miRTarBase - #MIRT000100


—
pre-miRNA Information
pre-miRNA hsa-mir-29b-1   
Genomic Coordinates chr7: 130877459 - 130877539
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-29b-2   
Genomic Coordinates chr1: 207802443 - 207802523
Synonyms MIRN29B2, mir-29b-2, MIR29B2
Description Homo sapiens miR-29b-2 stem-loop
Comment This sequence was named mir-102-1 in reference . Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Sequence 52| UAGCACCAUUUGAAAUCAGUGUU |74
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 7 - 130877488 29233923 MiREDiBase
A-to-I 2 1 - 207802471 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs773555186 20 dbSNP
rs1390817128 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol COL1A1   
Synonyms EDSC, OI1, OI2, OI3, OI4
Description collagen type I alpha 1 chain
Transcript NM_000088   
Expression
Putative miRNA Targets on COL1A1
3'UTR of COL1A1
(miRNA target sites are highlighted)		 
>COL1A1|NM_000088|3'UTR
   1 ACTCCCTCCATCCCAACCTGGCTCCCTCCCACCCAACCAACTTTCCCCCCAACCCGGAAACAGACAAGCAACCCAAACTG
  81 AACCCCCTCAAAAGCCAAAAAATGGGAGACAATTTCACATGGACTTTGGAAAATATTTTTTTCCTTTGCATTCATCTCTC
 161 AAACTTAGTTTTTATCTTTGACCAACCGAACATGACCAAAAACCAAAAGTGCATTCAACCTTACCAAAAAAAAAAAAAAA
 241 AAAAGAATAAATAAATAACTTTTTAAAAAAGGAAGCTTGGTCCACTTGCTTGAAGACCCATGCGGGGGTAAGTCCCTTTC
 321 TGCCCGTTGGGCTTATGAAACCCCAATGCTGCCCTTTCTGCTCCTTTCTCCACACCCCCCTTGGGGCCTCCCCTCCACTC
 401 CTTCCCAAATCTGTCTCCCCAGAAGACACAGGAAACAATGTATTGTCTGCCCAGCAATCAAAGGCAATGCTCAAACACCC
 481 AAGTGGCCCCCACCCTCAGCCCGCTCCTGCCCGCCCAGCACCCCCAGGCCCTGGGGGACCTGGGGTTCTCAGACTGCCAA
 561 AGAAGCCTTGCCATCTGGCGCTCCCATGGCTCTTGCAACATCTCCCCTTCGTTTTTGAGGGGGTCATGCCGGGGGAGCCA
 641 CCAGCCCCTCACTGGGTTCGGAGGAGAGTCAGGAAGGGCCACGACAAAGCAGAAACATCGGATTTGGGGAACGCGTGTCA
 721 ATCCCTTGTGCCGCAGGGCTGGGCGGGAGAGACTGTTCTGTTCCTTGTGTAACTGTGTTGCTGAAAGACTACCTCGTTCT
 801 TGTCTTGATGTGTCACCGGGGCAACTGCCTGGGGGCGGGGATGGGGGCAGGGTGGAAGCGGCTCCCCATTTTATACCAAA
 881 GGTGCTACATCTATGTGATGGGTGGGGTGGGGAGGGAATCACTGGTGCTATAGAAATTGAGATGCCCCCCCAGGCCAGCA
 961 AATGTTCCTTTTTGTTCAAAGTCTATTTTTATTCCTTGATATTTTTCTTTTTTTTTTTTTTTTTTTGTGGATGGGGACTT
1041 GTGAATTTTTCTAAAGGTGCTATTTAACATGGGAGGAGAGCGTGTGCGGCTCCAGCCCAGCCCGCTGCTCACTTTCCACC
1121 CTCTCTCCACCTGCCTCTGGCTTCTCAGGCCTCTGCTCTCCGACCTCTCTCCTCTGAAACCCTCCTCCACAGCTGCAGCC
1201 CATCCTCCCGGCTCCCTCCTAGTCTGTCCTGCGTCCTCTGTCCCCGGGTTTCAGAGACAACTTCCCAAAGCACAAAGCAG
1281 TTTTTCCCCCTAGGGGTGGGAGGAAGCAAAAGACTCTGTACCTATTTTGTATGTGTATAATAATTTGAGATGTTTTTAAT
1361 TATTTTGATTGCTGGAATAAAGCATGTGGAAATGACCCAAACATAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uugugacuaaAGUUUACCACGAu 5'
                    || | ||||||| 
Target 5' ggggagggaaTC-ACTGGTGCTa 3'
 909 - 930 144.00 -12.20
2 
miRNA  3' uugugACU---AAAGUUUACCACGAu 5'
               |||   |||| || |||||| 
Target 5' acttgTGAATTTTTCTAAAGGTGCTa 3'
 1037 - 1062 138.00 -11.70
3 
miRNA  3' uugugacUAAAGU----UUACCACGAu 5'
                 ||||:|    || |||||| 
Target 5' gctccccATTTTATACCAAAGGTGCTa 3'
 861 - 887 130.00 -12.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
804562 16 ClinVar
489278 20 ClinVar
324094 21 ClinVar
889274 73 ClinVar
324093 88 ClinVar
889273 88 ClinVar
889272 93 ClinVar
891701 120 ClinVar
324092 194 ClinVar
324091 202 ClinVar
324090 216 ClinVar
324088 245 ClinVar
324089 245 ClinVar
324087 246 ClinVar
324086 247 ClinVar
324085 252 ClinVar
324084 256 ClinVar
324082 259 ClinVar
324083 259 ClinVar
324081 260 ClinVar
891442 285 ClinVar
889897 342 ClinVar
889896 356 ClinVar
324080 378 ClinVar
324079 437 ClinVar
889215 502 ClinVar
889214 548 ClinVar
324078 623 ClinVar
324077 631 ClinVar
324075 682 ClinVar
324076 682 ClinVar
324074 714 ClinVar
324073 733 ClinVar
324072 744 ClinVar
324071 795 ClinVar
324070 815 ClinVar
889832 836 ClinVar
889153 837 ClinVar
324069 981 ClinVar
324068 1000 ClinVar
324067 1009 ClinVar
889152 1011 ClinVar
892515 1027 ClinVar
324066 1028 ClinVar
324065 1029 ClinVar
324064 1030 ClinVar
324062 1032 ClinVar
324063 1032 ClinVar
324061 1046 ClinVar
324060 1087 ClinVar
891321 1088 ClinVar
891320 1151 ClinVar
324059 1165 ClinVar
324058 1175 ClinVar
324057 1205 ClinVar
324056 1233 ClinVar
324055 1265 ClinVar
889080 1316 ClinVar
324054 1324 ClinVar
324053 1388 ClinVar
COSN30185026 8 COSMIC
COSN26971364 45 COSMIC
COSN30488768 55 COSMIC
COSN31511441 55 COSMIC
COSN26971363 65 COSMIC
COSN19748348 88 COSMIC
COSN30533220 89 COSMIC
COSN30505810 96 COSMIC
COSN30588554 97 COSMIC
COSN30114416 100 COSMIC
COSN30491348 105 COSMIC
COSN31505789 117 COSMIC
COSN22120478 144 COSMIC
COSN22119446 187 COSMIC
COSN22120228 201 COSMIC
COSN20093320 248 COSMIC
COSN20093318 252 COSMIC
COSN20093317 256 COSMIC
COSN27963682 513 COSMIC
COSN22401590 583 COSMIC
COSN17642336 617 COSMIC
COSN20114166 679 COSMIC
COSN5179345 735 COSMIC
COSN31523761 812 COSMIC
COSN8838177 859 COSMIC
COSN25887552 913 COSMIC
COSN31544926 944 COSMIC
COSN31549369 989 COSMIC
COSN26504954 1007 COSMIC
COSN8603362 1027 COSMIC
COSN28655639 1175 COSMIC
COSN22119935 1308 COSMIC
