| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-26a-1 |
| Genomic Coordinates | chr3: 37969404 - 37969480 |
| Synonyms | MIR26A, MIRN26A1, MIR26A1 |
| Description | Homo sapiens miR-26a-1 stem-loop |
| Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| pre-miRNA | hsa-mir-26a-2 |
| Genomic Coordinates | chr12: 57824609 - 57824692 |
| Synonyms | MIRN26A2, MIR26A2 |
| Description | Homo sapiens miR-26a-2 stem-loop |
| Comment | miR-26a was cloned from HeLa cells . |
| RNA Secondary Structure | |
| Associated Diseases |  |
| Mature miRNA Information | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-26a-5p | |||||||||||||||||||||||||||
| Sequence | 10| UUCAAGUAAUCCAGGAUAGGCU |31 | |||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||
| Experiments | Cloned | |||||||||||||||||||||||||||
| Editing Events in miRNAs |
|
DRVs in miRNA |
|
|||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Biomarker Information |
| ||||||
|---|---|---|---|---|---|---|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | HMGA2 | ||||||||||||||||||||
| Synonyms | BABL, HMGI-C, HMGIC, LIPO, STQTL9 | ||||||||||||||||||||
| Description | high mobility group AT-hook 2 | ||||||||||||||||||||
| Transcript | NM_003483 | ||||||||||||||||||||
| Other Transcripts | NM_003484 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on HMGA2 | |||||||||||||||||||||
| 3'UTR of HMGA2 (miRNA target sites are highlighted) |
>HMGA2|NM_003483|3'UTR 1 GGGGCGCCAACGTTCGATTTCTACCTCAGCAGCAGTTGGATCTTTTGAAGGGAGAAGACACTGCAGTGACCACTTATTCT 81 GTATTGCCATGGTCTTTCCACTTTCATCTGGGGTGGGGTGGGGTGGGGTGGGGGAGGGGGGGGTGGGGTGGGGAGAAATC 161 ACATAACCTTAAAAAGGACTATATTAATCACCTTCTTTGTAATCCCTTCACAGTCCCAGGTTTAGTGAAAAACTGCTGTA 241 AACACAGGGGACACAGCTTAACAATGCAACTTTTAATTACTGTTTTCTTTTTTCTTAACCTACTAATAGTTTGTTGATCT 321 GATAAGCAAGAGTGGGCGGGTGAGAAAAACCGAATTGGGTTTAGTCAATCACTGCACTGCATGCAAACAAGAAACGTGTC 401 ACACTTGTGACGTCGGGCATTCATATAGGAAGAACGCGGTGTGTAACACTGTGTACACCTCAAATACCACCCCAACCCAC 481 TCCCTGTAGTGAATCCTCTGTTTAGAACACCAAAGATAAGGACTAGATACTACTTTCTCTTTTTCGTATAATCTTGTAGA 561 CACTTACTTGATGATTTTTAACTTTTTATTTCTAAATGAGACGAAATGCTGATGTATCCTTTCATTCAGCTAACAAACTA 641 GAAAAGGTTATGTTCATTTTTCAAAAAGGGAAGTAAGCAAACAAATATTGCCAACTCTTCTATTTATGGATATCACACAT 721 ATCAGCAGGAGTAATAAATTTACTCACAGCACTTGTTTTCAGGACAACACTTCATTTTCAGGAAATCTACTTCCTACAGA 801 GCCAAAATGCCATTTAGCAATAAATAACACTTGTCAGCCTCAGAGCATTTAAGGAAACTAGACAAGTAAAATTATCCTCT 881 TTGTAATTTAATGAAAAGGTACAACAGAATAATGCATGATGAACTCACCTAATTATGAGGTGGGAGGAGCGAAATCTAAA 961 TTTCTTTTGCTATAGTTATACATCAATTTAAAAAGCAAAAAAAAAAAAGGGGGGGGCAATCTCTCTCTGTGTCTTTCTCT 1041 CTCTCTCTTCCTCTCCCTCTCTCTTTTCATTGTGTATCAGTTTCCATGAAAGACCTGAATACCACTTACCTCAAATTAAG 1121 CATATGTGTTACTTCAAGTAATACGTTTTGACATAAGATGGTTGACCAAGGTGCTTTTCTTCGGCTTGAGTTCACCATCT 1201 CTTCATTCAAACTGCACTTTTAGCCAGAGATGCAATATATCCCCACTACTCAATACTACCTCTGAATGTTACAACGAATT 1281 TACAGTCTAGTACTTATTACATGCTGCTATACACAAGCAATGCAAGAAAAAAACTTACTGGGTAGGTGATTCTAATCATC 1361 TGCAGTTCTTTTTGTACACTTAATTACAGTTAAAGAAGCAATCTCCTTACTGTGTTTCAGCATGACTATGTATTTTTCTA 1441 TGTTTTTTTAATTAAAAATTTTTAAAATACTTGTTTCAGCTTCTCTGCTAGATTTCTACATTAACTTGAAAATTTTTTAA 1521 CCAAGTCGCTCCTAGGTTCTTAAGGATAATTTTCCTCAATCACACTACACATCACACAAGATTTGACTGTAATATTTAAA 1601 TATTACCCTCCAAGTCTGTACCTCAAATGAATTCTTTAAGGAGATGGACTAATTGACTTGCAAAGACCTACCTCCAGACT 1681 TCAAAAGGAATGAACTTGTTACTTGCAGCATTCATTTGTTTTTTCAATGTTTGAAATAGTTCAAACTGCAGCTAACCCTA 1761 GTCAAAACTATTTTTGTAAAAGACATTTGATAGAAAGGAACACGTTTTTACATACTTTTGCAAAATAAGTAAATAATAAA 1841 TAAAATAAAAGCCAACCTTCAAAGAAACTTGAAGCTTTGTAGGTGAGATGCAACAAGCCCTGCTTTTGCATAATGCAATC 1921 AAAAATATGTGTTTTTAAGATTAGTTGAATATAAGAAAATGCTTGACAAATATTTTCATGTATTTTACACAAATGTGATT 2001 TTTGTAATATGTCTCAACCAGATTTATTTTAAACGCTTCTTATGTAGAGTTTTTATGCCTTTCTCTCCTAGTGAGTGTGC 2081 TGACTTTTTAACATGGTATTATCAACTGGGCCAGGAGGTAGTTTCTCATGACGGCTTTTGTCAGTATGGCTTTTAGTACT 2161 GAAGCCAAATGAAACTCAAAACCATCTCTCTTCCAGCTGCTTCAGGGAGGTAGTTTCAAAGGCCACATACCTCTCTGAGA 2241 CTGGCAGATCGCTCACTGTTGTGAATCACCAAAGGAGCTATGGAGAGAATTAAAACTCAACATTACTGTTAACTGTGCGT 2321 TAAATAAGCAAATAAACAGTGGCTCATAAAAATAAAAGTCGCATTCCATATCTTTGGATGGGCCTTTTAGAAACCTCATT 2401 GGCCAGCTCATAAAATGGAAGCAATTGCTCATGTTGGCCAAACATGGTGCACCGAGTGATTTCCATCTCTGGTAAAGTTA 2481 CACTTTTATTTCCTGTATGTTGTACAATCAAAACACACTACTACCTCTTAAGTCCCAGTATACCTCATTTTTCATACTGA 2561 AAAAAAAAGCTTGTGGCCAATGGAACAGTAAGAACATCATAAAATTTTTATATATATAGTTTATTTTTGTGGGAGATAAA 2641 TTTTATAGGACTGTTCTTTGCTGTTGTTGGTCGCAGCTACATAAGACTGGACATTTAACTTTTCTACCATTTCTGCAAGT 2721 TAGGTATGTTTGCAGGAGAAAAGTATCAAGACGTTTAACTGCAGTTGACTTTCTCCCTGTTCCTTTGAGTGTCTTCTAAC 2801 TTTATTCTTTGTTCTTTATGTAGAATTGCTGTCTATGATTGTACTTTGAATCGCTTGCTTGTTGAAAATATTTCTCTAGT 2881 GTATTATCACTGTCTGTTCTGCACAATAAACATAACAGCCTCTGTGATCCCCATGTGTTTTGATTCCTGCTCTTTGTTAC 2961 AGTTCCATTAAATGAGTAATAAAGTTTGGTCAAAACAGAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Visone R; Pallante P; Vecchione A; et al. - Oncogene, 2007
Thyroid carcinomas comprise a broad spectrum of tumors with different clinical behaviors. On the one side, there are occult papillary carcinomas (PTC), slow growing and clinically silent, and on the other side, rapidly growing anaplastic carcinomas (ATC), which are among the most lethal human neoplasms. We have analysed the microRNA (miR) profile of ATC in comparison to the normal thyroid using a microarray (miRNACHIP microarray). By this approach, we found an aberrant miR expression profile that clearly differentiates ATC from normal thyroid tissues and from PTC analysed in previous studies. In particular, a significant decrease in miR-30d, miR-125b, miR-26a and miR-30a-5p was detected in ATC in comparison to normal thyroid tissue. These results were further confirmed by northern blots, quantitative reverse transcription-PCR analyses and in situ hybridization. The overexpression of these four miRs in two human ATC-derived cell lines suggests a critical role of miR-125b and miR-26a downregulation in thyroid carcinogenesis, since a cell growth inhibition was achieved. Conversely, no effect on cell growth was observed after the overexpression of miR-30d and miR-30a-5p in the same cells. In conclusion, these data indicate a miR signature associated with ATC and suggest the miR deregulation as an important event in thyroid cell transformation.
