 1 4 2
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 4 2
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin precursor 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen type III alpha 1 chain 5 4
MIRT005568 COL4A1 collagen type IV alpha 1 chain 7 9
MIRT005570 MMP2 matrix metallopeptidase 2 5 8
MIRT005614 BBC3 BCL2 binding component 3 2 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 5 3
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor beta 2 3 2
MIRT006059 TGFB1 transforming growth factor beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 7 3
MIRT006251 NASP nuclear autoantigenic sperm protein 2 1
MIRT006486 PPP1R13B protein phosphatase 1 regulatory subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 4 2
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras like 2 5 3
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 3 3
MIRT007254 FOS Fos proto-oncogene, AP-1 transcription factor subunit 3 3
MIRT027237 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 2
MIRT027238 IMPDH1 inosine monophosphate dehydrogenase 1 2 2
MIRT027239 MYCN MYCN proto-oncogene, bHLH transcription factor 3 3
MIRT048359 SCAF8 SR-related CTD associated factor 8 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 LDL receptor related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1 binding protein 3 1 1
MIRT048365 B4GALT5 beta-1,4-galactosyltransferase 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 CECR2, histone acetyl-lysine reader 1 1
MIRT048372 TPD52L2 tumor protein D52 like 2 1 1
MIRT048373 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 1 1
MIRT048374 CIT citron rho-interacting serine/threonine kinase 1 1
MIRT048375 GNB2L1 receptor for activated C kinase 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 1 1
MIRT048377 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP centriole, cilia and spindle associated protein 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP neuronal regeneration related protein 1 1
MIRT048383 MKI67 marker of proliferation Ki-67 1 1
MIRT053293 TDG thymine DNA glycosylase 5 5
MIRT053581 CCND2 cyclin D2 5 3
MIRT053738 COL4A5 collagen type IV alpha 5 chain 1 1
MIRT053739 COL7A1 collagen type VII alpha 1 chain 1 1
MIRT053740 COL15A1 collagen type XV alpha 1 chain 1 1
MIRT053741 COL2A1 collagen type II alpha 1 chain 1 1
MIRT053742 COL4A6 collagen type IV alpha 6 chain 1 1
MIRT053743 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT053744 SOX12 SRY-box 12 1 1
MIRT053745 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT053746 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT053747 SERPINH1 serpin family H member 1 2 2
MIRT053748 NOTCH2 notch 2 4 1
MIRT053749 PPARD peroxisome proliferator activated receptor delta 1 1
MIRT054045 SNAI3 snail family transcriptional repressor 3 2 1
MIRT054192 AKT2 AKT serine/threonine kinase 2 4 2
MIRT054574 PER1 period circadian clock 1 3 1
MIRT060983 LAMC1 laminin subunit gamma 1 3 1
MIRT061662 BTG2 BTG anti-proliferation factor 2 2 4
MIRT067385 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT079942 RNF138 ring finger protein 138 2 2
MIRT080798 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT081893 KCTD15 potassium channel tetramerization domain containing 15 2 8
MIRT082515 CALM3 calmodulin 3 2 2
MIRT085293 CCNT2 cyclin T2 2 6
MIRT102856 INSIG1 insulin induced gene 1 2 2
MIRT207249 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT207755 VHL von Hippel-Lindau tumor suppressor 2 4
MIRT210969 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211650 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT213230 REST RE1 silencing transcription factor 2 10
MIRT225103 GOLGA7 golgin A7 2 2
MIRT250481 MAZ MYC associated zinc finger protein 2 2
MIRT264266 FAM102B family with sequence similarity 102 member B 2 2
MIRT267090 ZFP91 ZFP91 zinc finger protein 2 2
MIRT303363 MXD1 MAX dimerization protein 1 2 1
MIRT316344 ULBP2 UL16 binding protein 2 2 2
MIRT401476 AIM1 crystallin beta-gamma domain containing 1 2 1
MIRT437369 LAMC2 laminin subunit gamma 2 3 1
MIRT437372 ITGA6 integrin subunit alpha 6 3 2
MIRT437552 COL5A2 collagen type V alpha 2 chain 1 1
MIRT437553 COL10A1 collagen type X alpha 1 chain 1 1
MIRT437554 SPARC secreted protein acidic and cysteine rich 1 1
MIRT437555 FBN1 fibrillin 1 1 1
MIRT437556 LOX lysyl oxidase 2 2
MIRT437557 PDGFRB platelet derived growth factor receptor beta 2 2
MIRT437710 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437713 TUBB2A tubulin beta 2A class IIa 2 1
MIRT437716 EMP1 epithelial membrane protein 1 2 1
MIRT437719 SNX24 sorting nexin 24 2 1
MIRT437722 AMFR autocrine motility factor receptor 2 1
MIRT437725 RIOK3 RIO kinase 3 2 1
MIRT437728 WDR26 WD repeat domain 26 4 3
MIRT437731 DSC2 desmocollin 2 2 1
MIRT437870 IL32 interleukin 32 1 1
MIRT438911 GATA3 GATA binding protein 3 2 1
MIRT438912 PDGFRA platelet derived growth factor receptor alpha 2 1
MIRT438913 PDGFC platelet derived growth factor C 2 1
MIRT438914 PDGFB platelet derived growth factor subunit B 2 1
MIRT438915 PDGFA platelet derived growth factor subunit A 2 1
MIRT438916 MMP9 matrix metallopeptidase 9 2 1
MIRT438917 LOXL4 lysyl oxidase like 4 2 1
MIRT438918 LOXL2 lysyl oxidase like 2 2 1
MIRT438919 ITGB1 integrin subunit beta 1 2 1
MIRT438920 ANGPTL4 angiopoietin like 4 2 1
MIRT454812 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT456827 MORF4L2 mortality factor 4 like 2 2 8
MIRT462151 RPL22 ribosomal protein L22 2 2
MIRT465314 TRAM2 translocation associated membrane protein 2 2 2
MIRT467808 SLC2A14 solute carrier family 2 member 14 2 2
MIRT467829 SLC29A2 solute carrier family 29 member 2 2 2
MIRT467971 SLC16A1 solute carrier family 16 member 1 2 4
MIRT468225 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469448 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT469723 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT469841 R3HDM4 R3H domain containing 4 2 2
MIRT472643 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 2 2
MIRT474209 LEPRE1 prolyl 3-hydroxylase 1 1 1
MIRT474576 KLHDC3 kelch domain containing 3 2 2
MIRT475837 HDGF heparin binding growth factor 2 4
MIRT476721 FRK fyn related Src family tyrosine kinase 2 4
MIRT477473 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT478668 CTC1 CST telomere replication complex component 1 2 14
MIRT478710 CSRNP2 cysteine and serine rich nuclear protein 2 2 2
MIRT478985 COMMD2 COMM domain containing 2 2 2
MIRT479826 CCNA2 cyclin A2 2 8
MIRT479901 CCDC117 coiled-coil domain containing 117 2 2
MIRT480066 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT482012 AMER1 APC membrane recruitment protein 1 2 8
MIRT489024 C1QTNF6 C1q and TNF related 6 5 2
MIRT492513 RAET1L retinoic acid early transcript 1L 2 2
MIRT493825 FSCN1 fascin actin-bundling protein 1 2 2
MIRT495936 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT496358