COSN22120227 1310 COSMIC
COSN31570034 1311 COSMIC
rs1061237 88 GWAS
rs3840870 681 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs770414874 4 dbSNP
rs1167413486 5 dbSNP
rs748671504 6 dbSNP
rs1397854018 7 dbSNP
rs1411887098 8 dbSNP
rs1064882 14 dbSNP
rs202170631 16 dbSNP
rs1046454623 18 dbSNP
rs199806909 20 dbSNP
rs201085309 21 dbSNP
rs780248845 24 dbSNP
rs1363631858 28 dbSNP
rs11556514 32 dbSNP
rs895430341 36 dbSNP
rs758710876 37 dbSNP
rs1466207291 41 dbSNP
rs746061442 43 dbSNP
rs757339027 44 dbSNP
rs753857342 45 dbSNP
rs772644181 49 dbSNP
rs1363404758 50 dbSNP
rs750040559 51 dbSNP
rs764961764 51 dbSNP
rs571597998 55 dbSNP
rs552043533 56 dbSNP
rs10144 57 dbSNP
rs1205326663 61 dbSNP
rs532232848 84 dbSNP
rs920080624 86 dbSNP
rs1286205062 87 dbSNP
rs1061237 88 dbSNP
rs1358952166 89 dbSNP
rs1332768144 90 dbSNP
rs1428840575 90 dbSNP
rs367971695 93 dbSNP
rs1401820199 94 dbSNP
rs1170823524 95 dbSNP
rs1464680944 96 dbSNP
rs1420955102 97 dbSNP
rs182302582 102 dbSNP
rs774727896 104 dbSNP
rs1400673825 108 dbSNP
rs1319523813 112 dbSNP
rs1183248956 115 dbSNP
rs1433661050 119 dbSNP
rs773014749 120 dbSNP
rs1345758063 122 dbSNP
rs995103357 133 dbSNP
rs572791972 143 dbSNP
rs1459073596 148 dbSNP
rs1205685651 149 dbSNP
rs540794703 150 dbSNP
rs912288472 164 dbSNP
rs771941565 169 dbSNP
rs953698750 173 dbSNP
rs1201814829 180 dbSNP
rs932870817 186 dbSNP
rs1028218548 187 dbSNP
rs572007575 188 dbSNP
rs1410797866 193 dbSNP
rs886053158 194 dbSNP
rs1302004146 197 dbSNP
rs564917505 202 dbSNP
rs1282845727 203 dbSNP
rs1449615726 204 dbSNP
rs746116257 205 dbSNP
rs1331288454 213 dbSNP
rs886053157 216 dbSNP
rs1018128958 217 dbSNP
rs749440564 217 dbSNP
rs1445322249 220 dbSNP
rs1352260527 222 dbSNP
rs1233554937 224 dbSNP
rs1372473578 225 dbSNP
rs1405649909 227 dbSNP
rs1281277059 231 dbSNP
rs1354166677 240 dbSNP
rs1245078954 241 dbSNP
rs1412769866 243 dbSNP
rs1225068396 245 dbSNP
rs1248672806 245 dbSNP
rs1291175943 245 dbSNP
rs1490526486 245 dbSNP
rs371036719 245 dbSNP
rs56302025 245 dbSNP
rs564411753 245 dbSNP
rs886053156 246 dbSNP
rs886053155 247 dbSNP
rs1225379619 248 dbSNP
rs879149993 248 dbSNP
rs879228374 252 dbSNP
rs886053154 252 dbSNP
rs1330649148 253 dbSNP
rs1338447171 256 dbSNP
rs886053153 256 dbSNP
rs997561276 256 dbSNP
rs886053152 259 dbSNP
rs886053151 260 dbSNP
rs545033057 265 dbSNP
rs1177940665 272 dbSNP
rs1249624194 275 dbSNP
rs1456497312 279 dbSNP
rs1196555065 282 dbSNP
rs990020766 285 dbSNP
rs1460235951 293 dbSNP
rs1183565144 298 dbSNP
rs957278926 301 dbSNP
rs1031926243 303 dbSNP
rs1190401602 304 dbSNP
rs1288033451 305 dbSNP
rs1462195160 307 dbSNP
rs1242713923 308 dbSNP
rs200011356 309 dbSNP
rs1309079019 319 dbSNP
rs1445298112 320 dbSNP
rs748121019 325 dbSNP
rs998677198 326 dbSNP
rs1380400933 332 dbSNP
rs1293552099 336 dbSNP
rs902610684 341 dbSNP
rs1253268385 342 dbSNP
rs1321926542 346 dbSNP
rs977903235 354 dbSNP
rs1264067804 368 dbSNP
rs1463056549 373 dbSNP
rs148131473 378 dbSNP
rs917726182 379 dbSNP
rs1428576413 381 dbSNP
rs1194958185 387 dbSNP
rs35582215 387 dbSNP
rs1013616076 389 dbSNP
rs556918586 393 dbSNP
rs543172732 395 dbSNP
rs1176906997 398 dbSNP
rs1300926652 400 dbSNP
rs1451584442 408 dbSNP
rs895145709 409 dbSNP
rs1280405591 411 dbSNP
rs1343875036 413 dbSNP
rs886053150 437 dbSNP
rs1223070247 439 dbSNP
rs1284346243 444 dbSNP
rs1033521063 463 dbSNP
rs1237592677 471 dbSNP
rs1280094395 472 dbSNP
rs574187446 473 dbSNP
rs1206388137 477 dbSNP
rs554217471 478 dbSNP
rs75168103 479 dbSNP
rs962348430 482 dbSNP
rs1015377719 486 dbSNP
rs1431213561 487 dbSNP
rs931564655 488 dbSNP
rs898707835 491 dbSNP
rs1004356084 502 dbSNP
rs1037624012 503 dbSNP
rs891316684 505 dbSNP
rs571723940 506 dbSNP
rs1404599195 512 dbSNP
rs1219073797 513 dbSNP
rs1488817080 514 dbSNP
rs940173560 518 dbSNP
rs1285824060 521 dbSNP
rs1238579860 523 dbSNP
rs900088795 526 dbSNP
rs1302623641 528 dbSNP
rs912338820 537 dbSNP
rs1479574313 546 dbSNP
rs557681960 548 dbSNP
rs1329962426 553 dbSNP
rs1420825834 562 dbSNP
rs1366307233 579 dbSNP
rs1383507951 586 dbSNP
rs1000231009 587 dbSNP
rs932356762 590 dbSNP
rs1351844234 591 dbSNP
rs903172500 601 dbSNP
rs1297988067 605 dbSNP
rs372353138 607 dbSNP
rs1313527844 610 dbSNP
rs1360903764 611 dbSNP
rs1381477116 615 dbSNP
rs989738246 621 dbSNP
rs886053149 623 dbSNP
rs957537268 627 dbSNP
rs1031560347 628 dbSNP
rs1203314540 630 dbSNP
rs569577942 631 dbSNP
rs1458900941 633 dbSNP
rs937804748 634 dbSNP
rs1242453201 636 dbSNP
rs1445100895 638 dbSNP
rs926578613 640 dbSNP
rs973953328 644 dbSNP
rs1408463563 645 dbSNP
rs971238308 660 dbSNP
rs1169974386 661 dbSNP
rs1355530519 663 dbSNP
rs1360779405 664 dbSNP
rs1176726306 665 dbSNP
rs1432602911 669 dbSNP
rs1382702347 671 dbSNP
rs549697786 672 dbSNP
rs1453935082 673 dbSNP
rs3840870 680 dbSNP
rs35521741 681 dbSNP
rs112626388 682 dbSNP
rs77720683 682 dbSNP
rs141556853 683 dbSNP
rs199723627 683 dbSNP
rs557214395 684 dbSNP
rs1262219167 691 dbSNP
rs868111650 695 dbSNP
rs1461732798 697 dbSNP