LinkOut: [PMID: 17563749]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Huse JT; Brennan C; Hambardzumyan D; Wee B; et al. - Genes & development, 2009
Activated oncogenic signaling is central to the development of nearly all forms of cancer, including the most common class of primary brain tumor, glioma. Research over the last two decades has revealed the particular importance of the Akt pathway, and its molecular antagonist PTEN (phosphatase and tensin homolog), in the process of gliomagenesis. Recent studies have also demonstrated that microRNAs (miRNAs) may be responsible for the modulation of cancer-implicated genes in tumors. Here we report the identification miR-26a as a direct regulator of PTEN expression. We also show that miR-26a is frequently amplified at the DNA level in human glioma, most often in association with monoallelic PTEN loss. Finally, we demonstrate that miR-26a-mediated PTEN repression in a murine glioma model both enhances de novo tumor formation and precludes loss of heterozygosity and the PTEN locus. Our results document a new epigenetic mechanism for PTEN regulation in glioma and further highlight dysregulation of Akt signaling as crucial to the development of these tumors.
LinkOut: [PMID: 19487573]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MEG-01 |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , PicTar , TargetScan |
| Original Description (Extracted from the article) |
...
"This analysis identi茂卢聛ed miR-15ab
... - Palmieri D; D'Angelo D; Valentino T; De et al., 2012, Oncogene. |
| Article |
- Palmieri D; D'Angelo D; Valentino T; De et al. - Oncogene, 2012
Previous studies have demonstrated that high mobility group A proteins have a critical role on the onset of human pituitary adenomas. Indeed, both high mobility group A (HMGA) genes are overexpressed in pituitary adenomas, and consistently transgenic mice overexpressing either the Hmga1 or the Hmga2 gene develop mixed growth hormone/prolactin (GH-PRL)-secreting pituitary adenomas. Trisomy of chromosome 12, where HMGA2 is located, and/or amplification of the HMGA2 gene locus account for the HMGA2 overexpression in most human prolactinomas. Conversely, HMGA1 overexpression is not associated to any rearrangement or amplification of the HMGA1 locus. We have first identified micro RNAs (miRNAs) able to target both HMGA1 and HMGA2 messenger RNAs. Then, all of these miRNAs have been found downregulated in pituitary adenomas of different histotypes, compared with normal pituitary. Interestingly, their downregulation was also observed in nonfunctioning pituitary adenomas where HMGA2 overexpression is not associated to any alteration of the HMGA2 locus. Functional studies show that all these HMGA-targeting miRNAs inhibit the proliferation of the rat pituitary adenoma cell line GH3. Therefore, these results indicate that the downregulation of the miRNAs able to target the HMGA genes could contribute to increase HMGA protein levels in human pituitary adenomas, and then to pituitary tumorigenesis.
LinkOut: [PMID: 22139073]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK-293T |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , PicTar , TargetScan |
| Article |
- Zhou H; Guo W; Zhao Y; Wang Y; Zha R; Ding et al. - International journal of oncology, 2014
MicroRNAs (miRNAs) are a class of small, single-stranded, non-coding RNA molecules which can act as oncogenes or tumor suppressor genes in human cancer. However, the possible functions and mechanisms of miRNA action in gallbladder cancer (GBC) have not been elucidated. In the present study, it was found that miR-26a was often downregulated in GBC and the expression of miR-26a was associated with neoplasm histological grade. miR-26a significantly inhibited the proliferation of GBC cells based on the gain-of-function assays. Furthermore, we demonstrated that high mobility group AT-hook 2 (HMGA2) was a direct target of miR-26a. The results showed that HMGA2 mRNA levels and miR-26a levels were negatively correlated. In addition, we confirmed that reintroduction of HMGA2 antagonized the inhibition of miR-26a to GBC cell proliferation and all these effects were achieved through the cell cycle. Together, all these results suggest that miR-26a expression contributes to GBC proliferation by targeting HMGA2. miR-26a shows promise as a prognosis factor and therapeutic target of GBC patients.
LinkOut: [PMID: 24682444]
|
| Experimental Support 5 for Non-Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | xx |
| Validation Method |
|
| Conditions | A549 cells |
| Disease | MIMAT0000082 |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , miRBase Target Database , miRecord , PITA , RNAhybrid , TargetScan |
| Original Description (Extracted from the article) |
...
"HMGA2 is a direct target of miR-26a in A549 cells. HMGA2 3*-UTR construct that was mutated at the predicted miR-26a site. miR-26a failed to diminish the mutated luciferase activities
... - Liang H; Gu Y; Li T; Zhang Y; Huangfu L; Hu et al., 2014, Cell death & disease. |
| Article |
- Liang H; Gu Y; Li T; Zhang Y; Huangfu L; Hu et al. - Cell death & disease, 2014
Idiopathic Pulmonary Fibrosis (IPF) is a chronic, progressive, and highly lethal fibrotic lung disease with poor treatment and unknown etiology. Emerging evidence suggests that epithelial-mesenchymal transition (EMT) has an important role in repair and scar formation following epithelial injury during pulmonary fibrosis. Although some miRNAs have been shown to be dysregulated in the pathophysiological processes of IPF, limited studies have payed attention on the participation of miRNAs in EMT in lung fibrosis. In our study, we identified and constructed a regulation network of differentially expressed IPF miRNAs and EMT genes. Additionally, we found the downregulation of miR-26a in mice with experimental pulmonary fibrosis. Further studies showed that miR-26a regulated HMGA2, which is a key factor in the process of EMT and had the maximum number of regulating miRNAs in the regulation network. More importantly, inhibition of miR-26a resulted in lung epithelial cells transforming into myofibroblasts in vitro and in vivo, whereas forced expression of miR-26a alleviated TGF-beta1- and BLM-induced EMT in A549 cells and in mice, respectively. Taken together, our study deciphered the essential role of miR-26a in the pathogenesis of EMT in pulmonary fibrosis, and suggests that miR-26a may be a potential therapeutic target for IPF.
LinkOut: [PMID: 24853416]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | A549 |
| Disease | ; MIMAT0000082 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan |
| Original Description (Extracted from the article) |
...
MiR-26a directly targets HMGA2 in NSCLC cells
"MiR-26a directly targets HMGA2 in NSCLC cells. Both real- time RT-PCR and Western blotting analysis showed that ectopic expression of miR-26a markedly decreased HMGA2 expression in A549 at RNA and protein levels
... - Yang Y; Zhang P; Zhao Y; Yang J; Jiang G; Fan J, 2016, Cancer biology & therapy. |
| Article |
- Yang Y; Zhang P; Zhao Y; Yang J; Jiang G; Fan J - Cancer biology & therapy, 2016
BACKGROUND: Lung cancer is the most common cancer that is caused by perturbation of regulatory pathways rather than dysfunction of a single gene. Cisplatin (CDDP; cis-diamminedichloroplatinum II) is the first member of a class of platinum-containing anti-cancer medication, which binds to DNA and triggers apoptosis. CDDP-based chemotherapy is used to treat various types of cancers. However, the efficacy of CDDP in the treatment of non-small-cell lung cancer (NSCLC) is limited by acquired drug resistance. MicroRNAs have recently emerged as key regulators of cancers, and miR-26a is one of down-regulated miRNAs in A549/CDDPres cell line. This study aimed to investigate the role of miR-26a in CDDP resistance in NSCLC as well as the underlying mechanisms. METHODS: In this study, we analyzed expressional profiles of CDDP resistance-related mRNA, miRNA, and transcription factors (TF) that regulate miRNA expression in NSCLC. A549 cells were treated with CDDP, miR-26a mimic, or miR-26a inhibitor, and followed by biological analysis including drug sensitivity assay, colony formation assay, terminal-deoxynucleoitidyl Transferase Mediated Nick End Labeling (TUNEL) assay, and cell cycle analysis. Luciferase assay was used to determine the target of miR-26a. The regulation of miR-26a in Akt pathway was measured by western blot. RESULTS: High mobility group A (HMGA) 2 was identified as the target of miR-26a. Overexpression of miR-26a in A549 cells inhibited G1-S transition, increased cell death in response to CDDP treatment, and decreased the colony formation of A549 cells. MiR-26a significantly decreased the expression of E2F1, diminished Akt phosphorylation, and downregulated Bcl2 expression. Cell growth was suppressed by inhibiting HMGA2-mediated E2F1-Akt pathway. CONCLUSION: MiR-26a is responsible for A549 cell sensitivity in the treatment of CDDP through regulating HMGA2-mediated E2F1-Akt pathway.
LinkOut: [PMID: 26492332]
|
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
449 hsa-miR-26a-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000109 | HMGA2 | high mobility group AT-hook 2 |  |
|
|
|
4 | 5 | ||||
| MIRT000110 | HMGA1 | high mobility group AT-hook 1 | |
|
|
3 | 5 | |||||
| MIRT000111 | CCNE2 | cyclin E2 | |
|
|
|
4 | 2 | ||||
| MIRT000112 | CCND2 | cyclin D2 | |
|
|
|
|
5 | 10 | |||
| MIRT001021 | CDK8 | cyclin dependent kinase 8 | |
|
2 | 2 | ||||||
| MIRT001022 | CDC6 | cell division cycle 6 | |
|
|
3 | 3 | |||||
| MIRT001039 | LIF | LIF, interleukin 6 family cytokine | |
1 | 2 | |||||||
| MIRT001095 | PTEN | phosphatase and tensin homolog | |
|
|
|
4 | 7 | ||||
| MIRT001771 | EZH2 | enhancer of zeste 2 polycomb repressive complex 2 subunit | |
|
|
|
|
5 | 11 | |||
| MIRT001772 | PLAG1 | PLAG1 zinc finger | |
|
|
3 | 2 | |||||
| MIRT002315 | SERBP1 | SERPINE1 mRNA binding protein 1 | |
|
|
3 | 3 | |||||
| MIRT002340 | SMAD1 | SMAD family member 1 | |
|
|
|
4 | 6 | ||||
| MIRT003212 | MAP3K2 | mitogen-activated protein kinase kinase kinase 2 | |
|
|
3 | 2 | |||||
| MIRT003213 | RB1 | RB transcriptional corepressor 1 | |
|
|
|
|
5 | 2 | |||
| MIRT003803 | SMAD4 | SMAD family member 4 | |
|
|
3 | 3 | |||||
| MIRT003968 | MYC | MYC proto-oncogene, bHLH transcription factor | |
|
2 | 2 | ||||||
| MIRT004338 | CTGF | connective tissue growth factor | |
|
2 | 2 | ||||||
| MIRT004339 | STRADB | STE20-related kinase adaptor beta | |
|
|
|
4 | 4 | ||||
| MIRT004615 | IFNB1 | interferon beta 1 | |
|
|
3 | 2 | |||||
| MIRT004676 | GSK3B | glycogen synthase kinase 3 beta | |
|
|
|
|
|
|
7 | 10 | |
| MIRT005587 | CPEB2 | cytoplasmic polyadenylation element binding protein 2 | |
|
|
3 | 2 | |||||
| MIRT005588 | CPEB3 | cytoplasmic polyadenylation element binding protein 3 | |
|
|
|
4 | 2 | ||||
| MIRT005589 | CPEB4 | cytoplasmic polyadenylation element binding protein 4 | |
|
|
3 | 2 | |||||
| MIRT005751 | GDAP1 | ganglioside induced differentiation associated protein 1 | |
|
|
3 | 1 | |||||
| MIRT005920 | MTDH | metadherin | |
|
|
|
|
5 | 4 | |||
| MIRT006306 | CDK6 | cyclin dependent kinase 6 | |
|
2 | 1 | ||||||
| MIRT006309 | CCNE1 | cyclin E1 | |
|
|
3 | 2 | |||||
| MIRT006389 | ESR1 | estrogen receptor 1 | |
1 | 1 | |||||||
| MIRT006711 | ABCA1 | ATP binding cassette subfamily A member 1 | |
|
2 | 1 | ||||||
| MIRT006712 | ARL4C | ADP ribosylation factor like GTPase 4C | |
|
2 | 1 | ||||||
| MIRT007177 | E2F7 | E2F transcription factor 7 | |
|
2 | 7 | ||||||
| MIRT007347 | NOS2 | nitric oxide synthase 2 | |
|
|
3 | 2 | |||||
| MIRT007374 | IL6 | interleukin 6 | |
|
2 | 1 | ||||||
| MIRT030358 | TGFBR2 | transforming growth factor beta receptor 2 | |
|
|
3 | 1 | |||||
| MIRT050053 | HIST1H4E | histone cluster 1 H4 family member e | |
1 | 1 | |||||||
| MIRT050054 | ZNF814 | zinc finger protein 814 | |
1 | 1 | |||||||
| MIRT050055 | ZNF233 | zinc finger protein 233 | |
1 | 1 | |||||||
| MIRT050056 | ABCB7 | ATP binding cassette subfamily B member 7 | |
1 | 1 | |||||||
| MIRT050057 | SCRN1 | secernin 1 | |
1 | 1 | |||||||
| MIRT050058 | NABP1 | nucleic acid binding protein 1 | |
|
2 | 8 | ||||||
| MIRT050059 | FAM20B | FAM20B, glycosaminoglycan xylosylkinase | |
1 | 1 | |||||||
| MIRT050060 | ARCN1 | archain 1 | |
1 | 1 | |||||||
| MIRT050061 | ANO3 | anoctamin 3 | |
1 | 1 | |||||||
| MIRT050062 | TFAM | transcription factor A, mitochondrial | |
1 | 1 | |||||||
| MIRT050063 | FER | FER tyrosine kinase | |
1 | 1 | |||||||
| MIRT050064 | HIAT1 | major facilitator superfamily domain containing 14A | |
1 | 1 | |||||||
| MIRT050065 | PPP1CC | protein phosphatase 1 catalytic subunit gamma | |
1 | 1 | |||||||
| MIRT050066 | SLC35B4 | solute carrier family 35 member B4 | |
1 | 1 | |||||||
| MIRT050067 | RASA1 | RAS p21 protein activator 1 | |
1 | 1 | |||||||
| MIRT050068 | COX1 | cytochrome c oxidase subunit I | |
1 | 1 | |||||||
| MIRT050069 | MSL3 | MSL complex subunit 3 | |
1 | 1 | |||||||
| MIRT050070 | GGA2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | |
1 | 1 | |||||||
| MIRT050071 | GIT2 | GIT ArfGAP 2 | |
1 | 1 | |||||||
| MIRT050072 | DNMT1 | DNA methyltransferase 1 | |
1 | 1 | |||||||
| MIRT050073 | MFHAS1 | malignant fibrous histiocytoma amplified sequence 1 | |
1 | 1 | |||||||
| MIRT050074 | UBA2 | ubiquitin like modifier activating enzyme 2 | |
1 | 1 | |||||||
| MIRT050075 | DCAF7 | DDB1 and CUL4 associated factor 7 | |
1 | 1 | |||||||
| MIRT050076 | MTRF1 | mitochondrial translation release factor 1 | |
1 | 1 | |||||||
| MIRT050077 | WBSCR16 | RCC1 like | |
1 | 1 | |||||||
| MIRT050078 | NUAK1 | NUAK family kinase 1 | |
1 | 1 | |||||||
| MIRT050079 | TUT1 | terminal uridylyl transferase 1, U6 snRNA-specific | |
1 | 1 | |||||||
| MIRT050080 | PNMA2 | paraneoplastic Ma antigen 2 | |
1 | 1 | |||||||
| MIRT050081 | ACTL8 | actin like 8 | |
1 | 1 | |||||||
| MIRT050082 | HSPA8 | heat shock protein family A (Hsp70) member 8 | |
1 | 1 | |||||||
| MIRT050083 | DHX15 | DEAH-box helicase 15 | |
1 | 1 | |||||||
| MIRT050084 | TCP1 | t-complex 1 | |
1 | 1 | |||||||
| MIRT050085 | SLC25A5 | solute carrier family 25 member 5 | |
1 | 1 | |||||||
| MIRT050086 | LSM14A | LSM14A, mRNA processing body assembly factor | |
1 | 1 | |||||||
| MIRT050087 | CAMKV | CaM kinase like vesicle associated | |
1 | 1 | |||||||
| MIRT050088 | ALG10B | ALG10B, alpha-1,2-glucosyltransferase | |
1 | 1 | |||||||
| MIRT050089 | TYW1 | tRNA-yW synthesizing protein 1 homolog | |
1 | 1 | |||||||
| MIRT050090 | RPL13A | ribosomal protein L13a | |
1 | 1 | |||||||
| MIRT050091 | AGO1 | argonaute 1, RISC catalytic component | |
1 | 1 | |||||||
| MIRT050092 | TXLNG | taxilin gamma | |
1 | 1 | |||||||
| MIRT050093 | RAB18 | RAB18, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT050094 | RPS27A | ribosomal protein S27a | |