rs1013668710 699 dbSNP
rs1196095616 700 dbSNP
rs1478298226 712 dbSNP
rs529873413 713 dbSNP
rs567392981 714 dbSNP
rs1478887051 715 dbSNP
rs1174743713 716 dbSNP
rs1405744218 727 dbSNP
rs964199113 732 dbSNP
rs886053148 733 dbSNP
rs1336683315 741 dbSNP
rs1342972976 742 dbSNP
rs1061947 744 dbSNP
rs898754927 745 dbSNP
rs1037270355 755 dbSNP
rs1004810809 758 dbSNP
rs111435223 761 dbSNP
rs1221257798 766 dbSNP
rs1282432252 787 dbSNP
rs745926887 793 dbSNP
rs886053147 795 dbSNP
rs1051173850 796 dbSNP
rs1445417012 800 dbSNP
rs1042126632 810 dbSNP
rs886053146 815 dbSNP
rs1263924143 817 dbSNP
rs556212417 818 dbSNP
rs1429069771 836 dbSNP
rs527358320 836 dbSNP
rs564977858 837 dbSNP
rs1177994836 839 dbSNP
rs1400579730 840 dbSNP
rs1318437519 841 dbSNP
rs1361854690 842 dbSNP
rs895888962 843 dbSNP
rs1345979442 844 dbSNP
rs1438343032 850 dbSNP
rs1277209791 858 dbSNP
rs1380258031 867 dbSNP
rs1224222911 868 dbSNP
rs1286863347 877 dbSNP
rs1381085992 884 dbSNP
rs62062994 885 dbSNP
rs1355904439 886 dbSNP
rs1220596919 887 dbSNP
rs1268427582 888 dbSNP
rs1452337259 890 dbSNP
rs1201484178 891 dbSNP
rs544994820 893 dbSNP
rs1055801624 897 dbSNP
rs1403967607 898 dbSNP
rs1172954547 899 dbSNP
rs1381679494 901 dbSNP
rs1466235050 903 dbSNP
rs920991964 904 dbSNP
rs1365812161 906 dbSNP
rs1423121495 908 dbSNP
rs377759600 909 dbSNP
rs1191321526 910 dbSNP
rs1425857192 913 dbSNP
rs531350062 915 dbSNP
rs1181769580 929 dbSNP
rs1054544790 932 dbSNP
rs935667741 937 dbSNP
rs937878292 938 dbSNP
rs1243865633 939 dbSNP
rs1357351936 945 dbSNP
rs376098958 946 dbSNP
rs542979909 948 dbSNP
rs367793861 950 dbSNP
rs766065626 951 dbSNP
rs922380869 952 dbSNP
rs975147875 952 dbSNP
rs964231650 956 dbSNP
rs1465931417 959 dbSNP
rs1256958822 972 dbSNP
rs917094352 978 dbSNP
rs574167621 981 dbSNP
rs968040887 982 dbSNP
rs1314503326 985 dbSNP
rs1341113567 991 dbSNP
rs1247320484 995 dbSNP
rs1268624937 996 dbSNP
rs1339215652 1000 dbSNP
rs886053145 1000 dbSNP
rs1395348895 1001 dbSNP
rs1020493955 1002 dbSNP
rs1203544525 1006 dbSNP
rs201245980 1007 dbSNP
rs1333306136 1008 dbSNP
rs886053144 1009 dbSNP
rs1061970 1011 dbSNP
rs1372138293 1011 dbSNP
rs895806530 1012 dbSNP
rs1399648498 1013 dbSNP
rs1469268024 1013 dbSNP
rs554031884 1015 dbSNP
rs1403074408 1016 dbSNP
rs1001554485 1017 dbSNP
rs1369382060 1025 dbSNP
rs1219425608 1027 dbSNP
rs1255683028 1027 dbSNP
rs1321816331 1027 dbSNP
rs1340140345 1027 dbSNP
rs200882287 1027 dbSNP
rs58879635 1027 dbSNP
rs767248844 1027 dbSNP
rs1202857123 1028 dbSNP
rs878912123 1028 dbSNP
rs1488432740 1029 dbSNP
rs577594286 1029 dbSNP
rs751268781 1029 dbSNP
rs878983048 1030 dbSNP
rs1240510631 1031 dbSNP
rs1176789523 1032 dbSNP
rs886053142 1032 dbSNP
rs886053143 1032 dbSNP
rs1179821914 1033 dbSNP
rs1457822152 1035 dbSNP
rs948218229 1037 dbSNP
rs1451468071 1038 dbSNP
rs1156916137 1042 dbSNP
rs886053141 1046 dbSNP
rs535610699 1051 dbSNP
rs896280681 1051 dbSNP
rs540822949 1058 dbSNP
rs1489279473 1059 dbSNP
rs1302332982 1062 dbSNP
rs1314474408 1064 dbSNP
rs1237470752 1066 dbSNP
rs748870013 1070 dbSNP
rs1259676213 1073 dbSNP
rs1353776959 1077 dbSNP
rs1265692681 1081 dbSNP
rs959462068 1082 dbSNP
rs373689267 1083 dbSNP
rs557843360 1087 dbSNP
rs191326459 1088 dbSNP
rs1417270545 1095 dbSNP
rs1180957852 1097 dbSNP
rs568937195 1104 dbSNP
rs1379812427 1112 dbSNP
rs1056146745 1118 dbSNP
rs537589365 1128 dbSNP
rs377369536 1129 dbSNP
rs1160747797 1134 dbSNP
rs865843152 1141 dbSNP
rs1363947978 1149 dbSNP
rs1457542401 1150 dbSNP
rs536196631 1151 dbSNP
rs1062135 1153 dbSNP
rs891340724 1161 dbSNP
rs1309154160 1162 dbSNP
rs887064711 1163 dbSNP
rs1391666098 1164 dbSNP
rs149419718 1165 dbSNP
rs933679759 1168 dbSNP
rs996943385 1169 dbSNP
rs1221792210 1170 dbSNP
rs75713851 1175 dbSNP
rs527505360 1185 dbSNP
rs571331626 1188 dbSNP
rs34162544 1191 dbSNP
rs1238709042 1198 dbSNP
rs370496085 1202 dbSNP
rs551536386 1205 dbSNP
rs763136064 1208 dbSNP
rs1383406763 1209 dbSNP
rs924294540 1210 dbSNP
rs1165726447 1211 dbSNP
rs531312697 1218 dbSNP
rs1178993082 1220 dbSNP
rs1041743121 1222 dbSNP
rs1452854187 1232 dbSNP
rs73987442 1233 dbSNP
rs1401685367 1239 dbSNP
rs1449595725 1244 dbSNP
rs145188105 1245 dbSNP
rs991333121 1246 dbSNP
rs567249120 1265 dbSNP
rs1314414123 1273 dbSNP
rs926721886 1279 dbSNP
rs974181177 1296 dbSNP
rs1197783871 1298 dbSNP
rs1258401977 1299 dbSNP
rs1287957208 1302 dbSNP
rs1459050726 1307 dbSNP
rs12944834 1308 dbSNP
rs1201657090 1309 dbSNP
rs1349817958 1310 dbSNP
rs963065493 1312 dbSNP
rs967567610 1316 dbSNP
rs1277723787 1318 dbSNP
rs1182729659 1319 dbSNP
rs886053140 1324 dbSNP
rs1416242912 1327 dbSNP
rs993079147 1332 dbSNP
rs1300837587 1333 dbSNP
rs1335286925 1337 dbSNP
rs765028341 1350 dbSNP
rs1358126443 1358 dbSNP
rs12937105 1365 dbSNP
rs1015600144 1370 dbSNP
rs886053139 1388 dbSNP
rs1304009039 1394 dbSNP
rs1034330931 1397 dbSNP
rs188154578 1399 dbSNP
rs1299239027 1400 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Li Z; Hassan MQ; Jafferji M; Aqeilan RI; et al.