1 | 1 | |||||||
| MIRT050095 | RPS26 | ribosomal protein S26 | |
1 | 1 | |||||||
| MIRT050096 | PIKFYVE | phosphoinositide kinase, FYVE-type zinc finger containing | |
1 | 1 | |||||||
| MIRT050097 | TP53INP1 | tumor protein p53 inducible nuclear protein 1 | |
1 | 1 | |||||||
| MIRT050098 | ZNF703 | zinc finger protein 703 | |
1 | 1 | |||||||
| MIRT050099 | MTRF1L | mitochondrial translational release factor 1 like | |
1 | 1 | |||||||
| MIRT050100 | ZNF506 | zinc finger protein 506 | |
1 | 1 | |||||||
| MIRT050101 | KCTD5 | potassium channel tetramerization domain containing 5 | |
1 | 1 | |||||||
| MIRT050102 | CTC1 | CST telomere replication complex component 1 | |
1 | 1 | |||||||
| MIRT050103 | TKT | transketolase | |
1 | 1 | |||||||
| MIRT050104 | LYST | lysosomal trafficking regulator | |
1 | 1 | |||||||
| MIRT050105 | FAM134A | reticulophagy regulator family member 2 | |
1 | 1 | |||||||
| MIRT050106 | NKX2-5 | NK2 homeobox 5 | |
1 | 1 | |||||||
| MIRT050107 | AURKAIP1 | aurora kinase A interacting protein 1 | |
1 | 1 | |||||||
| MIRT050108 | ATP1A1 | ATPase Na+/K+ transporting subunit alpha 1 | |
1 | 1 | |||||||
| MIRT050109 | COASY | Coenzyme A synthase | |
1 | 1 | |||||||
| MIRT050110 | CTR9 | CTR9 homolog, Paf1/RNA polymerase II complex component | |
1 | 1 | |||||||
| MIRT050111 | COX3 | cytochrome c oxidase III | |
1 | 1 | |||||||
| MIRT050112 | ELOVL6 | ELOVL fatty acid elongase 6 | |
1 | 1 | |||||||
| MIRT050113 | PIGT | phosphatidylinositol glycan anchor biosynthesis class T | |
1 | 1 | |||||||
| MIRT050114 | TMCC3 | transmembrane and coiled-coil domain family 3 | |
1 | 1 | |||||||
| MIRT050115 | ARHGEF1 | Rho guanine nucleotide exchange factor 1 | |
1 | 1 | |||||||
| MIRT050116 | SHC2 | SHC adaptor protein 2 | |
1 | 1 | |||||||
| MIRT050117 | PSMA3 | proteasome subunit alpha 3 | |
1 | 1 | |||||||
| MIRT050118 | PTTG1 | pituitary tumor-transforming 1 | |
1 | 1 | |||||||
| MIRT050119 | RPS24 | ribosomal protein S24 | |
1 | 1 | |||||||
| MIRT050120 | SPTBN1 | spectrin beta, non-erythrocytic 1 | |
1 | 1 | |||||||
| MIRT050121 | UBTF | upstream binding transcription factor, RNA polymerase I | |
1 | 1 | |||||||
| MIRT050122 | BTBD3 | BTB domain containing 3 | |
1 | 1 | |||||||
| MIRT050123 | AHR | aryl hydrocarbon receptor | |
1 | 1 | |||||||
| MIRT050124 | EEF1B2 | eukaryotic translation elongation factor 1 beta 2 | |
1 | 1 | |||||||
| MIRT050125 | MRPL51 | mitochondrial ribosomal protein L51 | |
1 | 1 | |||||||
| MIRT050126 | SETD2 | SET domain containing 2 | |
1 | 1 | |||||||
| MIRT050127 | LRP6 | LDL receptor related protein 6 | |
1 | 1 | |||||||
| MIRT050128 | RHOBTB1 | Rho related BTB domain containing 1 | |
1 | 1 | |||||||
| MIRT050129 | HIST1H4J | histone cluster 1 H4 family member j | |
1 | 1 | |||||||
| MIRT050130 | MYO10 | myosin X | |
1 | 1 | |||||||
| MIRT050131 | ATP7B | ATPase copper transporting beta | |
1 | 1 | |||||||
| MIRT050132 | CSRP2BP | lysine acetyltransferase 14 | |
1 | 1 | |||||||
| MIRT050133 | RBM39 | RNA binding motif protein 39 | |
1 | 1 | |||||||
| MIRT050134 | C14orf37 | chromosome 14 open reading frame 37 | |
|
2 | 3 | ||||||
| MIRT050135 | SFMBT1 | Scm like with four mbt domains 1 | |
1 | 1 | |||||||
| MIRT050136 | KIAA1704 | GPALPP motifs containing 1 | |
1 | 1 | |||||||
| MIRT050137 | ABCB9 | ATP binding cassette subfamily B member 9 | |
1 | 1 | |||||||
| MIRT050138 | ADM | adrenomedullin | |
|
2 | 11 | ||||||
| MIRT050139 | USP7 | ubiquitin specific peptidase 7 | |
1 | 1 | |||||||
| MIRT050140 | TTN | titin | |
1 | 1 | |||||||
| MIRT050141 | HNRNPU | heterogeneous nuclear ribonucleoprotein U | |
1 | 1 | |||||||
| MIRT050142 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | |
1 | 1 | |||||||
| MIRT050143 | CEPT1 | choline/ethanolamine phosphotransferase 1 | |
1 | 1 | |||||||
| MIRT050144 | HOXC8 | homeobox C8 | |
1 | 1 | |||||||
| MIRT050145 | CTBP1 | C-terminal binding protein 1 | |
1 | 1 | |||||||
| MIRT050146 | SET | SET nuclear proto-oncogene | |
1 | 1 | |||||||
| MIRT050147 | MCM3AP | minichromosome maintenance complex component 3 associated protein | |
1 | 1 | |||||||
| MIRT050148 | TPGS2 | tubulin polyglutamylase complex subunit 2 | |
1 | 1 | |||||||
| MIRT050149 | CA2 | carbonic anhydrase 2 | |
1 | 1 | |||||||
| MIRT050150 | PCYT1A | phosphate cytidylyltransferase 1, choline, alpha | |
1 | 1 | |||||||
| MIRT050151 | ACTN4 | actinin alpha 4 | |
1 | 1 | |||||||
| MIRT050152 | EPG5 | ectopic P-granules autophagy protein 5 homolog | |
1 | 1 | |||||||
| MIRT050153 | OLA1 | Obg like ATPase 1 | |
1 | 1 | |||||||
| MIRT050154 | RRM2 | ribonucleotide reductase regulatory subunit M2 | |
1 | 1 | |||||||
| MIRT050155 | BBX | BBX, HMG-box containing | |
1 | 1 | |||||||
| MIRT050156 | NUP205 | nucleoporin 205 | |
1 | 1 | |||||||
| MIRT050157 | C6orf47 | chromosome 6 open reading frame 47 | |
1 | 1 | |||||||
| MIRT050158 | CFLAR | CASP8 and FADD like apoptosis regulator | |
1 | 1 | |||||||
| MIRT050159 | SEC31A | SEC31 homolog A, COPII coat complex component | |
1 | 1 | |||||||
| MIRT050160 | GLG1 | golgi glycoprotein 1 | |
1 | 1 | |||||||
| MIRT050161 | TBC1D16 | TBC1 domain family member 16 | |
1 | 1 | |||||||
| MIRT050162 | BTBD9 | BTB domain containing 9 | |
1 | 1 | |||||||
| MIRT050163 | RND2 | Rho family GTPase 2 | |
1 | 1 | |||||||
| MIRT050164 | TUBG1 | tubulin gamma 1 | |
1 | 1 | |||||||
| MIRT050165 | AHRR | aryl-hydrocarbon receptor repressor | |
1 | 1 | |||||||
| MIRT050166 | CNTD2 | cyclin N-terminal domain containing 2 | |
1 | 1 | |||||||
| MIRT050167 | UBE2A | ubiquitin conjugating enzyme E2 A | |
1 | 1 | |||||||
| MIRT050168 | CCDC43 | coiled-coil domain containing 43 | |
1 | 1 | |||||||
| MIRT050169 | MSH6 | mutS homolog 6 | |
1 | 1 | |||||||
| MIRT050170 | HIST4H4 | histone cluster 4 H4 | |
1 | 1 | |||||||
| MIRT050171 | C17orf51 | chromosome 17 open reading frame 51 | |
1 | 1 | |||||||
| MIRT050172 | SLC25A30 | solute carrier family 25 member 30 | |
1 | 1 | |||||||
| MIRT050173 | USB1 | U6 snRNA biogenesis phosphodiesterase 1 | |
1 | 1 | |||||||
| MIRT050174 | MYH10 | myosin heavy chain 10 | |
1 | 1 | |||||||
| MIRT050175 | LINS | lines homolog 1 | |
1 | 1 | |||||||
| MIRT050176 | UBR4 | ubiquitin protein ligase E3 component n-recognin 4 | |
1 | 2 | |||||||
| MIRT050177 | ZNF207 | zinc finger protein 207 | |
1 | 1 | |||||||
| MIRT050178 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | |
1 | 1 | |||||||
| MIRT050179 | TXNL1 | thioredoxin like 1 | |
1 | 1 | |||||||
| MIRT050180 | FOXO3 | forkhead box O3 | |
1 | 1 | |||||||
| MIRT050181 | COPB1 | coatomer protein complex subunit beta 1 | |
1 | 1 | |||||||
| MIRT050182 | FASN | fatty acid synthase | |
1 | 1 | |||||||
| MIRT050183 | SARS | seryl-tRNA synthetase | |
1 | 1 | |||||||
| MIRT050184 | DDB1 | damage specific DNA binding protein 1 | |
1 | 1 | |||||||
| MIRT050185 | PPIA | peptidylprolyl isomerase A | |
1 | 1 | |||||||
| MIRT050186 | SLC35A4 | solute carrier family 35 member A4 | |
1 | 1 | |||||||
| MIRT050187 | TXNDC11 | thioredoxin domain containing 11 | |
1 | 1 | |||||||
| MIRT050188 | HIST2H2AA3 | histone cluster 2 H2A family member a3 | |
1 | 1 | |||||||
| MIRT050189 | TRAP1 | TNF receptor associated protein 1 | |
1 | 1 | |||||||
| MIRT050190 | SDCBP | syndecan binding protein | |
1 | 1 | |||||||
| MIRT050191 | ASCC2 | activating signal cointegrator 1 complex subunit 2 | |
1 | 1 | |||||||
| MIRT050192 | KDM5C | lysine demethylase 5C | |
1 | 1 | |||||||
| MIRT050193 | DST | dystonin | |
1 | 1 | |||||||
| MIRT050194 | CLIC4 | chloride intracellular channel 4 | |
1 | 1 | |||||||
| MIRT050195 | WWP2 | WW domain containing E3 ubiquitin protein ligase 2 | |
1 | 1 | |||||||
| MIRT050196 | ATP5A1 | ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle | |
1 | 1 | |||||||
| MIRT050197 | RPL13 | ribosomal protein L13 | |
1 | 1 | |||||||
| MIRT050198 | CNBP | CCHC-type zinc finger nucleic acid binding protein | |
1 | 1 | |||||||
| MIRT052649 | MCL1 | MCL1, BCL2 family apoptosis regulator | |
1 | 1 | |||||||
| MIRT052903 | CHD1 | chromodomain helicase DNA binding protein 1 | |
|
2 | 1 | ||||||
| MIRT053077 | CKS2 | CDC28 protein kinase regulatory subunit 2 | |
|
|
|
4 | 3 | ||||
| MIRT053097 | PRKCD | protein kinase C delta | |
|
|
|
4 | 2 | ||||
| MIRT053251 | BAG4 | BCL2 associated athanogene 4 | |
|
2 | 1 | ||||||
| MIRT053574 | FGF9 | fibroblast growth factor 9 | |
|
|
3 | 1 | |||||
| MIRT054062 | ACVR1 | activin A receptor type 1 | |
|
2 | 1 | ||||||
| MIRT054415 | AMACR | alpha-methylacyl-CoA racemase | |
|
|
3 | 1 | |||||
| MIRT054432 | ATM | ATM serine/threonine kinase | |
|
|
3 | 1 | |||||
| MIRT054484 | RCBTB1 | RCC1 and BTB domain containing protein 1 | |
|
|
3 | 1 | |||||
| MIRT054645 | HGF | hepatocyte growth factor | |
|
|
3 | 1 | |||||
| MIRT054676 | LIN28B | lin-28 homolog B | |
|
|
3 | 1 | |||||
| MIRT054677 | ZCCHC11 | zinc finger CCHC-type containing 11 | |
|
|
3 | 1 | |||||
| MIRT060004 | VANGL2 | VANGL planar cell polarity protein 2 | |
|
2 | 4 | ||||||
| MIRT062177 | WNK1 | WNK lysine deficient protein kinase 1 | |
|
2 | 2 | ||||||
| MIRT064905 | ZBTB18 | zinc finger and BTB domain containing 18 | |
|
2 | 6 | ||||||
| MIRT066809 | ZDHHC18 | zinc finger DHHC-type containing 18 | |
|
2 | 3 | ||||||
| MIRT067540 | METAP2 | methionyl aminopeptidase 2 | |
1 | 1 | |||||||
| MIRT072092 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
|
2 | 5 | ||||||
| MIRT072125 | RTF1 | RTF1 homolog, Paf1/RNA polymerase II complex component | |
1 | 1 | |||||||
| MIRT073375 | ABHD2 | abhydrolase domain containing 2 | |
1 | 1 | |||||||
| MIRT075111 | C16ORF70 | chromosome 16 open reading frame 70 | |
|
2 | 5 | ||||||
| MIRT080605 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | |
|
2 | 8 | ||||||
| MIRT085205 | SLC5A3 | solute carrier family 5 member 3 | |
|
2 | 2 | ||||||
| MIRT086007 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | |
|
2 | 2 | ||||||
| MIRT087899 | TNRC6B | trinucleotide repeat containing 6B | |
|
2 | 5 | ||||||
| MIRT089450 | TET3 | tet methylcytosine dioxygenase 3 | |
|
2 | 3 | ||||||
| MIRT089599 | MAT2A | methionine adenosyltransferase 2A | |
|
2 | 11 | ||||||
| MIRT090517 | SLC25A36 | solute carrier family 25 member 36 | |
|
2 | 2 | ||||||
| MIRT097631 | POLR3G | RNA polymerase III subunit G | |
1 | 1 | |||||||
| MIRT118410 | DNMT3B | DNA methyltransferase 3 beta | |
|
|
|
4 | 1 | ||||
| MIRT122040 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | |
1 | 1 | |||||||
| MIRT133477 | EP400 | E1A binding protein p400 | |
1 | 1 | |||||||
| MIRT134087 | KLHL42 | kelch like family member 42 | |
1 | 1 | |||||||
| MIRT136529 | KPNA6 | karyopherin subunit alpha 6 | |
1 | 1 | |||||||
| MIRT137414 | RLF | rearranged L-myc fusion | |
1 | 1 | |||||||
| MIRT137577 | RCOR1 | REST corepressor 1 | |
1 | 1 | |||||||
| MIRT137722 | EIF5 | eukaryotic translation initiation factor 5 | |
1 | 1 | |||||||
| MIRT147274 | KPNA2 | karyopherin subunit alpha 2 | |
|
2 | 10 | ||||||
| MIRT151691 | CHAF1A | chromatin assembly factor 1 subunit A | |
1 | 1 | |||||||
| MIRT156734 | FAM126B | family with sequence similarity 126 member B | |
|
2 | 2 | ||||||
| MIRT159273 | RASGRP3 | RAS guanyl releasing protein 3 | |
1 | 1 | |||||||
| MIRT166022 | SFXN1 | sideroflexin 1 | |
1 | 1 | |||||||
| MIRT166592 | ZSWIM6 | zinc finger SWIM-type containing 6 | |
1 | 1 | |||||||
| MIRT168865 | PIM1 | Pim-1 proto-oncogene, serine/threonine kinase | |
1 | 1 | |||||||
| MIRT168937 | IRF4 | interferon regulatory factor 4 | |