- The Journal of biological chemistry, 2009
Bone tissue arises from mesenchymal cells induced into the osteoblast lineage by essential transcription factors and signaling cascades. MicroRNAs regulate biological processes by binding to mRNA 3'-untranslated region (UTR) sequences to attenuate protein synthesis. Here we performed microRNA profiling and identified miRs that are up-regulated through stages of osteoblast differentiation. Among these are the miR-29, miR-let-7, and miR-26 families that target many collagens and extracellular matrix proteins. We find that miR-29b supports osteoblast differentiation through several mechanisms. miR-29b decreased and anti-miR-29b increased activity of COL1A1, COL5A3, and COL4A2 3'-UTR sequences in reporter assays, as well as endogenous gene expression. These results support a mechanism for regulating collagen protein accumulation during the mineralization stage when miR-29b reaches peak levels. We propose that this mechanism prevents fibrosis and facilitates mineral deposition. Our studies further demonstrate that miR-29b promotes osteogenesis by directly down-regulating known inhibitors of osteoblast differentiation, HDAC4, TGFbeta3, ACVR2A, CTNNBIP1, and DUSP2 proteins through binding to target 3'-UTR sequences in their mRNAs. Thus, miR-29b is a key regulator of development of the osteoblast phenotype by targeting anti-osteogenic factors and modulating bone extracellular matrix proteins.
LinkOut: [PMID: 19342382]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions LX-2
Disease MIMAT0000100;
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "As a result ...

- Ogawa T; Iizuka M; Sekiya Y; Yoshizato K; et al., 2010, Biochemical and biophysical research communications.

Article - Ogawa T; Iizuka M; Sekiya Y; Yoshizato K; et al.
- Biochemical and biophysical research communications, 2010
MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression through imperfect base pairing with the 3' untranslated region (3'UTR) of target mRNA. We studied the regulation of alpha 1 (I) collagen (Col1A1) expression by miRNAs in human stellate cells, which are involved in liver fibrogenesis. Among miR-29b, -143, and -218, whose expressions were altered in response to transforming growth factor-beta1 or interferon-alpha stimulation, miR-29b was the most effective suppressor of type I collagen at the mRNA and protein level via its direct binding to Col1A1 3'UTR. miR-29b also had an effect on SP1 expression. These results suggested that miR-29b is involved in the regulation of type I collagen expression by interferon-alpha in hepatic stellate cells. It is anticipated that miR-29b will be used for the regulation of stellate cell activation and lead to antifibrotic therapy.
LinkOut: [PMID: 19913496]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions PC3 , DU145
Disease prostate cancer
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Collagens are directly targeted by miR-29b ...

- Steele R; Mott JL; Ray RB, 2010, Genes & cancer.

Article - Steele R; Mott JL; Ray RB
- Genes & cancer, 2010
c-myc promoter binding protein (MBP-1) is a multi-functional protein known to regulate expression of targets involved in the malignant phenotype. We have previously demonstrated that exogenous expression of MBP-1 inhibits prostate tumor growth, although the mechanism of growth inhibition is not well understood. We hypothesized that MBP-1 may modulate microRNA (miRNA) expression for regulation of prostate cancer cell growth. In this study, we demonstrated that exogenous MBP-1 upregulates miR-29b by 5-9 fold in prostate cancer cells as measured by real-time quantitative reverse transcription-PCR. Subsequent studies indicated that exogenous expression of miR-29b inhibited Mcl-1, COL1A1, and COL4A1. Further, a novel target with potential implications for invasion and metastasis, matrix metallopeptidase-2 (MMP-2), was identified and confirmed to be a miR-29b target in prostate cancer cells. Together our results demonstrated that exogenous expression of miR-29b regulates prostate cancer cell growth by modulating anti-apoptotic and pro-metastatic matrix molecules, implicating therapeutic potential of miR-29b for prostate cancer inhibition.
LinkOut: [PMID: 20657750]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Castoldi G; Di Gioia CR; Bombardi C; et al.
- Journal of cellular physiology, 2012
MicroRNAs play an important role in myocardial diseases. MiR-133a regulates cardiac hypertrophy, while miR-29b is involved in cardiac fibrosis. The aim of this study was to evaluate whether miR-133a and miR-29b play a role in myocardial fibrosis caused by Angiotensin II (Ang II)-dependent hypertension. Sprague-Dawley rats were treated for 4 weeks with Ang II (200 ng/kg/min) or Ang II + irbesartan (50 mg/kg/day in drinking water), or saline by osmotic minipumps. At the end of the experimental period, cardiac miR-133a and miR-29b expression was measured by real-time PCR, and myocardial fibrosis was evaluated by morphometric analysis. A computer-based prediction algorithm led to the identification of collagen 1a1 (Col1A1) as a putative target of miR-133a. A reporter plasmid bearing the 3'-untranslated regions (UTRs) of Col1A1 mRNA was constructed and luciferase assay was performed. MiR-133a suppressed the activity of luciferase when the reporter gene was linked to a 3'-UTR segment of Col1A1 (P < 0.01). Mutation of miR-133a binding sites in the 3'-UTR of Col1A1 mRNA abolished miR-133a-mediated repression of reporter gene activity, showing that Col1A1 is a real target of miR-133a. In vivo, Ang II caused an increase in systolic blood pressure (P < 0.0001, tail cuff) and myocardial fibrosis in presence of a decrease in miR-133a (P < 0.01) and miR-29b (P < 0.01), and an increase in Col1A1 expression (P < 0.01). These effects were abolished by Ang II administration + irbesartan. These data demonstrate a relationship between miR-133a and Col1A1, suggesting that myocardial fibrosis occurring in Ang II-dependent hypertension is regulated by the down-regulation of miR-133a and miR-29b through the modulation of Col1A1 expression.
LinkOut: [PMID: 21769867]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions CAKI-2 , 786-O , ACHN , caki-2
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... we found that the p85 regulatory subunit of PI3K harbors a binding site for miR-29b at positions 331 to 337 of its 3'UTR. ...

- Li N; Cui J; Duan X; Chen H; Fan F, 2012, Investigative ophthalmology & visual science.

Article - Li N; Cui J; Duan X; Chen H; Fan F
- Investigative ophthalmology & visual science, 2012
PURPOSE: To evaluate the expression profile of microRNAs (miRNAs) and their roles in human Tenon's fibroblasts (HTFs), and to establish an miRNA-based gene-silencing method for antifibrosis in vitro. METHODS: The miRNA expression profile was analyzed by microarray using quiescent and transforming growth factor beta 1 (TGFbeta1)-stimulated primary HTFs, respectively. Candidate miRNAs were identified by quantitative RT-PCR. miRNAs potentially targeting fibrosis-related genes were predicted using a published algorithm. Predicted fibrosis-related genes regulated by candidate miRNAs were confirmed by transfection of the miRNA into HTF culture (with or without TGFbeta1 treatment), followed by quantitative RT-PCR and Western blot analysis. RESULTS: In all, 38 miRNAs were identified to be upregulated and 31 downregulated, in TGFbeta1-stimulated HTFs. Among those, the miR-29b, downregulated in TGFbeta1-treated HTFs, targeted a cadre of mRNAs that encode proteins involved in fibrosis, including PI3Kp85alpha, Sp1, and collagen type I alpha1 (Col1A1). Treatment of HTFs with TGFbeta1 activated the PI3K/Akt/Sp1 pathway and, consequently, induced an increase in the expression of type I collagen. Overexpression of miR-29b inhibited the PI3K/Akt/Sp1 pathway, and attenuated the expression of Col1A1. CONCLUSIONS. miR-29b acted as a suppressor of type I collagen gene by repressing the PI3K/Akt/Sp1 pathway in HTFs. Overexpression of miR-29b protected subconjunctival tissues against collagen production and fibrosis. These findings provided a novel rationale for the development of miRNA-based strategies for attenuating scar formation after glaucoma filtering surgery.