1 | 1 | |||||||
| MIRT169515 | TTK | TTK protein kinase | |
1 | 1 | |||||||
| MIRT169560 | PNRC1 | proline rich nuclear receptor coactivator 1 | |
1 | 1 | |||||||
| MIRT170138 | KLHDC10 | kelch domain containing 10 | |
1 | 1 | |||||||
| MIRT175075 | DCAF10 | DDB1 and CUL4 associated factor 10 | |
1 | 1 | |||||||
| MIRT183141 | WEE1 | WEE1 G2 checkpoint kinase | |
|
2 | 1 | ||||||
| MIRT187790 | ANKRD52 | ankyrin repeat domain 52 | |
1 | 1 | |||||||
| MIRT191753 | ZNF410 | zinc finger protein 410 | |
|
2 | 2 | ||||||
| MIRT193070 | MAPK6 | mitogen-activated protein kinase 6 | |
|
2 | 2 | ||||||
| MIRT193726 | USP3 | ubiquitin specific peptidase 3 | |
1 | 1 | |||||||
| MIRT203408 | DYRK1A | dual specificity tyrosine phosphorylation regulated kinase 1A | |
1 | 1 | |||||||
| MIRT206543 | RHOQ | ras homolog family member Q | |
|
2 | 2 | ||||||
| MIRT210981 | TET2 | tet methylcytosine dioxygenase 2 | |
1 | 1 | |||||||
| MIRT213685 | PTPN13 | protein tyrosine phosphatase, non-receptor type 13 | |
|
|
3 | 1 | |||||
| MIRT215349 | CREBRF | CREB3 regulatory factor | |
|
2 | 2 | ||||||
| MIRT227685 | TBC1D13 | TBC1 domain family member 13 | |
|
2 | 2 | ||||||
| MIRT243962 | MAP1B | microtubule associated protein 1B | |
|
2 | 2 | ||||||
| MIRT250410 | TNRC6A | trinucleotide repeat containing 6A | |
|
2 | 7 | ||||||
| MIRT262152 | OTUD1 | OTU deubiquitinase 1 | |
1 | 1 | |||||||
| MIRT277212 | AKIRIN1 | akirin 1 | |
|
2 | 2 | ||||||
| MIRT286389 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 3 | ||||||
| MIRT308147 | PDE12 | phosphodiesterase 12 | |
|
2 | 2 | ||||||
| MIRT319694 | UBN2 | ubinuclein 2 | |
|
2 | 3 | ||||||
| MIRT327077 | KLHL15 | kelch like family member 15 | |
|
2 | 10 | ||||||
| MIRT346489 | SSX2IP | SSX family member 2 interacting protein | |
1 | 1 | |||||||
| MIRT438130 | ADAM17 | ADAM metallopeptidase domain 17 | |
|
|
|
|
|
6 | 3 | ||
| MIRT438159 | PIK3C2A | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha | |
1 | 1 | |||||||
| MIRT438209 | CHEK1 | checkpoint kinase 1 | |
|
2 | 1 | ||||||
| MIRT438638 | TDG | thymine DNA glycosylase | |
1 | 1 | |||||||
| MIRT438656 | PHB | prohibitin | |
|
|
3 | 1 | |||||
| MIRT444707 | ZNF772 | zinc finger protein 772 | |
|
2 | 2 | ||||||
| MIRT448615 | OTUD4 | OTU deubiquitinase 4 | |
|
2 | 2 | ||||||
| MIRT451358 | UQCR11 | ubiquinol-cytochrome c reductase, complex III subunit XI | |
|
2 | 2 | ||||||
| MIRT457292 | ZBTB45 | zinc finger and BTB domain containing 45 | |
|
2 | 2 | ||||||
| MIRT458763 | CES2 | carboxylesterase 2 | |
|
2 | 2 | ||||||
| MIRT458855 | CD55 | CD55 molecule (Cromer blood group) | |
|
2 | 2 | ||||||
| MIRT460261 | SLC26A2 | solute carrier family 26 member 2 | |
|
2 | 2 | ||||||
| MIRT461702 | ZNF426 | zinc finger protein 426 | |
|
2 | 2 | ||||||
| MIRT465730 | TMTC3 | transmembrane and tetratricopeptide repeat containing 3 | |
|
2 | 2 | ||||||
| MIRT466688 | TAF13 | TATA-box binding protein associated factor 13 | |
|
2 | 4 | ||||||
| MIRT468541 | SERP1 | stress associated endoplasmic reticulum protein 1 | |
|
2 | 2 | ||||||
| MIRT468809 | SACS | sacsin molecular chaperone | |
|
2 | 11 | ||||||
| MIRT470198 | PSAT1 | phosphoserine aminotransferase 1 | |
|
2 | 6 | ||||||
| MIRT476009 | GTF2A1 | general transcription factor IIA subunit 1 | |
|
2 | 8 | ||||||
| MIRT477228 | ETF1 | eukaryotic translation termination factor 1 | |
|
2 | 4 | ||||||
| MIRT477752 | EDEM3 | ER degradation enhancing alpha-mannosidase like protein 3 | |
|
2 | 2 | ||||||
| MIRT478346 | DDIT4 | DNA damage inducible transcript 4 | |
|
2 | 2 | ||||||
| MIRT478525 | CTNS | cystinosin, lysosomal cystine transporter | |
|
2 | 2 | ||||||
| MIRT480793 | BLOC1S2 | biogenesis of lysosomal organelles complex 1 subunit 2 | |
|
2 | 6 | ||||||
| MIRT482242 | AGPAT5 | 1-acylglycerol-3-phosphate O-acyltransferase 5 | |
|
2 | 2 | ||||||
| MIRT486465 | MDM2 | MDM2 proto-oncogene | |
|
2 | 10 | ||||||
| MIRT487561 | LOXL2 | lysyl oxidase like 2 | |
|
2 | 2 | ||||||
| MIRT498663 | ZNF664 | zinc finger protein 664 | |
|
2 | 8 | ||||||
| MIRT499509 | RNF6 | ring finger protein 6 | |
|
2 | 6 | ||||||
| MIRT502456 | FRAT2 | FRAT2, WNT signaling pathway regulator | |
|
2 | 6 | ||||||
| MIRT502713 | CREBZF | CREB/ATF bZIP transcription factor | |
|
2 | 6 | ||||||
| MIRT502853 | CHEK2 | checkpoint kinase 2 | |
|
2 | 6 | ||||||
| MIRT507558 | DEPDC1 | DEP domain containing 1 | |
|
2 | 6 | ||||||
| MIRT524742 | BRCA1 | BRCA1, DNA repair associated | |
|
2 | 2 | ||||||
| MIRT527178 | LRRTM4 | leucine rich repeat transmembrane neuronal 4 | |
|
2 | 2 | ||||||
| MIRT527909 | B3GALT5 | beta-1,3-galactosyltransferase 5 | |
|
2 | 2 | ||||||
| MIRT532895 | ZNF451 | zinc finger protein 451 | |
|
2 | 2 | ||||||
| MIRT533588 | TOB1 | transducer of ERBB2, 1 | |
|
2 | 7 | ||||||
| MIRT534368 | SETD8 | lysine methyltransferase 5A | |
|
2 | 4 | ||||||
| MIRT535060 | PPP2R5D | protein phosphatase 2 regulatory subunit B'delta | |
|
2 | 4 | ||||||
| MIRT536204 | MAD2L1 | mitotic arrest deficient 2 like 1 | |
|
2 | 2 | ||||||
| MIRT537233 | GALNT3 | polypeptide N-acetylgalactosaminyltransferase 3 | |
|
2 | 2 | ||||||
| MIRT539774 | KIAA0408 | KIAA0408 | |
|
2 | 6 | ||||||
| MIRT540867 | ZBTB24 | zinc finger and BTB domain containing 24 | |
|
2 | 2 | ||||||
| MIRT541042 | SOGA3 | SOGA family member 3 | |
|
2 | 6 | ||||||
| MIRT541350 | DDX3X | DEAD-box helicase 3, X-linked | |
|
2 | 2 | ||||||
| MIRT544949 | TUB | tubby bipartite transcription factor | |
|
2 | 4 | ||||||
| MIRT545809 | ZNF608 | zinc finger protein 608 | |
|
2 | 2 | ||||||
| MIRT547008 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | |
|
2 | 2 | ||||||
| MIRT551188 | EPB41L3 | erythrocyte membrane protein band 4.1 like 3 | |
|
2 | 2 | ||||||
| MIRT551973 | TMEM19 | transmembrane protein 19 | |
|
2 | 2 | ||||||
| MIRT552044 | ALG1 | ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase | |
|
2 | 2 | ||||||
| MIRT553325 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT554367 | SFPQ | splicing factor proline and glutamine rich | |
|
2 | 2 | ||||||
| MIRT555741 | PDCD10 | programmed cell death 10 | |
|
2 | 2 | ||||||
| MIRT556346 | MAN2A1 | mannosidase alpha class 2A member 1 | |
|
2 | 3 | ||||||
| MIRT560389 | TMEM254 | transmembrane protein 254 | |
|
2 | 2 | ||||||
| MIRT560465 | SMIM9 | small integral membrane protein 9 | |
|
2 | 2 | ||||||
| MIRT561122 | ATP2B1 | ATPase plasma membrane Ca2+ transporting 1 | |
|
2 | 2 | ||||||
| MIRT562626 | ARNTL2 | aryl hydrocarbon receptor nuclear translocator like 2 | |
|
2 | 2 | ||||||
| MIRT564084 | NSA2 | NSA2, ribosome biogenesis homolog | |
|
2 | 2 | ||||||
| MIRT564207 | SDE2 | SDE2 telomere maintenance homolog | |
|
2 | 2 | ||||||
| MIRT565191 | TSHZ1 | teashirt zinc finger homeobox 1 | |
|
2 | 2 | ||||||
| MIRT567887 | CSTF2 | cleavage stimulation factor subunit 2 | |
|
2 | 2 | ||||||
| MIRT568259 | BMP2K | BMP2 inducible kinase | |
|
2 | 2 | ||||||
| MIRT568505 | ARF1 | ADP ribosylation factor 1 | |
|
2 | 2 | ||||||
| MIRT572178 | CDV3 | CDV3 homolog | |
|
2 | 2 | ||||||
| MIRT574711 | HAUS8 | HAUS augmin like complex subunit 8 | |
|
2 | 3 | ||||||
| MIRT610597 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | |
|
2 | 2 | ||||||
| MIRT614445 | WDR92 | WD repeat domain 92 | |
|
2 | 2 | ||||||
| MIRT615442 | FAXC | failed axon connections homolog | |
|
2 | 2 | ||||||
| MIRT618503 | HSPD1 | heat shock protein family D (Hsp60) member 1 | |
|
2 | 2 | ||||||
| MIRT618903 | CDK9 | cyclin dependent kinase 9 | |
|
2 | 2 | ||||||
| MIRT620083 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | |
|
2 | 2 | ||||||
| MIRT620286 | GLTP | glycolipid transfer protein | |
|
2 | 2 | ||||||
| MIRT622464 | RNF11 | ring finger protein 11 | |
|
2 | 2 | ||||||
| MIRT624644 | ASXL3 | additional sex combs like 3, transcriptional regulator | |
|
2 | 2 | ||||||
| MIRT624697 | AQR | aquarius intron-binding spliceosomal factor | |
|
2 | 2 | ||||||
| MIRT625256 | ZNF566 | zinc finger protein 566 | |
|
2 | 2 | ||||||
| MIRT628258 | EFCAB14 | EF-hand calcium binding domain 14 | |
|
2 | 2 | ||||||
| MIRT628872 | FAM177A1 | family with sequence similarity 177 member A1 | |
|
2 | 2 | ||||||
| MIRT630720 | FPR1 | formyl peptide receptor 1 | |
|
2 | 2 | ||||||
| MIRT631887 | SLFN13 | schlafen family member 13 | |
|
2 | 2 | ||||||
| MIRT637716 | MYOZ3 | myozenin 3 | |
|
2 | 2 | ||||||
| MIRT639892 | SSR3 | signal sequence receptor subunit 3 | |
|
2 | 2 | ||||||
| MIRT642506 | ORC6 | origin recognition complex subunit 6 | |
|
2 | 2 | ||||||
| MIRT644723 | SEPT14 | septin 14 | |
|
2 | 2 | ||||||
| MIRT645341 | AGTPBP1 | ATP/GTP binding protein 1 | |
|
2 | 2 | ||||||
| MIRT648886 | TUBGCP5 | tubulin gamma complex associated protein 5 | |
|
2 | 2 | ||||||
| MIRT653565 | SLC35B3 | solute carrier family 35 member B3 | |
|
2 | 2 | ||||||
| MIRT656095 | MTA3 | metastasis associated 1 family member 3 | |
|
2 | 2 | ||||||
| MIRT660204 | BMPR1A | bone morphogenetic protein receptor type 1A | |
|
2 | 2 | ||||||
| MIRT660753 | ALDH6A1 | aldehyde dehydrogenase 6 family member A1 | |
|
2 | 2 | ||||||
| MIRT661379 | RHCG | Rh family C glycoprotein | |
|
2 | 2 | ||||||
| MIRT662310 | ADM2 | adrenomedullin 2 | |
|
2 | 2 | ||||||
| MIRT662628 | MCM8 | minichromosome maintenance 8 homologous recombination repair factor | |
|
2 | 2 | ||||||
| MIRT663688 | ZNF347 | zinc finger protein 347 | |
|
2 | 2 | ||||||
| MIRT665109 | FKTN | fukutin | |
|
2 | 2 | ||||||
| MIRT665262 | ZKSCAN1 | zinc finger with KRAB and SCAN domains 1 | |
|
2 | 2 | ||||||
| MIRT666273 | SLC31A1 | solute carrier family 31 member 1 | |
|
2 | 2 | ||||||
| MIRT666646 | RBM48 | RNA binding motif protein 48 | |
|
2 | 2 | ||||||
| MIRT667511 | LUC7L2 | LUC7 like 2, pre-mRNA splicing factor | |
|
2 | 2 | ||||||
| MIRT669228 | C7orf55-LUC7L2 | C7orf55-LUC7L2 readthrough | |
|
2 | 2 | ||||||
| MIRT669271 | C1orf50 | chromosome 1 open reading frame 50 | |
|
2 | 2 | ||||||
| MIRT671783 | RGS17 | regulator of G protein signaling 17 | |
|
2 | 2 | ||||||
| MIRT672379 | RPL37 | ribosomal protein L37 | |
|
2 | 2 | ||||||
| MIRT673464 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | |
|
2 | 2 | ||||||
| MIRT673600 | HPSE | heparanase | |
|
2 | 4 | ||||||
| MIRT676269 | NWD1 | NACHT and WD repeat domain containing 1 | |
|
2 | 2 | ||||||
| MIRT676514 | RNF216 | ring finger protein 216 | |
|
2 | 2 | ||||||
| MIRT676653 | LRRC27 | leucine rich repeat containing 27 | |
|
2 | 2 | ||||||
| MIRT677335 | PHAX | phosphorylated adaptor for RNA export | |
|
2 | 2 | ||||||
| MIRT677523 | OCIAD2 | OCIA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT677548 | C19orf52 | translocase of inner mitochondrial membrane 29 | |
|
2 | 2 | ||||||
| MIRT677724 | SSR1 | signal sequence receptor subunit 1 | |
|
2 | 2 | ||||||
| MIRT677800 | PNPLA3 | patatin like phospholipase domain containing 3 | |
|
2 | 2 | ||||||
| MIRT677885 | DCP1A | decapping mRNA 1A | |
|
2 | 2 | ||||||
| MIRT678104 | MICA | MHC class I polypeptide-related sequence A | |
|
2 | 2 | ||||||
| MIRT678431 | PDE4C | phosphodiesterase 4C | |
|
2 | 2 | ||||||
| MIRT678488 | ARHGEF39 | Rho guanine nucleotide exchange factor 39 | |
|
2 | 2 | ||||||
| MIRT678898 | TTLL12 | tubulin tyrosine ligase like 12 | |
|
2 | 2 | ||||||
| MIRT679296 | SSBP2 | single stranded DNA binding protein 2 | |
|
2 | 2 | ||||||
| MIRT679572 | UGGT1 | UDP-glucose glycoprotein glucosyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT680003 | ZNF860 | zinc finger protein 860 | |
|
2 | 2 | ||||||
| MIRT694963 | PLAC8 | placenta specific 8 | |