LinkOut: [PMID: 22297492]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Primary human dermal fibroblasts
Location of target site 3'UTR
Tools used in this research PicTar , TargetScanS
Original Description (Extracted from the article) ... miR-29b mimics significantly inhibited the luciferase activities derived from the reporter vectors carrying collagen subunits 1a1 and 1a2 39UTRs as compared with control ...

- Cheng J; Wang Y; Wang D; Wu Y, 2013, The American journal of the medical sciences.

Article - Cheng J; Wang Y; Wang D; Wu Y
- The American journal of the medical sciences, 2013
BACKGROUND: Excessive collagen synthesis and deposit during skin wound healing results in scar formation. MicroRNAs (miRNAs) are endogenous noncoding RNA regulators that mediate diverse biological functions through repressing target genes and hold great potentials for clinical therapeutic applications. The aim of the present study was to identify miRNAs as post-transcriptional regulators of collagen 1 in skin fibroblasts. METHODS: miRNA candidates that potentially target collagen 1 were predicted by computational algorithms PicTar and TargetScan. The expression changes of collagen subunits 1alpha1 and 1alpha2 were measured by real-time reverse transcription-polymerase chain reaction and western blot after the primary skin fibroblasts were transfected with miR-29b mimics or inhibitor, respectively. A luciferase reporter assay was performed to further determine whether both collagen 1 subunits were probably direct targets of miR-29b. RESULTS: Computational predictions identified several miRNAs as possible regulators for collagen 1 synthesis, including miR-29b. Enforced overexpression of miR-29b resulted in remarkable decrease of collagen 1alpha1 and 1alpha2, whereas knockdown of endogenous miR-29b induced pronounced increase of collagen 1alpha1 and 1alpha2 at both the messenger RNA and the protein levels. The luciferase activities were significantly inhibited when cells were cotransfected with reporter constructs and miR-29 mimics in vitro. Moreover, miR-29b transcriptional abundance inversely related to the levels of both collagen 1 subunits in skin scar as compared with normal skin. CONCLUSIONS: Our data indicate that miR-29b is a potent post-transcriptional repressor of collagen 1 in skin fibroblasts and its deregulation might be implicated in scar formation, suggesting that miR-29b might represent a potential therapeutic target for scar reduction.
LinkOut: [PMID: 23221517]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions hMSCs
Disease MIMAT0000100
Location of target site 3'UTR
Tools used in this research PicTar
Original Description (Extracted from the article) ... "Transfecting cells with the LMWP/miR-29b complex showed that ectopic miR-29b in human MSCs signi茂卢聛cantly repressed the luciferase activity of reporter plasmids carrying the COL1A1 and COL5A3 ...

- Suh JS; Lee JY; Choi YS; Chung CP; Park YJ, 2013, Biomaterials.

Article - Suh JS; Lee JY; Choi YS; Chung CP; Park YJ
- Biomaterials, 2013
Stem cell differentiation is modulated by several key molecules, including cytokines, hormones, and engineered peptides. Emerging evidence suggests that microRNA has potential applications in stem cell engineering, such as in osteoblastic differentiation. MicroRNAs (miRNAs) bind to the 3'-untranslated region (UTR) sequence of target mRNA, thereby attenuating protein synthesis. Our goal was to evaluate the delivery of miRNA, i.e., miRNA-29b, to stem cells to promote osteoblastic differentiation because this miRNA is known to target anti-osteogenic factors gene expression. Despite the important role of miRNAs, their application has been limited due to poor cell/tissue penetration. The authors attempted to overcome this limitation by using a cell-penetrating peptide (CPP) carrier. Herein, the arginine-rich CPP, called the lowmolecular weight protamine (LMWP), is the sequence from natural protamine. We worked out the difficult problem to transfect into hMSCs by the complex with LMWP, and then we investigated synthetic double-stranded miR-29b could be induced osteoblast differentiation.
LinkOut: [PMID: 23478036]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions T4-2
Disease 1277.0
Location of target site 3'UTR
Original Description (Extracted from the article) ... "Quantitative RTPCR demonstrated that miR-29b and -29c mimics also inhibited the expression of the ECM network genes that contain miR- 29芒鈧鈥渂inding sites in the 3'UTR region (Fig. 4E) ...

- Zhu J; Xiong G; Fu H; Evers BM; Zhou BP; Xu R, 2015, Cancer research.

Article - Zhu J; Xiong G; Fu H; Evers BM; Zhou BP; Xu R
- Cancer research, 2015
The extracellular matrix (ECM) is a determining factor in the tumor microenvironment that restrains or promotes malignant growth. In this report, we show how the molecular chaperone protein Hsp47 functions as a nodal hub in regulating an ECM gene transcription network. A transcription network analysis showed that Hsp47 expression was activated during breast cancer development and progression. Hsp47 silencing reprogrammed human breast cancer cells to form growth-arrested and/or noninvasive structures in 3D cultures, and to limit tumor growth in xenograft assays by reducing deposition of collagen and fibronectin. Coexpression network analysis also showed that levels of microRNA(miR)-29b and -29c were inversely correlated with expression of Hsp47 and ECM network genes in human breast cancer tissues. We found that miR-29 repressed expression of Hsp47 along with multiple ECM network genes. Ectopic expression of miR-29b suppressed malignant phenotypes of breast cancer cells in 3D culture. Clinically, increased expression of Hsp47 and reduced levels of miR-29b and -29c were associated with poor survival outcomes in breast cancer patients. Our results show that Hsp47 is regulated by miR-29 during breast cancer development and progression, and that increased Hsp47 expression promotes cancer progression in part by enhancing deposition of ECM proteins.
LinkOut: [PMID: 25744716]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MSC , TDSC
Location of target site 3'UTR
Original Description (Extracted from the article) ... "However ...

- Lu YF; Liu Y; Fu WM; Xu J; Wang B; Sun YX; et al., 2017, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Article - Lu YF; Liu Y; Fu WM; Xu J; Wang B; Sun YX; et al.
- FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 2017
Tendon injures are common orthopedic conditions, but tendon development and the pathogenesis of tendon injures, such as tendinopathy, remain largely unknown and have limited the development of clinical therapy. Studies on tenogenic differentiation at the molecular level may help in developing novel therapeutic strategies. As novel regulators, long noncoding RNAs (lncRNAs) have been found to have widespread biological functions, and emerging evidence demonstrates that lncRNAs may play important regulatory roles in cell differentiation and tissue regeneration. In this study, we found that lncRNA H19 stimulated tenogenesis of human tendon-derived stem cells. Stable overexpression of H19 significantly accelerated TGF-beta1-induced tenogenic differentiation in vitro and accelerated tendon healing in a mouse tendon defect model. H19 directly targeted miR-29b-3p, which is considered to be a negative regulator of tenogenesis. Furthermore, miR-29b-3p directly suppressed the expression of TGF-beta1 and type I collagen, thereby forming a novel regulatory feedback loop between H19 and TGF-beta1 to mediate tenogenic differentiation. Our study demonstrated that H19 promotes tenogenic differentiation both in vitro and in vivo by targeting miR-29b-3p and activating TGF-beta1 signaling. Regulation of the TGF-beta1/H19/miR-29b-3p regulatory loop may be a new strategy for treating tendon injury.-Lu, Y.-F., Liu, Y., Fu, W.-M., Xu, J., Wang, B., Sun, Y.-X., Wu, T.-Y., Xu, L.-L, Chan, K.-M., Zhang, J.-F., Li, G. Long noncoding RNA H19 accelerates tenogenic differentiation and promotes tendon healing through targeting miR-29b-3p and activating TGF-beta1 signaling.