|
2 | 2 | ||||||
| MIRT697861 | UBE2H | ubiquitin conjugating enzyme E2 H | |
|
2 | 2 | ||||||
| MIRT698310 | TMEM2 | transmembrane protein 2 | |
|
2 | 2 | ||||||
| MIRT701712 | MTMR12 | myotubularin related protein 12 | |
|
2 | 2 | ||||||
| MIRT705964 | ACBD5 | acyl-CoA binding domain containing 5 | |
|
2 | 2 | ||||||
| MIRT714342 | DIP2A | disco interacting protein 2 homolog A | |
|
2 | 2 | ||||||
| MIRT715309 | POLR2E | RNA polymerase II subunit E | |
|
2 | 2 | ||||||
| MIRT717477 | PDE4DIP | phosphodiesterase 4D interacting protein | |
|
2 | 2 | ||||||
| MIRT719604 | PRKX | protein kinase, X-linked | |
|
2 | 2 | ||||||
| MIRT724483 | CSNK1A1 | casein kinase 1 alpha 1 | |
|
2 | 2 | ||||||
| MIRT726021 | ZNF680 | zinc finger protein 680 | |
1 | 1 | |||||||
| MIRT726041 | ZNF254 | zinc finger protein 254 | |
1 | 1 | |||||||
| MIRT726096 | WNT5A | Wnt family member 5A | |
1 | 1 | |||||||
| MIRT726288 | TMEM30A | transmembrane protein 30A | |
1 | 1 | |||||||
| MIRT726312 | TMCC1 | transmembrane and coiled-coil domain family 1 | |
1 | 1 | |||||||
| MIRT726446 | SSH2 | slingshot protein phosphatase 2 | |
1 | 1 | |||||||
| MIRT726486 | SMEK1 | protein phosphatase 4 regulatory subunit 3A | |
1 | 1 | |||||||
| MIRT726514 | SLC7A1 | solute carrier family 7 member 1 | |
1 | 1 | |||||||
| MIRT726535 | SLC38A2 | solute carrier family 38 member 2 | |
1 | 1 | |||||||
| MIRT726657 | SASS6 | SAS-6 centriolar assembly protein | |
1 | 1 | |||||||
| MIRT726778 | REEP4 | receptor accessory protein 4 | |
1 | 1 | |||||||
| MIRT726937 | PIK3R4 | phosphoinositide-3-kinase regulatory subunit 4 | |
1 | 1 | |||||||
| MIRT726989 | PDE4B | phosphodiesterase 4B | |
1 | 1 | |||||||
| MIRT727060 | NUDT19 | nudix hydrolase 19 | |
1 | 1 | |||||||
| MIRT727062 | NUCKS1 | nuclear casein kinase and cyclin dependent kinase substrate 1 | |
1 | 1 | |||||||
| MIRT727485 | HSPA13 | heat shock protein family A (Hsp70) member 13 | |
1 | 1 | |||||||
| MIRT727488 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | |
1 | 1 | |||||||
| MIRT727508 | HECTD3 | HECT domain E3 ubiquitin protein ligase 3 | |
1 | 1 | |||||||
| MIRT727675 | FBXO11 | F-box protein 11 | |
1 | 1 | |||||||
| MIRT727780 | ELAVL2 | ELAV like RNA binding protein 2 | |
1 | 1 | |||||||
| MIRT727786 | EIF4G2 | eukaryotic translation initiation factor 4 gamma 2 | |
1 | 1 | |||||||
| MIRT727793 | EHD1 | EH domain containing 1 | |
1 | 1 | |||||||
| MIRT727863 | DNMBP | dynamin binding protein | |
1 | 1 | |||||||
| MIRT727903 | DCTN4 | dynactin subunit 4 | |
1 | 1 | |||||||
| MIRT727941 | CPSF2 | cleavage and polyadenylation specific factor 2 | |
1 | 1 | |||||||
| MIRT727966 | COX5A | cytochrome c oxidase subunit 5A | |
1 | 1 | |||||||
| MIRT728000 | CHORDC1 | cysteine and histidine rich domain containing 1 | |
|
|
3 | 1 | |||||
| MIRT728203 | BID | BH3 interacting domain death agonist | |
1 | 1 | |||||||
| MIRT728213 | BCL7B | BCL tumor suppressor 7B | |
1 | 1 | |||||||
| MIRT728306 | ARPP19 | cAMP regulated phosphoprotein 19 | |
1 | 1 | |||||||
| MIRT728331 | AP1S3 | adaptor related protein complex 1 sigma 3 subunit | |
1 | 1 | |||||||
| MIRT728396 | ACSL3 | acyl-CoA synthetase long chain family member 3 | |
1 | 1 | |||||||
| MIRT731168 | ITGA5 | integrin subunit alpha 5 | |
|
2 | 1 | ||||||
| MIRT731390 | DUSP4 | dual specificity phosphatase 4 | |
|
|
3 | 1 | |||||
| MIRT732062 | NRAS | NRAS proto-oncogene, GTPase | |
|
|
3 | 1 | |||||
| MIRT732063 | E2F2 | E2F transcription factor 2 | |
|
|
3 | 1 | |||||
| MIRT732182 | PTGS2 | prostaglandin-endoperoxide synthase 2 | 6 | 2 | ||||||||
| MIRT732280 | JAG1 | jagged 1 | |
|
|
3 | 1 | |||||
| MIRT732490 | NRP1 | neuropilin 1 | |
1 | 0 | |||||||
| MIRT732621 | MS | multiple sclerosis | |
1 | 0 | |||||||
| MIRT733344 | CREB1 | cAMP responsive element binding protein 1 | |
|
|
|
4 | 0 | ||||
| MIRT733365 | ADIPOQ | adiponectin, C1Q and collagen domain containing | |
1 | 0 | |||||||
| MIRT733699 | NORAD | non-coding RNA activated by DNA damage | |
|
2 | 0 | ||||||
| MIRT733700 | UBE3A | ubiquitin protein ligase E3A | |
|
2 | 0 | ||||||
| MIRT733702 | CCND1 | cyclin D1 | |
|
2 | 0 | ||||||
| MIRT733703 | TGFBR1 | transforming growth factor beta receptor 1 | |
|
2 | 0 | ||||||
| MIRT734551 | SHC4 | SHC adaptor protein 4 | |
|
2 | 0 | ||||||
| MIRT734552 | PFDN4 | prefoldin subunit 4 | |
|
2 | 0 | ||||||
| MIRT734721 | CD38 | CD38 molecule | |
|
|
3 | 0 | |||||
| MIRT736775 | MAP2 | microtubule associated protein 2 | |
|
2 | 0 | ||||||
| MIRT736838 | USP35 | ubiquitin specific peptidase 35 | |
|
2 | 0 | ||||||
| MIRT736852 | EIF2A | eukaryotic translation initiation factor 2A | |
|
2 | 0 | ||||||
| MIRT737078 | ULK1 | unc-51 like autophagy activating kinase 1 | |
|
|
3 | 0 | |||||
| MIRT737079 | SNHG6 | small nucleolar RNA host gene 6 | |
|
|
3 | 0 | |||||
| MIRT737091 | ULK2 | unc-51 like autophagy activating kinase 2 | |
|
|
3 | 0 | |||||
| MIRT737491 | FLI1 | Fli-1 proto-oncogene, ETS transcription factor | |
|
2 | 0 | ||||||
| MIRT755414 | NEK6 | NIMA related kinase 6 | 3 | 1 | ||||||||
| MIRT755509 | ICAM1 | intercellular adhesion molecule 1 | 1 | 1 | ||||||||
| MIRT755687 | RUNX2 | runt related transcription factor 2 | 3 | 1 | ||||||||
| MIRT755688 | SPP1 | secreted phosphoprotein 1 | 3 | 1 | ||||||||
| MIRT755689 | ALPL | alkaline phosphatase, liver/bone/kidney | 3 | 1 | ||||||||
| MIRT756239 | NEAT1 | nuclear paraspeckle assembly transcript 1 (non-protein coding) | 2 | 1 | ||||||||
| MIRT756240 | FANCE | Fanconi anemia complementation group E | 3 | 1 | ||||||||
| MIRT756287 | ZBTB7C | zinc finger and BTB domain containing 7C | 3 | 1 | ||||||||
| MIRT756352 | PLCB1 | phospholipase C beta 1 | 3 | 1 | ||||||||
| miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|