LinkOut: [PMID: 27895107]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.724 1.5e-4 -0.809 7.8e-6 20 Click to see details
GSE19536 Breast cancer -0.321 5.6e-4 -0.321 5.6e-4 100 Click to see details
GSE21687 Ependynoma primary tumors -0.339 3.1e-3 -0.228 3.5e-2 64 Click to see details
GSE19783 ER- ER- breast cancer -0.25 1.3e-2 -0.272 7.7e-3 79 Click to see details
GSE21849 B cell lymphoma -0.393 1.7e-2 -0.184 1.7e-1 29 Click to see details
GSE14794 Lymphoblastoid cells -0.219 1.9e-2 -0.202 2.8e-2 90 Click to see details
GSE19350 CNS germ cell tumors -0.387 1.1e-1 -0.399 9.9e-2 12 Click to see details
GSE21032 Prostate cancer -0.112 1.6e-1 -0.095 2.0e-1 83 Click to see details
GSE32688 Pancreatic cancer -0.154 2.0e-1 -0.188 1.5e-1 32 Click to see details
GSE27834 Pluripotent stem cells 0.131 3.1e-1 0.279 1.5e-1 16 Click to see details
GSE17498 Multiple myeloma 0.06 3.6e-1 -0.144 1.9e-1 40 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.189 3.6e-1 -0.314 2.7e-1 6 Click to see details
GSE42095 Differentiated embryonic stem cells -0.075 3.7e-1 0.189 1.9e-1 23 Click to see details
GSE28544 Breast cancer -0.065 3.8e-1 -0.137 2.6e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.042 4.2e-1 0.105 3.1e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.039 4.3e-1 -0.205 1.7e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.034 4.4e-1 0.099 3.2e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.033 4.5e-1 0.071 3.8e-1 20 Click to see details
GSE38226 Liver fibrosis -0.032 4.5e-1 -0.101 3.3e-1 21 Click to see details
GSE28260 Renal cortex and medulla -0.038 4.5e-1 0.104 3.7e-1 13 Click to see details
GSE17306 Multiple myeloma 0.006 4.8e-1 -0.045 3.8e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.322 0 -0.308 0 84 Click to see details
PAAD -0.921 0.04 -1.000 0.5 4 Click to see details
UCEC -0.406 0.04 -0.398 0.05 19 Click to see details
STAD -0.307 0.04 -0.386 0.01 32 Click to see details
HNSC -0.259 0.05 -0.249 0.06 42 Click to see details
CHOL 0.577 0.05 0.667 0.02 9 Click to see details
KICH 0.284 0.08 0.108 0.3 25 Click to see details
LUSC -0.195 0.12 -0.088 0.3 38 Click to see details
CESC 0.925 0.12 0.500 0.33 3 Click to see details
PRAD -0.131 0.18 -0.111 0.22 50 Click to see details
KIRC -0.072 0.28 -0.049 0.35 68 Click to see details
PCPG 0.6 0.3 0.500 0.33 3 Click to see details
ESCA 0.134 0.35 0.164 0.31 11 Click to see details
LUAD 0.107 0.37 0.105 0.37 12 Click to see details
BLCA -0.067 0.4 -0.061 0.4 18 Click to see details
KIRP -0.03 0.44 -0.066 0.36 32 Click to see details
COAD -0.05 0.45 -0.262 0.27 8 Click to see details
LIHC -0.009 0.48 -0.048 0.37 49 Click to see details
THCA 0.003 0.49 -0.012 0.46 59 Click to see details
THCA 0.003 0.49 -0.012 0.46 59 Click to see details
THCA 0.003 0.49 -0.012 0.46 59 Click to see details
248 hsa-miR-29b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000095 TGFB3 transforming growth factor beta 3 2 1
MIRT000096 HDAC4 histone deacetylase 4 4 4
MIRT000097 CTNNBIP1 catenin beta interacting protein 1 4 4
MIRT000098 COL5A3 collagen type V alpha 3 chain 2 2
MIRT000099 COL4A2 collagen type IV alpha 2 chain 2 2
MIRT000100 COL1A1 collagen type I alpha 1 chain 8 8
MIRT000101 ACVR2A activin A receptor type 2A 1 1
MIRT000445 SP1 Sp1 transcription factor 5 6
MIRT000684 CDK6 cyclin dependent kinase 6 6 5
MIRT000930 BACE1 beta-secretase 1 3 1
MIRT002310 SFPQ splicing factor proline and glutamine rich 3 1
MIRT002316 DNAJB11 DnaJ heat shock protein family (Hsp40) member B11 3 1
MIRT003026 DNMT3B DNA methyltransferase 3 beta 4 7
MIRT003029 DNMT3A DNA methyltransferase 3 alpha 5 9
MIRT003287 MCL1 MCL1, BCL2 family apoptosis regulator 7 20
MIRT003290 BCL2 BCL2, apoptosis regulator 4 3
MIRT003661 DNMT1 DNA methyltransferase 1 4 2
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 9 9
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet methylcytosine dioxygenase 1 4 2
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 4 2
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin precursor 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen type III alpha 1 chain 5 4
MIRT005568 COL4A1 collagen type IV alpha 1 chain 7 9
MIRT005570 MMP2 matrix metallopeptidase 2 5 8
MIRT005614 BBC3 BCL2 binding component 3 2 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 5 3
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor beta 2 3 2
MIRT006059 TGFB1 transforming growth factor beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 7 3
MIRT006251 NASP nuclear autoantigenic sperm protein 2 1
MIRT006486 PPP1R13B protein phosphatase 1 regulatory subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 4 2
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras like 2 5 3
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 3 3
MIRT007254 FOS Fos proto-oncogene, AP-1 transcription factor subunit 3 3
MIRT027237 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 2
MIRT027238 IMPDH1 inosine monophosphate dehydrogenase 1 2 2
MIRT027239 MYCN MYCN proto-oncogene, bHLH transcription factor 3 3
MIRT048359 SCAF8 SR-related CTD associated factor 8 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 LDL receptor related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1 binding protein 3 1 1
MIRT048365 B4GALT5 beta-1,4-galactosyltransferase 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 CECR2, histone acetyl-lysine reader 1 1
MIRT048372 TPD52L2 tumor protein D52 like 2 1 1
MIRT048373 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 1 1
MIRT048374 CIT citron rho-interacting serine/threonine kinase 1 1
MIRT048375 GNB2L1 receptor for activated C kinase 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 1 1
MIRT048377 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP centriole, cilia and spindle associated protein 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP neuronal regeneration related protein 1 1
MIRT048383 MKI67 marker of proliferation Ki-67 1 1
MIRT053293 TDG thymine DNA glycosylase 5 5
MIRT053581 CCND2 cyclin D2 5 3
MIRT053738 COL4A5 collagen type IV alpha 5 chain 1 1
MIRT053739 COL7A1 collagen type VII alpha 1 chain 1 1
MIRT053740 COL15A1 collagen type XV alpha 1 chain 1 1
MIRT053741 COL2A1 collagen type II alpha 1 chain 1 1
MIRT053742 COL4A6 collagen type IV alpha 6 chain 1 1
MIRT053743 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT053744 SOX12 SRY-box 12 1 1
MIRT053745 MAP2K6 mitogen-activated protein kinase kinase 6 1 1
MIRT053746 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT053747 SERPINH1 serpin family H member 1 2 2
MIRT053748 NOTCH2 notch 2 4 1
MIRT053749 PPARD peroxisome proliferator activated receptor delta 1 1
MIRT054045 SNAI3 snail family transcriptional repressor 3 2 1
MIRT054192 AKT2 AKT serine/threonine kinase 2 4 2
MIRT054574 PER1 period circadian clock 1 3 1
MIRT060983 LAMC1 laminin subunit gamma 1 3 1
MIRT061662 BTG2 BTG anti-proliferation factor 2 2 4
MIRT067385 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT079942 RNF138 ring finger protein 138 2 2
MIRT080798 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT081893 KCTD15 potassium channel tetramerization domain containing 15 2 8
MIRT082515 CALM3 calmodulin 3 2 2
MIRT085293 CCNT2 cyclin T2 2 6
MIRT102856 INSIG1 insulin induced gene 1 2 2
MIRT207249 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT207755 VHL von Hippel-Lindau tumor suppressor 2 4
MIRT210969 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211650 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT213230 REST RE1 silencing transcription factor 2 10
MIRT225103 GOLGA7 golgin A7 2 2
MIRT250481 MAZ MYC associated zinc finger protein 2 2
MIRT264266 FAM102B family with sequence similarity 102 member B 2 2
MIRT267090 ZFP91 ZFP91 zinc finger protein 2 2
MIRT303363 MXD1 MAX dimerization protein 1 2 1
MIRT316344 ULBP2 UL16 binding protein 2 2 2
MIRT401476 AIM1 crystallin beta-gamma domain containing 1 2 1
MIRT437369 LAMC2 laminin subunit gamma 2 3 1
MIRT437372 ITGA6 integrin subunit alpha 6 3 2
MIRT437552 COL5A2 collagen type V alpha 2 chain 1 1
MIRT437553 COL10A1 collagen type X alpha 1 chain 1 1
MIRT437554 SPARC secreted protein acidic and cysteine rich 1 1
MIRT437555 FBN1 fibrillin 1 1 1
MIRT437556 LOX lysyl oxidase 2 2
MIRT437557 PDGFRB platelet derived growth factor receptor beta 2 2
MIRT437710 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437713 TUBB2A tubulin beta 2A class IIa 2 1
MIRT437716 EMP1 epithelial membrane protein 1 2 1
MIRT437719 SNX24 sorting nexin 24 2 1
MIRT437722 AMFR autocrine motility factor receptor 2 1
MIRT437725 RIOK3 RIO kinase 3 2 1
MIRT437728 WDR26 WD repeat domain 26 4 3
MIRT437731 DSC2 desmocollin 2 2 1
MIRT437870 IL32 interleukin 32 1 1
MIRT438911 GATA3 GATA binding protein 3 2 1
MIRT438912 PDGFRA platelet derived growth factor receptor alpha 2 1
MIRT438913 PDGFC platelet derived growth factor C 2 1
MIRT438914 PDGFB platelet derived growth factor subunit B 2 1
MIRT438915 PDGFA platelet derived growth factor subunit A 2 1
MIRT438916 MMP9 matrix metallopeptidase 9 2 1
MIRT438917 LOXL4 lysyl oxidase like 4 2 1
MIRT438918 LOXL2 lysyl oxidase like 2 2 1
MIRT438919 ITGB1 integrin subunit beta 1 2 1
MIRT438920 ANGPTL4 angiopoietin like 4 2 1
MIRT454812 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT456827 MORF4L2 mortality factor 4 like 2 2 8
MIRT462151 RPL22 ribosomal protein L22 2 2
MIRT465314 TRAM2 translocation associated membrane protein 2 2 2
MIRT467808 SLC2A14 solute carrier family 2 member 14 2 2
MIRT467829 SLC29A2 solute carrier family 29 member 2 2 2
MIRT467971 SLC16A1 solute carrier family 16 member 1 2 4
MIRT468225 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469448 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT469723 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT469841 R3HDM4 R3H domain containing 4 2 2
MIRT472643 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 2 2
MIRT474209 LEPRE1 prolyl 3-hydroxylase 1 1 1
MIRT474576 KLHDC3 kelch domain containing 3 2 2
MIRT475837 HDGF heparin binding growth factor 2 4
MIRT476721 FRK fyn related Src family tyrosine kinase 2 4
MIRT477473 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT478668 CTC1 CST telomere replication complex component 1 2 14
MIRT478710 CSRNP2 cysteine and serine rich nuclear protein 2 2 2
MIRT478985 COMMD2 COMM domain containing 2 2 2
MIRT479826 CCNA2 cyclin A2 2 8
MIRT479901 CCDC117 coiled-coil domain containing 117 2 2
MIRT480066 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT482012 AMER1 APC membrane recruitment protein 1 2 8
MIRT489024 C1QTNF6 C1q and TNF related 6 5 2
MIRT492513 RAET1L retinoic acid early transcript 1L 2 2
MIRT493825 FSCN1 fascin actin-bundling protein 1 2 2
MIRT495936 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT496358 PPY pancreatic polypeptide 2 2
MIRT496662 TMEM237 transmembrane protein 237 2 2
MIRT497644 GLDN gliomedin 2 2
MIRT501878 MORF4L1 mortality factor 4 like 1 2 8
MIRT502932 CDC42SE1 CDC42 small effector 1 2 4
MIRT506750 LDOC1L retrotransposon Gag like 6 2 6
MIRT507168 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT514918 MDM2 MDM2 proto-oncogene 2 6
MIRT523962 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT527675 CASP8 caspase 8 2 2
MIRT536936 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT537359 FJX1 four jointed box 1 2 2
MIRT537687 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 2 2
MIRT538124 DDX6 DEAD-box helicase 6 2 2
MIRT538813 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT546938 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547104 PLAG1 PLAG1 zinc finger 2 2
MIRT547823 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT548237 FEM1B fem-1 homolog B 2 2
MIRT550036 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT552619 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT556562 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT558857 CDC23 cell division cycle 23 2 2
MIRT565485 SPRTN SprT-like N-terminal domain 2 2
MIRT568205 CBX6 chromobox 6 2 2
MIRT576774 Tmem127 transmembrane protein 127 2 2
MIRT576958 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 2 3
MIRT610003 PIGS phosphatidylinositol glycan anchor biosynthesis class S 2 3
MIRT616511 COX7A2L cytochrome c oxidase subunit 7A2 like 2 2
MIRT640887 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT641350 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT642978 TESPA1 thymocyte expressed, positive selection associated 1 2 2
MIRT643634 YY2 YY2 transcription factor 2 2
MIRT644386 ZNF286A zinc finger protein 286A 2 2
MIRT650749 YAE1D1 Yae1 domain containing 1 2 2
MIRT661585 EPHX2 epoxide hydrolase 2 2 2
MIRT664287 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT689393 ZNF850 zinc finger protein 850 2 2
MIRT693815 SEC31A SEC31 homolog A, COPII coat complex component 2 2
MIRT694532 TRIM72 tripartite motif containing 72 2 2
MIRT694628 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695135 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695152 PRY PTPN13-like, Y-linked 2 2
MIRT703640 FBRS fibrosin 2 2
MIRT704551 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704967 CBX2 chromobox 2 2 2
MIRT705497 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT707993 OTUD4 OTU deubiquitinase 4 2 2
MIRT708741 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT710621 COLEC10 collectin subfamily member 10 2 2
MIRT713056 IFRD1 interferon related developmental regulator 1 2 2
MIRT715515 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT720770 FAM193A family with sequence similarity 193 member A 2 2
MIRT731925 AQP4 aquaporin 4 3 1
MIRT732673 HMGB1 high mobility group box 1 3 0
MIRT734350 IL6 interleukin 6 1 0
MIRT734351 TP53 tumor protein p53 1 0
MIRT734565 BCL2L11 BCL2 like 11 2 0
MIRT734770 TRIM44 tripartite motif containing 44 2 0
MIRT734771 CCNE1 cyclin E1 2 0
MIRT735260 STAT3 signal transducer and activator of transcription 3 6 1
MIRT735414 HBP1 HMG-box transcription factor 1 3 0
MIRT735537 HIF3A hypoxia inducible factor 3 alpha subunit 3 0
MIRT735639 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 3 0
MIRT735641 AKT3 AKT serine/threonine kinase 3 3 0
MIRT735943 DNM3OS DNM3 opposite strand/antisense RNA 4 0
MIRT737493 SMAD3 SMAD family member 3 1 0
MIRT737577 SNAI1 snail family transcriptional repressor 1 2 0
MIRT755941 SLMAP sarcolemma associated protein 4 1
MIRT755963 ROBO1 roundabout guidance receptor 1 5 1
MIRT755964 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 5 1
MIRT756271 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 3 1
MIRT756364 LIN7A lin-7 homolog A, crumbs cell polarity complex component 2 1
MIRT756474 COL5A1 collagen type V alpha 1 chain 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-29b Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-29b Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Microarray prostate cancer 20945501 2011 up-regulated
miR-29b Dihydrotestosterone(DHT) NULL 10635 Quantitative real-time PCR prostate cancer 20945501 2011 up-regulated
miR-29b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-29b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-29b Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-29b Testosterone + 1,25-Dihydroxyvitamin D3 approved NULL Microarray prostate cancer 21592394 2011 up-regulated
miR-29b Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-29b Progesterone approved 5994 Quantitative real-time PCR Breast cancer 22330642 2012 down-regulated
miR-29b Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-29b Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-29b CCl4 NULL 5943 Quantitative real-time PCR liver 22393047 2012 down-regulated
miR-29b Estrogen NULL NULL Quantitative real-time PCR liver 22393047 2012 up-regulated
miR-29b Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 down-regulated
miR-29b 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-29b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-29b Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-29b Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 up-regulated
miR-29b Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 down-regulated
miR-29b Urethane NULL 5641 Quantitative real-time PCR mouse lung 24361357 2014 down-regulated
miR-29b Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 down-regulated
miR-29b Rapamycin approved 5284616 Quantitative real-time PCR HL-1 cells 25062042 2014 up-regualted
miR-29b Estradiol benzoate (EB) NULL NULL Quantitative real-time PCR adult germ cell 22334722 2012 up-regulated
miR-29b Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-29b-3p Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-29b Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-miR-29b-3p (1S,10R,12R,14R,15S)-15-hydroxyspiro[13,16-dioxapentacyclo[8.5.1.01,10.03,8.012,14]hexadeca-3,5,7-triene-11,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-2,9-dione 388424 NSC683332 resistant
hsa-miR-29b-3p (5Z)-5-[(4-oxothieno[2,3-b]thiochromen-2-yl)methylidene]-2-sulfanylideneimidazolidin-4-one 5468927 NSC679240 resistant
hsa-miR-29b-3p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 resistant
hsa-miR-29b-3p 1-adamantylmethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 391131 NSC689857 resistant
hsa-miR-29b-3p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-29b-3p 2-(1-adamantyl)ethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 403758 NSC719177 resistant
hsa-miR-29b-3p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 resistant
hsa-miR-29b-3p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxybenzene-1,4-diol;hydrochloride 5387959 NSC630004 resistant
hsa-miR-29b-3p 2-[[(E)-3-(2-chlorophenyl)prop-2-enoyl]amino]-5-iodobenzamide 53329762 NSC748148 resistant
hsa-miR-29b-3p 2-acetylimidazo[4,5-b]pyridin 4 tolyl 3 thiosemicarbazone 135440014 NSC674106 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 resistant
hsa-miR-29b-3p 2-amino-1-N,9-N-bis[10-[(4-methoxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129907 NSC684908 resistant
hsa-miR-29b-3p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 resistant
hsa-miR-29b-3p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 sensitive
hsa-miR-29b-3p 3-(4-chlorophenyl)-5-methyl-[1,2]oxazolo[5,4-d]triazin-4-one 399226 NSC709900 resistant
hsa-miR-29b-3p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 resistant
hsa-miR-29b-3p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-29b-3p 5,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 372651 NSC648148 resistant
hsa-miR-29b-3p Acetic acid;3-[4-(2-hydroxyethyl)piperidin-1-yl]-N-[6-[3-[4-(2-hydroxyethyl)piperidin-1-yl]propanoylamino]-9,10-dioxoanthracen-2-yl]propanamide 374314 NSC651841 resistant
hsa-miR-29b-3p Beacon red 135421797 NSC12455 resistant
hsa-miR-29b-3p Benzoic acid, 3,4,5-trihydroxy-, phenyl ester 333279 NSC333571 resistant
hsa-miR-29b-3p Csa13 24205348 NSC735211 sensitive
hsa-miR-29b-3p Mefloquine hydrochloride 456309 NSC157387 sensitive
hsa-miR-29b-3p Methyl 3-hydroxy-3-[(15R)-15-tetracyclo[6.6.2.02,7.09,14]hexadeca-2,4,6,9,11,13-hexaenyl]propanedithioate 383730 NSC672159 resistant
hsa-miR-29b-3p Methyl 6-[[(3S,4aR,6aR,6bS,8R,8aR,12aS,14aR,14bR)-8a-[3-[3,4-dihydroxy-6-methyl-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxycarbonyl-8-hydroxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropi 385532 NSC676788 sensitive
hsa-miR-29b-3p Naphth[2,3-d]oxazol-9-one, 2-methyl-4-(phenylimino)- 160386 NSC650573 sensitive
hsa-miR-29b-3p NSC148077 NSC148077 resistant
hsa-miR-29b-3p NSC175490 NSC175490 resistant
hsa-miR-29b-3p NSC175493 NSC175493 resistant
hsa-miR-29b-3p NSC85701 NSC85701 resistant
hsa-miR-29b-3p Oxin 1923 NSC2039 approved resistant
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MDA-435)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (MDA-MB-435, MDA-MB-436, SKBr3, BT-474, MDA-MB-231, MCF7)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-29b-3p Cyclopamine 442972 NSC734950 resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-29b-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Decitabine 451668 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (Kasumi-1, NB4, FDC-P1-KITmut)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Cholangiocarcinoma cell line (HuCCT1, HuH28)
hsa-miR-29b-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-29b-3p Ethanol 702 NSC85228 approved resistant Low Cerebellum Granule Neuron tissue
hsa-miR-29b-3p Chemotherapy sensitive Low Ovarian Cancer tissue
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (ES2, AMOC2)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Carfilzomib 11556711 NSC756640 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Ixazomib 25183872 approved sensitive Low Melanoma cell line (RPMI8226)
hsa-miR-29b-3p Interferon-Gamma sensitive Low Colorectal Cancer cell line (HCT-116, HT-29, LS174T, SW480,SW620, HEK293)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-29b-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-29b-3p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-29b-3p Methotrexate 126941 NSC740 approved sensitive Low Osteosarcoma tissue and cell line (MG-63, U-2-OS)
hsa-miR-29b-3p Crizotinib 11626560 NSC749005 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Lorlatinib 71731823 NSC780108 approved resistant High Non-Small Cell Lung Cancer cell line (NCI-H2228, DFCI032)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (MG-63)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Cancer cell line (PANC-1 cell, BXPC-3)
hsa-miR-29b-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-21)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Endometrial Cancer cell line (HEC-1-B)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colon Cancer cell line (SW480, SW620)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (LN229, U87MG, U251)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251, U87MG)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HT-29, DLD1)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-29b-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (MDA-MB-231, Hs578t, SKBR3, MCF-7)
hsa-miR-29b-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma tissue
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-29b-3p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HT-29, HCT-116, SW480, SW620, LoVo, SW48, DLD-1, Caco-1, HCT-15)
hsa-miR-29b-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-29b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKVO3ip1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-29b-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-29b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-29b-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-29b-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (HuH28)
hsa-miR-29b-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-29b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-29b-3p Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-29b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-29b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-29b-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-29b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-29b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-29b-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission