pre-miRNA Information
pre-miRNA hsa-mir-26a-1   
Genomic Coordinates chr3: 37969404 - 37969480
Synonyms MIR26A, MIRN26A1, MIR26A1
Description Homo sapiens miR-26a-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-26a-2   
Genomic Coordinates chr12: 57824609 - 57824692
Synonyms MIRN26A2, MIR26A2
Description Homo sapiens miR-26a-2 stem-loop
Comment miR-26a was cloned from HeLa cells .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-26a-5p
Sequence 10| UUCAAGUAAUCCAGGAUAGGCU |31
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
C-to-U 21 3 + 37969433 17604727 MiREDiBase
C-to-U 21 12 - 57824659 17604727 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30516844 7 COSMIC
COSN30543820 11 COSMIC
COSN30447912 11 COSMIC
COSN31502139 13 COSMIC
COSN31591664 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1323067579 3 dbSNP
rs1315291543 9 dbSNP
rs1249227702 12 dbSNP
rs1348933092 17 dbSNP
rs1012142515 17 dbSNP
rs1445643611 18 dbSNP
rs756293180 19 dbSNP
rs765258989 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B52VKB miR-26a Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Quantitative real-time PCR
BI82DS miR-26a-5p Predictive Biomarker (PRD) Clinical/Experimental Data Expression High Peripheral blood Quantitative real-time PCR
Gene Information
Gene Symbol HMGA1   
Synonyms HMG-R, HMGA1A, HMGIY
Description high mobility group AT-hook 1
Transcript NM_002131   
Other Transcripts NM_145899 , NM_145901 , NM_145902 , NM_145903 , NM_145905   
Expression
Putative miRNA Targets on HMGA1
3'UTR of HMGA1
(miRNA target sites are highlighted)
>HMGA1|NM_002131|3'UTR
   1 CCCATGCGTGCCGCCTGCTCCTCACTGGAGGAGCAGCTTCCTTCTGGGACTGGACAGCTTTGCTCCGCTCCCACCGCCCC
  81 CACCCCTTCCCCAGGCCCACCATCACCACCGCCTCTGGCCGCCACCCCCATCTTCCACCTGTGCCCTCACCACCACACTA
 161 CACAGCACACCAGCCGCTGCAGGGCTCCCATGGGCTGAGTGGGGAGCAGTTTTCCCCTGGCCTCAGTTCCCAGCTCCCCC
 241 CGCCCACCCACGCATACACACATGCCCTCCTGGACAAGGCTAACATCCCACTTAGCCGCACCCTGCACCTGCTGCGTCCC
 321 CACTCCCTTGGTGGTGGGGACATTGCTCTCTGGGCTTTTGGTTTGGGGGCGCCCTCTCTGCTCCTTCACTGTTCCCTCTG
 401 GCTTCCCATAGTGGGGCCTGGGAGGGTTCCCCTGGCCTTAAAAGGGGCCCAAGCCCCATCTCATCCTGGCACGCCCTACT
 481 CCACTGCCCTGGCAGCAGCAGGTGTGGCCAATGGAGGGGGGTGCTGGCCCCCAGGATTCCCCCAGCCAAACTGTCTTTGT
 561 CACCACGTGGGGCTCACTTTTCATCCTTCCCCAACTTCCCTAGTCCCCGTACTAGGTTGGACAGCCCCCTTCGGTTACAG
 641 GAAGGCAGGAGGGGTGAGTCCCCTACTCCCTCTTCACTGTGGCCACAGCCCCCTTGCCCTCCGCCTGGGATCTGAGTACA
 721 TATTGTGGTGATGGAGATGCAGTCACTTATTGTCCAGGTGAGGCCCAAGAGCCCTGTGGCCGCCACCTGAGGTGGGCTGG
 801 GGCTGCTCCCCTAACCCTACTTTGCTTCCGCCACTCAGCCATTTCCCCCTCCTCAGATGGGGCACCAATAACAAGGAGCT
 881 CACCCTGCCCGCTCCCAACCCCCCTCCTGCTCCTCCCTGCCCCCCAAGGTTCTGGTTCCATTTTTCCTCTGTTCACAAAC
 961 TACCTCTGGACAGTTGTGTTGTTTTTTGTTCAATGTTCCATTCTTCGACATCCGTCATTGCTGCTGCTACCAGCGCCAAA
1041 TGTTCATCCTCATTGCCTCCTGTTCTGCCCACGATCCCCTCCCCCAAGATACTCTTTGTGGGGAAGAGGGGCTGGGGCAT
1121 GGCAGGCTGGGTGACCGACTACCCCAGTCCCAGGGAAGGTGGGGCCCTGCCCCTAGGATGCTGCAGCAGAGTGAGCAAGG
1201 GGGCCCAAATCGACCATAAAGGGTGTAGGGGCCACCTCCTCCCCCTGTTCTGTTGGGGAGGGGTAGCCATGATTTGTCCC
1281 AGCCTGGGGCTCCCTCTCTGGTTTCCTATTTGCAGTTACTTGAATAAAAAAAATATCCTTTTCTGGAAAAAAAAAAAAAA
1361 AAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucGGAUAGGACCU-AAUGAACUu 5'
            ||||| :|| | |||||||| 
Target 5' ttCCTAT-TTGCAGTTACTTGAa 3'
1303 - 1324 167.00 -16.80
2
miRNA  3' ucGGAUAGGACCUAAUGAAcuu 5'
            |||| ||     |||||   
Target 5' ccCCTAACC----CTACTTtgc 3'
808 - 825 110.00 -6.30
3
miRNA  3' ucGGAU-AGGACCUAAUGAACUu 5'
            |||| |||  |  |||| |: 
Target 5' tcCCTAGTCCCCG--TACTAGGt 3'
597 - 617 108.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM5958929 19 COSMIC
COSM9394511 32 COSMIC
COSM9847894 77 COSMIC
COSM4590304 83 COSMIC
COSM9815441 83 COSMIC
COSM7319397 88 COSMIC
COSM9848484 95 COSMIC
COSM5996992 121 COSMIC
COSM1621547 145 COSMIC
COSM5512246 252 COSMIC
COSM1621548 303 COSMIC
COSM3784535 323 COSMIC
COSM8575563 423 COSMIC
COSM9371603 437 COSMIC
COSM7259299 479 COSMIC
COSM6994698 606 COSMIC
COSM9563391 610 COSMIC
COSM4595312 636 COSMIC
COSM8434511 640 COSMIC
COSM8413371 690 COSMIC
COSM5505187 704 COSMIC
COSM7608380 719 COSMIC
COSN31560009 741 COSMIC
COSN6319046 751 COSMIC
COSN30540261 765 COSMIC
COSN31484480 770 COSMIC
COSN19703020 783 COSMIC
COSN17078344 830 COSMIC
COSN9781128 837 COSMIC
COSN26466050 947 COSMIC
COSN5629450 1096 COSMIC
COSN15974416 1108 COSMIC
COSN23391964 1299 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773643332 5 dbSNP
rs1331211392 6 dbSNP
rs761589586 6 dbSNP
rs771892031 6 dbSNP
rs1229061581 7 dbSNP
rs766017108 8 dbSNP
rs373998742 9 dbSNP
rs1204261651 12 dbSNP
rs1264855109 13 dbSNP
rs759283212 14 dbSNP
rs1463388860 16 dbSNP
rs1204322201 19 dbSNP
rs1166110075 25 dbSNP
rs1368910793 26 dbSNP
rs1014079471 27 dbSNP
rs1262781153 28 dbSNP
rs1430492798 29 dbSNP
rs772826618 37 dbSNP
rs1428706480 39 dbSNP
rs1480780305 41 dbSNP
rs1179211858 42 dbSNP
rs1410319655 46 dbSNP
rs1453569920 48 dbSNP
rs1020054814 49 dbSNP
rs760323577 51 dbSNP
rs1289812670 52 dbSNP
rs1385270172 53 dbSNP
rs1383535196 54 dbSNP
rs1300859564 55 dbSNP
rs1183607020 56 dbSNP
rs1344328358 59 dbSNP
rs967127881 62 dbSNP
rs1285181377 63 dbSNP
rs999874702 64 dbSNP
rs1238115758 65 dbSNP
rs764643694 66 dbSNP
rs752273694 67 dbSNP
rs758268707 68 dbSNP
rs777697282 72 dbSNP
rs1268360569 74 dbSNP
rs751303861 75 dbSNP
rs757029639 76 dbSNP
rs557830810 77 dbSNP
rs781077291 78 dbSNP
rs1418971707 79 dbSNP
rs975410620 80 dbSNP
rs749447567 81 dbSNP
rs573143874 82 dbSNP
rs2780219 83 dbSNP
rs1427970886 84 dbSNP
rs1309911046 86 dbSNP
rs772659198 87 dbSNP
rs773888708 88 dbSNP
rs1304402049 89 dbSNP
rs1371159868 90 dbSNP
rs747591630 91 dbSNP
rs1390774543 93 dbSNP
rs1410721908 94 dbSNP
rs771177977 97 dbSNP
rs1318506570 99 dbSNP
rs1242257957 102 dbSNP
rs1451986512 103 dbSNP
rs1252011428 105 dbSNP
rs777114762 106 dbSNP
rs759111273 111 dbSNP
rs1360431420 112 dbSNP
rs1224870101 114 dbSNP
rs1249681940 121 dbSNP
rs574265056 122 dbSNP
rs1178286914 124 dbSNP
rs1253217889 125 dbSNP
rs1422496930 126 dbSNP
rs1183366422 127 dbSNP
rs1384273363 128 dbSNP
rs774927228 131 dbSNP
rs544847907 132 dbSNP
rs562344845 136 dbSNP
rs1460982488 140 dbSNP
rs1298688930 142 dbSNP
rs375019390 143 dbSNP
rs763975213 144 dbSNP
rs751465310 145 dbSNP
rs1383864381 149 dbSNP
rs1248470113 150 dbSNP
rs757264395 153 dbSNP
rs1307006927 155 dbSNP
rs1205294447 161 dbSNP
rs1253667799 162 dbSNP
rs767201678 170 dbSNP
rs940773178 176 dbSNP
rs368392959 177 dbSNP
rs545165232 180 dbSNP
rs560272359 181 dbSNP
rs1393918642 185 dbSNP
rs1416871355 186 dbSNP
rs1427465709 189 dbSNP
rs1455320149 190 dbSNP
rs527509695 191 dbSNP
rs1356247573 195 dbSNP
rs1468144180 197 dbSNP
rs1441505701 198 dbSNP
rs1335946017 199 dbSNP
rs1406582743 200 dbSNP
rs1454326479 202 dbSNP
rs758521351 204 dbSNP
rs949956883 208 dbSNP
rs1215283838 210 dbSNP
rs1297789891 221 dbSNP
rs548928964 222 dbSNP
rs1223477780 223 dbSNP
rs1485423938 225 dbSNP
rs1281111403 226 dbSNP
rs1264222950 229 dbSNP
rs903002981 230 dbSNP
rs1462943894 234 dbSNP
rs766225310 236 dbSNP
rs1207199789 237 dbSNP
rs1240065433 238 dbSNP
rs561103673 242 dbSNP
rs188629081 243 dbSNP
rs1421052727 246 dbSNP
rs1479147123 247 dbSNP
rs1175635525 248 dbSNP
rs1032730483 252 dbSNP
rs550002991 253 dbSNP
rs1397244084 254 dbSNP
rs753821579 256 dbSNP
rs1315927413 258 dbSNP
rs746261014 262 dbSNP
rs568959785 263 dbSNP
rs539441976 266 dbSNP
rs568187720 267 dbSNP
rs551496296 270 dbSNP
rs1284544528 271 dbSNP
rs1326269589 272 dbSNP
rs996565455 275 dbSNP
rs1435999890 277 dbSNP
rs1283978364 279 dbSNP
rs566606124 286 dbSNP
rs1216102966 287 dbSNP
rs1264798809 288 dbSNP
rs1361113836 292 dbSNP
rs1169285970 293 dbSNP
rs1489671889 294 dbSNP
rs1198062321 295 dbSNP
rs1269571609 296 dbSNP
rs773969172 298 dbSNP
rs767493668 299 dbSNP
rs1363679539 302 dbSNP
rs1258057250 303 dbSNP
rs534263154 304 dbSNP
rs987694238 305 dbSNP
rs759200105 312 dbSNP
rs1161566143 313 dbSNP
rs1363925599 315 dbSNP
rs1015102202 316 dbSNP
rs1303801600 317 dbSNP
rs1309697093 321 dbSNP
rs779484794 322 dbSNP
rs962169002 323 dbSNP
rs1279446561 324 dbSNP
rs1374514753 325 dbSNP
rs1225819529 327 dbSNP
rs1287799732 328 dbSNP
rs1280369488 329 dbSNP
rs1356788145 331 dbSNP
rs1461471303 335 dbSNP
rs1207923197 337 dbSNP
rs1245920399 339 dbSNP
rs1462167022 340 dbSNP
rs756006004 341 dbSNP
rs555690284 343 dbSNP
rs1460690370 345 dbSNP
rs796229715 346 dbSNP
rs1179584626 351 dbSNP
rs1232177977 353 dbSNP
rs766317647 354 dbSNP
rs11557700 356 dbSNP
rs752946938 362 dbSNP
rs142532394 365 dbSNP
rs1189947495 366 dbSNP
rs1383656772 367 dbSNP
rs758753247 370 dbSNP
rs777999103 371 dbSNP
rs1367559819 372 dbSNP
rs765108256 374 dbSNP
rs937401866 375 dbSNP
rs1336866794 376 dbSNP
rs1444865654 377 dbSNP
rs1313346504 382 dbSNP
rs1213487596 389 dbSNP
rs1335884980 390 dbSNP
rs1275646332 392 dbSNP
rs991533061 394 dbSNP
rs747119801 395 dbSNP
rs1244834863 397 dbSNP
rs757650780 403 dbSNP
rs1357868589 409 dbSNP
rs567797839 416 dbSNP
rs1272281739 417 dbSNP
rs1438290543 423 dbSNP
rs1378694243 424 dbSNP
rs1170885266 425 dbSNP
rs1200356634 426 dbSNP
rs781735212 428 dbSNP
rs538200876 430 dbSNP
rs1184444409 433 dbSNP
rs1370358014 435 dbSNP
rs1474506249 436 dbSNP
rs1323417720 441 dbSNP
rs1167376993 443 dbSNP
rs542568545 447 dbSNP
rs1412156502 450 dbSNP
rs949991297 451 dbSNP
rs746174678 456 dbSNP
rs1041578049 457 dbSNP
rs1363093979 462 dbSNP
rs1453766151 464 dbSNP
rs192998300 467 dbSNP
rs145863026 473 dbSNP
rs544998673 474 dbSNP
rs748922683 479 dbSNP
rs1469243015 481 dbSNP
rs1255271653 484 dbSNP
rs1339415052 485 dbSNP
rs1054693268 486 dbSNP
rs1350595760 487 dbSNP
rs1261103191 490 dbSNP
rs1460714731 494 dbSNP
rs1437904716 496 dbSNP
rs1204044050 501 dbSNP
rs1258579925 502 dbSNP
rs1319631244 504 dbSNP
rs1261783776 505 dbSNP
rs899604561 509 dbSNP
rs996988029 512 dbSNP
rs1029348192 516 dbSNP
rs1230500897 516 dbSNP
rs1445473398 517 dbSNP
rs1192685853 518 dbSNP
rs553772855 519 dbSNP
rs1289356876 522 dbSNP
rs1393344987 528 dbSNP
rs1323851926 531 dbSNP
rs1009160718 535 dbSNP
rs1397047983 539 dbSNP
rs1478807012 540 dbSNP
rs773666182 544 dbSNP
rs962604943 545 dbSNP
rs995037436 546 dbSNP
rs1470543404 547 dbSNP
rs1304923963 550 dbSNP
rs761400065 552 dbSNP
rs1380189748 553 dbSNP
rs1277550684 555 dbSNP
rs1317145382 556 dbSNP
rs1348196807 556 dbSNP
rs138006458 556 dbSNP
rs372041536 559 dbSNP
rs542666872 567 dbSNP
rs1281365376 568 dbSNP
rs11759910 569 dbSNP
rs752656250 571 dbSNP
rs1223942804 573 dbSNP
rs755474994 578 dbSNP
rs773171532 582 dbSNP
rs1204781257 583 dbSNP
rs1262627439 585 dbSNP
rs991957499 586 dbSNP
rs111748592 590 dbSNP
rs1268845000 593 dbSNP
rs1341589521 595 dbSNP
rs1481035248 596 dbSNP
rs1178804510 597 dbSNP
rs766266312 599 dbSNP
rs753754619 600 dbSNP
rs1166347548 601 dbSNP
rs1157647754 602 dbSNP
rs1360752226 605 dbSNP
rs1421061543 606 dbSNP
rs1300721007 607 dbSNP
rs1344271929 608 dbSNP
rs73419171 609 dbSNP
rs1303236518 610 dbSNP
rs372626790 620 dbSNP
rs1209563083 622 dbSNP
rs924573061 624 dbSNP
rs564825523 625 dbSNP
rs758593266 625 dbSNP
rs1238049182 626 dbSNP
rs757385064 627 dbSNP
rs1356090550 629 dbSNP
rs781165347 630 dbSNP
rs750904896 631 dbSNP
rs1054325412 632 dbSNP
rs1490521966 633 dbSNP
rs756668884 634 dbSNP
rs1150783 636 dbSNP
rs184349426 637 dbSNP
rs1418918946 639 dbSNP
rs749655115 646 dbSNP
rs1050797831 647 dbSNP
rs566486075 649 dbSNP
rs1409591117 653 dbSNP
rs1421162492 654 dbSNP
rs890870444 655 dbSNP
rs1364415129 656 dbSNP
rs1003919932 657 dbSNP
rs1457920597 660 dbSNP
rs1295284467 661 dbSNP
rs1408851095 662 dbSNP
rs375191354 664 dbSNP
rs779344492 666 dbSNP
rs1390649688 669 dbSNP
rs1309681119 670 dbSNP
rs1378769682 671 dbSNP
rs1244092864 674 dbSNP
rs1314546273 680 dbSNP
rs1360272284 682 dbSNP
rs1223846710 683 dbSNP
rs1250190345 687 dbSNP
rs527784847 689 dbSNP
rs747796445 690 dbSNP
rs1240450151 691 dbSNP
rs1443093890 697 dbSNP
rs549451959 703 dbSNP
rs145849177 704 dbSNP
rs538419054 706 dbSNP
rs1166256577 708 dbSNP
rs1371319384 710 dbSNP
rs1461436537 717 dbSNP
rs1211498946 720 dbSNP
rs1331910863 723 dbSNP
rs556924403 724 dbSNP
rs1271161001 725 dbSNP
rs777177218 725 dbSNP
rs1450118690 727 dbSNP
rs1336391651 730 dbSNP
rs1490551444 733 dbSNP
rs1380160844 739 dbSNP
rs1230140973 741 dbSNP
rs959088803 742 dbSNP
rs571991698 750 dbSNP
rs770999104 751 dbSNP
rs1219787246 753 dbSNP
rs1260485223 756 dbSNP
rs1460303905 757 dbSNP
rs563499231 762 dbSNP
rs1242186183 763 dbSNP
rs1483358119 767 dbSNP
rs1394204570 769 dbSNP
rs115929552 774 dbSNP
rs1259098295 777 dbSNP
rs1427342636 780 dbSNP
rs759430066 782 dbSNP
rs1156336595 783 dbSNP
rs144540283 786 dbSNP
rs1334493771 787 dbSNP
rs553813535 788 dbSNP
rs1180089991 797 dbSNP
rs371593640 801 dbSNP
rs1366822318 804 dbSNP
rs1221951902 809 dbSNP
rs990451434 814 dbSNP
rs1473877752 817 dbSNP
rs542405032 818 dbSNP
rs1351456495 821 dbSNP
rs2780218 825 dbSNP
rs2780217 826 dbSNP
rs932510371 828 dbSNP
rs1164058111 830 dbSNP
rs1419179458 831 dbSNP
rs537322378 837 dbSNP
rs1439006898 844 dbSNP
rs1343972827 845 dbSNP
rs1318220107 847 dbSNP
rs1310380725 848 dbSNP
rs1371755964 850 dbSNP
rs912338027 852 dbSNP
rs939736146 855 dbSNP
rs1394028695 857 dbSNP
rs1191586611 858 dbSNP
rs1240329452 862 dbSNP
rs1489329414 862 dbSNP
rs150982394 863 dbSNP
rs1214983562 864 dbSNP
rs1310491365 868 dbSNP
rs1036709872 873 dbSNP
rs1208735941 873 dbSNP
rs1448228994 879 dbSNP
rs1302186499 881 dbSNP
rs1221342075 884 dbSNP
rs1269290624 885 dbSNP
rs1270196283 886 dbSNP
rs898130342 888 dbSNP
rs1362937741 891 dbSNP
rs73419174 892 dbSNP
rs1374495084 897 dbSNP
rs1049745196 899 dbSNP
rs894721330 902 dbSNP
rs1013080232 903 dbSNP
rs1230388588 904 dbSNP
rs10947489 905 dbSNP
rs1478110198 908 dbSNP
rs1265196575 918 dbSNP
rs1185929641 920 dbSNP
rs1485373965 922 dbSNP
rs1256851945 927 dbSNP
rs907325763 928 dbSNP
rs564711337 930 dbSNP
rs1306179458 937 dbSNP
rs200521247 947 dbSNP
rs998867948 950 dbSNP
rs532281980 970 dbSNP
rs201779449 976 dbSNP
rs1219553727 977 dbSNP
rs1342967715 978 dbSNP
rs1208683436 979 dbSNP
rs1254094588 982 dbSNP
rs1412431575 982 dbSNP
rs1377804914 985 dbSNP
rs140481117 994 dbSNP
rs1188487514 997 dbSNP
rs540878901 1004 dbSNP
rs560158096 1007 dbSNP
rs527673741 1008 dbSNP
rs549245060 1011 dbSNP
rs149013137 1015 dbSNP
rs1185668147 1018 dbSNP
rs750856264 1022 dbSNP
rs1256938715 1030 dbSNP
rs1391190725 1035 dbSNP
rs986661229 1036 dbSNP
rs912368599 1038 dbSNP
rs939768653 1045 dbSNP
rs1434600337 1050 dbSNP
rs1171340564 1053 dbSNP
rs1403705803 1058 dbSNP
rs1396173989 1062 dbSNP
rs1322791829 1064 dbSNP
rs1317160117 1069 dbSNP
rs17038619 1073 dbSNP
rs1436864649 1074 dbSNP
rs1298014583 1078 dbSNP
rs879589872 1085 dbSNP
rs919612284 1088 dbSNP
rs147082929 1093 dbSNP
rs1054798737 1095 dbSNP
rs1368911696 1095 dbSNP
rs1417343306 1098 dbSNP
rs571830852 1099 dbSNP
rs1201147220 1104 dbSNP
rs1459418864 1108 dbSNP
rs1251541210 1117 dbSNP
rs1283797854 1127 dbSNP
rs991588253 1133 dbSNP
rs1213390861 1134 dbSNP
rs1489111752 1137 dbSNP
rs948960263 1138 dbSNP
rs1190786535 1144 dbSNP
rs1314583842 1150 dbSNP
rs1308161803 1155 dbSNP
rs1248961791 1159 dbSNP
rs1378582500 1161 dbSNP
rs915649170 1161 dbSNP
rs1454154546 1165 dbSNP
rs1045889755 1171 dbSNP
rs907358404 1172 dbSNP
rs539344658 1174 dbSNP
rs998899261 1188 dbSNP
rs548106813 1193 dbSNP
rs1032205407 1194 dbSNP
rs375086146 1197 dbSNP
rs1379922715 1201 dbSNP
rs1466086669 1207 dbSNP
rs1150782 1208 dbSNP
rs1012014555 1211 dbSNP
rs1193429112 1212 dbSNP
rs41269030 1213 dbSNP
rs772035549 1226 dbSNP
rs1270146273 1229 dbSNP
rs1196988716 1230 dbSNP
rs1458431537 1235 dbSNP
rs1484639376 1238 dbSNP
rs1284701543 1239 dbSNP
rs554398196 1246 dbSNP
rs3197257 1251 dbSNP
rs1393436175 1254 dbSNP
rs1232319039 1261 dbSNP
rs1274343165 1264 dbSNP
rs879394138 1268 dbSNP
rs576111157 1270 dbSNP
rs1359750789 1271 dbSNP
rs536715260 1272 dbSNP
rs961165424 1279 dbSNP
rs1172183849 1283 dbSNP
rs1379717805 1284 dbSNP
rs1238268806 1286 dbSNP
rs780882116 1289 dbSNP
rs1191411376 1294 dbSNP
rs2797 1296 dbSNP
rs972585859 1300 dbSNP
rs919712523 1309 dbSNP
rs1193776147 1315 dbSNP
rs1277793552 1318 dbSNP
rs1488970005 1318 dbSNP
rs1199520328 1323 dbSNP
rs1257548693 1326 dbSNP
rs931062273 1326 dbSNP
rs558332304 1327 dbSNP
rs1269084103 1334 dbSNP
rs576622661 1337 dbSNP
rs777562460 1339 dbSNP
rs1401969353 1345 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Article - Visone R; Pallante P; Vecchione A; et al.
- Oncogene, 2007
Thyroid carcinomas comprise a broad spectrum of tumors with different clinical behaviors. On the one side, there are occult papillary carcinomas (PTC), slow growing and clinically silent, and on the other side, rapidly growing anaplastic carcinomas (ATC), which are among the most lethal human neoplasms. We have analysed the microRNA (miR) profile of ATC in comparison to the normal thyroid using a microarray (miRNACHIP microarray). By this approach, we found an aberrant miR expression profile that clearly differentiates ATC from normal thyroid tissues and from PTC analysed in previous studies. In particular, a significant decrease in miR-30d, miR-125b, miR-26a and miR-30a-5p was detected in ATC in comparison to normal thyroid tissue. These results were further confirmed by northern blots, quantitative reverse transcription-PCR analyses and in situ hybridization. The overexpression of these four miRs in two human ATC-derived cell lines suggests a critical role of miR-125b and miR-26a downregulation in thyroid carcinogenesis, since a cell growth inhibition was achieved. Conversely, no effect on cell growth was observed after the overexpression of miR-30d and miR-30a-5p in the same cells. In conclusion, these data indicate a miR signature associated with ATC and suggest the miR deregulation as an important event in thyroid cell transformation.
LinkOut: [PMID: 17563749]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MEG-01
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... "This analysis identi茂卢聛ed miR-15ab ...

- Palmieri D; D'Angelo D; Valentino T; De et al., 2012, Oncogene.

Article - Palmieri D; D'Angelo D; Valentino T; De et al.
- Oncogene, 2012
Previous studies have demonstrated that high mobility group A proteins have a critical role on the onset of human pituitary adenomas. Indeed, both high mobility group A (HMGA) genes are overexpressed in pituitary adenomas, and consistently transgenic mice overexpressing either the Hmga1 or the Hmga2 gene develop mixed growth hormone/prolactin (GH-PRL)-secreting pituitary adenomas. Trisomy of chromosome 12, where HMGA2 is located, and/or amplification of the HMGA2 gene locus account for the HMGA2 overexpression in most human prolactinomas. Conversely, HMGA1 overexpression is not associated to any rearrangement or amplification of the HMGA1 locus. We have first identified micro RNAs (miRNAs) able to target both HMGA1 and HMGA2 messenger RNAs. Then, all of these miRNAs have been found downregulated in pituitary adenomas of different histotypes, compared with normal pituitary. Interestingly, their downregulation was also observed in nonfunctioning pituitary adenomas where HMGA2 overexpression is not associated to any alteration of the HMGA2 locus. Functional studies show that all these HMGA-targeting miRNAs inhibit the proliferation of the rat pituitary adenoma cell line GH3. Therefore, these results indicate that the downregulation of the miRNAs able to target the HMGA genes could contribute to increase HMGA protein levels in human pituitary adenomas, and then to pituitary tumorigenesis.
LinkOut: [PMID: 22139073]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Sw1990 , Panc-1
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... HMGA1 is a target of miR-26a ...

- Li W; Yuan Y; Huang L; Qiao M; Zhang Y, 2012, Diabetes research and clinical practice.

Article - Li W; Yuan Y; Huang L; Qiao M; Zhang Y
- Diabetes research and clinical practice, 2012
AIMS: To investigate the effect of metformin on the expression profiles of microRNAs in human pancreatic cancer cells. METHODS: MicroRNAs real-time PCR Array was applied to investigate differentially expressed miRNAs in Sw1990 cells treated with or without metformin. Stem-loop real time RT-PCR was used to confirm the results of the array assay in Sw1990 and Panc-1 cells. The effects of miR-26a on cell growth, apoptosis, invasion and migration abilities were respectively examined by CCK8 assay, Apoptosis assay, Matrigel invasion and migration assay. HMGA1 was proved to be a target of miR-26a by Luciferase reporter assay, Real-time PCR and Western-blotting. RESULTS: Nine miRNAs were significantly up-regulated in metformin treated cells. Metformin up-regulated the expression of miR-26a, miR-192 and let-7c in a dose-dependent manner. Forced expression of miR-26a significantly inhibited cell proliferation, invasion, migration and increased cell apoptosis, whereas knockdown of miR-26a obtained the opposite effect. Furthermore, we demonstrated that HMGA1, an oncogene, is a direct target of miR-26a. Nude mice xenograft models confirmed that metformin up-regulated the level of miR-26a and surpressed the expression of HMGA1 in vivo. CONCLUSION: These observations suggested that modulation of miRNA expression may be an important mechanism underlying the biological effects of metformin.
LinkOut: [PMID: 22245693]
Experimental Support 4 for Non-Functional miRNA-Target Interaction
miRNA:Target xx
Validation Method
     
Conditions 5637 , UM-UC-3 , T24 , SV-HUC-1 , HEK293T
Disease MIMAT0000082; bladder cancer
Location of target site 3'UTR
Tools used in this research MicroCosm , TargetScan
Original Description (Extracted from the article) ... "High mobility group AT-hook 1 (HMGA1) ...

- Lin Y; Chen H; Hu Z; Mao Y; Xu X; Zhu Y; Xu et al., 2013, FEBS letters.

Article - Lin Y; Chen H; Hu Z; Mao Y; Xu X; Zhu Y; Xu et al.
- FEBS letters, 2013
It is increasingly clear that microRNAs play a crucial role in tumorigenesis. Recently, emerging evidence suggested that miR-26a is aberrantly expressed in tumor tissues. In our study, frequent down-regulation of miR-26a was observed in 10 human bladder cancer tissues. Forced expression of miR-26a in the bladder cancer cell line T24 inhibited cell proliferation and impaired cell motility. High mobility group AT-hook 1 (HMGA1), a gene that modulates cell cycle transition and cell motility, was verified as a novel target of miR-26a in bladder cancer. These findings indicate an important role for miR-26a in the molecular etiology of bladder cancer and implicate the potential application of miR-26a in bladder cancer therapy.
LinkOut: [PMID: 23796420]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MDA-MB-231 , 293T
Disease 3159.0
Location of target site 3'UTR
Tools used in this research microRNA.org , TargetScan
Original Description (Extracted from the article) ... "Figure 4A shows that the luciferase activity significantly decreased after co-transfection with psiCHECK-2/HMGA1 3芒鈧鈩- UTR and miR-26a mimics in comparison with control cells. The results demonstrated that miR-26a specifically binds to the 3芒鈧鈩-UTR of HMGA1 mRNA. The effect of miR-26a transfection on HMGA1 mRNA and protein expression was respectively assessed using RT-PCR and Western blot in MDA-MB-231 cell line. As shown in Figure 4B and 4C ...

- Zhao XX; Yuan QZ; Mu DP; Sun DW; Bo QA; Pan et al., 2015, International journal of clinical and experimental pathology.

Article - Zhao XX; Yuan QZ; Mu DP; Sun DW; Bo QA; Pan et al.
- International journal of clinical and experimental pathology, 2015
OBJECTIVES: To investigate the crucial role of miR-26a in breast cancer and to validate whether miR-26a could regulate proliferation of breast cancer cells by targeting high mobility group AT-hook 1 (HMGA1). METHODS: Reverse transcription-polymerase chain reaction (RT-PCR) was used to quantify the expression levels of miR-26a in breast cancer and adjacent non-cancerous breast tissues. MTT, cell migration and invasion assay were carried out to characterize the miR-26a function. Finally, to validate the target gene of miR-26a, luciferase reporter assay was employed, followed by RT-PCR and Western blot confirmation. RESULTS: Compared with normal tissues, a significant down-regulation of miR-26a expression was observed in breast cancer tissues (P=0.002). miR-26a suppresses MDA-MB-231 and Mcf-7 breast cancer cell lines proliferation and motility. The luciferase activity was significantly decreased after co-transfection with psiCHECK-2/HMGA1 3'-UTR and miR-26a mimics in comparison with control cells, and qRT-PCR and Western blotting analysis found that HMGA1 expression at the mRNA and protein levels decreased in the miR-26a mimic-treatment group relative to NC. MTT assay showed that down regulation of HMGA1 by siRNA could significantly enhance the tumor-suppressive effect of miR-26a (P < 0.05). CONCLUSIONS: The results of the present study indicate that miR-26a may be associated with human breast carcinogenesis, which inhibits tumor cell proliferation by targeting HMGA1.
LinkOut: [PMID: 25755724]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BEAS2B , A549
Disease "lung adenocarcinoma (LUAD)
Location of target site 3'UTR
Tools used in this research previous_study
Original Description (Extracted from the article) ... MiR-26 down-regulates IL-6 production through silencing HMGA1 and MALT1. ...

- Chen CY; Chang JT; Ho YF; Shyu AB, 2016, Nucleic acids research.

Article - Chen CY; Chang JT; Ho YF; Shyu AB
- Nucleic acids research, 2016
MiR-26 has emerged as a key tumour suppressor in various cancers. Accumulating evidence supports that miR-26 regulates inflammation and tumourigenicity largely through down-regulating IL-6 production, but the underlying mechanism remains obscure. Here, combining a transcriptome-wide approach with manipulation of cellular miR-26 levels, we showed that instead of directly targeting IL-6 mRNA for gene silencing, miR-26 diminishes IL-6 transcription activated by TNF-alpha through silencing NF-kappaB signalling related factors HMGA1 and MALT1. We demonstrated that miR-26 extensively dampens the induction of many inflammation-related cytokine, chemokine and tissue-remodelling genes that are activated via NF-kappaB signalling pathway. Knocking down both HMGA1 and MALT1 by RNAi had a silencing effect on NF-kappaB-responsive genes similar to that caused by miR-26. Moreover, we discovered that poor patient prognosis in human lung adenocarcinoma is associated with low miR-26 and high HMGA1 or MALT1 levels and not with levels of any of them individually. These new findings not only unravel a novel mechanism by which miR-26 dampens IL-6 production transcriptionally but also demonstrate a direct role of miR-26 in down-regulating NF-kappaB signalling pathway, thereby revealing a more critical and broader role of miR-26 in inflammation and cancer than previously realized.
LinkOut: [PMID: 27025651]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions H1299 , NSCLC
Disease MIMAT0000082
Location of target site 3'UTR
Tools used in this research previous_study
Original Description (Extracted from the article) ... "To examine whether HMGA1 is a direct target of miR芒鈧鈥26a ...

- Sekimoto N; Suzuki A; Suzuki Y; Sugano S, 2017, Molecular medicine reports.

Article - Sekimoto N; Suzuki A; Suzuki Y; Sugano S
- Molecular medicine reports, 2017
Lung cancer is the most common cause of cancerassociated mortality worldwide, and the number of cases is increasing annually. Several studies have shown that microRNAs (miRNAs) control proliferation, differentiation, and apoptosis in various cell types, and increasing evidence indicates the presence of aberrant miRNA expression profiles and unique miRNA signaling pathways in several types of cancer. The present study aimed to identify miRNAs, which correlated specifically with the progression of lung cancer through the analysis of 57,100 transcripts and 1,341 small RNA expression profiles in 26 lung adenocarcinoma cell lines using nextgeneration sequencing. The most marked negative correlation was found between the expression of hsamiR26a1 and messenger RNA (mRNA), and a list of mRNAs, which exhibited negative correlation with hsamiR26a1 were investigated. The most marked negative correlation was observed between the expression levels of hsamiR26a1 and high mobility group A1 (HMGA1). Using a lung adenocarcinoma cell line, the present study analyzed the effect of the overexpression of miR26a on the expression of HMGA1 and found that miR26a repressed the expression of HMGA1 by reducing the mRNA levels of HMGA1. Furthermore, it was demonstrated that the overexpression of miR26a in a lung adenocarcinoma cell line repressed cell migration, invasion and growth by targeting HMGA1. Taken together, the present study showed a significant negative correlation between the expression of miR26a and HMGA1 in 26 lung adenocarcinoma cell lines, and provided evidence that the suppression of miR26a supports the progression of cancer by stimulating the expression of HMGA1.
LinkOut: [PMID: 28000891]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer -0.424 4.9e-5 -0.375 3.3e-4 79 Click to see details
GSE19536 Breast cancer -0.358 1.3e-4 -0.339 2.8e-4 100 Click to see details
GSE42095 Differentiated embryonic stem cells -0.66 3.1e-4 -0.701 9.7e-5 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.668 6.4e-4 -0.729 1.3e-4 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.495 5.9e-3 -0.374 3.3e-2 25 Click to see details
GSE21849 B cell lymphoma -0.453 6.8e-3 -0.461 5.9e-3 29 Click to see details
GSE17498 Multiple myeloma -0.375 8.6e-3 -0.359 1.1e-2 40 Click to see details
GSE28544 Breast cancer 0.388 3.1e-2 0.718 3.9e-5 24 Click to see details
GSE19350 CNS germ cell tumors -0.548 3.3e-2 -0.476 5.9e-2 12 Click to see details
GSE32688 Pancreatic cancer 0.295 5.1e-2 0.239 9.4e-2 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.272 9.9e-2 0.300 7.7e-2 24 Click to see details
GSE21032 Prostate cancer -0.13 1.2e-1 -0.173 5.9e-2 83 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.367 1.7e-1 0.100 4.0e-1 9 Click to see details
GSE19783 ER+ ER+ breast cancer -0.228 1.7e-1 -0.283 1.1e-1 20 Click to see details
GSE38226 Liver fibrosis 0.215 1.7e-1 0.214 1.8e-1 21 Click to see details
GSE28260 Renal cortex and medulla 0.171 2.9e-1 0.176 2.8e-1 13 Click to see details
GSE27834 Pluripotent stem cells 0.06 4.1e-1 -0.041 4.4e-1 16 Click to see details
GSE17306 Multiple myeloma 0.027 4.3e-1 -0.068 3.2e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.023 4.3e-1 -0.041 3.7e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.028 4.5e-1 -0.009 4.8e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.012 4.6e-1 -0.015 4.4e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.83 0 -0.850 0 9 Click to see details
BLCA 0.562 0.01 0.593 0 18 Click to see details
STAD 0.354 0.02 0.302 0.05 32 Click to see details
BRCA 0.164 0.07 0.170 0.06 84 Click to see details
ESCA -0.479 0.07 -0.482 0.07 11 Click to see details
LUSC -0.212 0.1 -0.254 0.06 38 Click to see details
KIRC -0.132 0.14 -0.038 0.38 68 Click to see details
HNSC 0.151 0.17 0.159 0.16 42 Click to see details
LUAD -0.266 0.2 -0.287 0.18 12 Click to see details
COAD -0.341 0.2 -0.452 0.13 8 Click to see details
UCEC 0.192 0.22 0.188 0.22 19 Click to see details
THCA 0.104 0.22 0.122 0.18 59 Click to see details
CESC 0.75 0.23 0.500 0.33 3 Click to see details
PAAD 0.538 0.23 0.000 0.5 4 Click to see details
PCPG -0.729 0.24 -0.500 0.33 3 Click to see details
KICH -0.147 0.24 -0.116 0.29 25 Click to see details
KIRP -0.096 0.3 -0.096 0.3 32 Click to see details
PRAD 0.011 0.47 0.025 0.43 50 Click to see details
LIHC 0.005 0.49 -0.025 0.43 49 Click to see details
LIHC 0.005 0.49 -0.025 0.43 49 Click to see details
LIHC 0.005 0.49 -0.025 0.43 49 Click to see details
449 hsa-miR-26a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000109 HMGA2 high mobility group AT-hook 2 4 5
MIRT000110 HMGA1 high mobility group AT-hook 1 3 5
MIRT000111 CCNE2 cyclin E2 4 2
MIRT000112 CCND2 cyclin D2 5 10
MIRT001021 CDK8 cyclin dependent kinase 8 2 2
MIRT001022 CDC6 cell division cycle 6 3 3
MIRT001039 LIF LIF, interleukin 6 family cytokine 1 2
MIRT001095 PTEN phosphatase and tensin homolog 4 7
MIRT001771 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 5 11
MIRT001772 PLAG1 PLAG1 zinc finger 3 2
MIRT002315 SERBP1 SERPINE1 mRNA binding protein 1 3 3
MIRT002340 SMAD1 SMAD family member 1 4 6
MIRT003212 MAP3K2 mitogen-activated protein kinase kinase kinase 2 3 2
MIRT003213 RB1 RB transcriptional corepressor 1 5 2
MIRT003803 SMAD4 SMAD family member 4 3 3
MIRT003968 MYC MYC proto-oncogene, bHLH transcription factor 2 2
MIRT004338 CTGF connective tissue growth factor 2 2
MIRT004339 STRADB STE20-related kinase adaptor beta 4 4
MIRT004615 IFNB1 interferon beta 1 3 2
MIRT004676 GSK3B glycogen synthase kinase 3 beta 7 10
MIRT005587 CPEB2 cytoplasmic polyadenylation element binding protein 2 3 2
MIRT005588 CPEB3 cytoplasmic polyadenylation element binding protein 3 4 2
MIRT005589 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 2
MIRT005751 GDAP1 ganglioside induced differentiation associated protein 1 3 1
MIRT005920 MTDH metadherin 5 4
MIRT006306 CDK6 cyclin dependent kinase 6 2 1
MIRT006309 CCNE1 cyclin E1 3 2
MIRT006389 ESR1 estrogen receptor 1 1 1
MIRT006711 ABCA1 ATP binding cassette subfamily A member 1 2 1
MIRT006712 ARL4C ADP ribosylation factor like GTPase 4C 2 1
MIRT007177 E2F7 E2F transcription factor 7 2 7
MIRT007347 NOS2 nitric oxide synthase 2 3 2
MIRT007374 IL6 interleukin 6 2 1
MIRT030358 TGFBR2 transforming growth factor beta receptor 2 3 1
MIRT050053 HIST1H4E histone cluster 1 H4 family member e 1 1
MIRT050054 ZNF814 zinc finger protein 814 1 1
MIRT050055 ZNF233 zinc finger protein 233 1 1
MIRT050056 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT050057 SCRN1 secernin 1 1 1
MIRT050058 NABP1 nucleic acid binding protein 1 2 8
MIRT050059 FAM20B FAM20B, glycosaminoglycan xylosylkinase 1 1
MIRT050060 ARCN1 archain 1 1 1
MIRT050061 ANO3 anoctamin 3 1 1
MIRT050062 TFAM transcription factor A, mitochondrial 1 1
MIRT050063 FER FER tyrosine kinase 1 1
MIRT050064 HIAT1 major facilitator superfamily domain containing 14A 1 1
MIRT050065 PPP1CC protein phosphatase 1 catalytic subunit gamma 1 1
MIRT050066 SLC35B4 solute carrier family 35 member B4 1 1
MIRT050067 RASA1 RAS p21 protein activator 1 1 1
MIRT050068 COX1 cytochrome c oxidase subunit I 1 1
MIRT050069 MSL3 MSL complex subunit 3 1 1
MIRT050070 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT050071 GIT2 GIT ArfGAP 2 1 1
MIRT050072 DNMT1 DNA methyltransferase 1 1 1
MIRT050073 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT050074 UBA2 ubiquitin like modifier activating enzyme 2 1 1
MIRT050075 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT050076 MTRF1 mitochondrial translation release factor 1 1 1
MIRT050077 WBSCR16 RCC1 like 1 1
MIRT050078 NUAK1 NUAK family kinase 1 1 1
MIRT050079 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT050080 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT050081 ACTL8 actin like 8 1 1
MIRT050082 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT050083 DHX15 DEAH-box helicase 15 1 1
MIRT050084 TCP1 t-complex 1 1 1
MIRT050085 SLC25A5 solute carrier family 25 member 5 1 1
MIRT050086 LSM14A LSM14A, mRNA processing body assembly factor 1 1
MIRT050087 CAMKV CaM kinase like vesicle associated 1 1
MIRT050088 ALG10B ALG10B, alpha-1,2-glucosyltransferase 1 1
MIRT050089 TYW1 tRNA-yW synthesizing protein 1 homolog 1 1
MIRT050090 RPL13A ribosomal protein L13a 1 1
MIRT050091 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT050092 TXLNG taxilin gamma 1 1
MIRT050093 RAB18 RAB18, member RAS oncogene family 1 1
MIRT050094 RPS27A ribosomal protein S27a 1 1
MIRT050095 RPS26 ribosomal protein S26 1 1
MIRT050096 PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing 1 1
MIRT050097 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT050098 ZNF703 zinc finger protein 703 1 1
MIRT050099 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT050100 ZNF506 zinc finger protein 506 1 1
MIRT050101 KCTD5 potassium channel tetramerization domain containing 5 1 1
MIRT050102 CTC1 CST telomere replication complex component 1 1 1
MIRT050103 TKT transketolase 1 1
MIRT050104 LYST lysosomal trafficking regulator 1 1
MIRT050105 FAM134A reticulophagy regulator family member 2 1 1
MIRT050106 NKX2-5 NK2 homeobox 5 1 1
MIRT050107 AURKAIP1 aurora kinase A interacting protein 1 1 1
MIRT050108 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT050109 COASY Coenzyme A synthase 1 1
MIRT050110 CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT050111 COX3 cytochrome c oxidase III 1 1
MIRT050112 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT050113 PIGT phosphatidylinositol glycan anchor biosynthesis class T 1 1
MIRT050114 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT050115 ARHGEF1 Rho guanine nucleotide exchange factor 1 1 1
MIRT050116 SHC2 SHC adaptor protein 2 1 1
MIRT050117 PSMA3 proteasome subunit alpha 3 1 1
MIRT050118 PTTG1 pituitary tumor-transforming 1 1 1
MIRT050119 RPS24 ribosomal protein S24 1 1
MIRT050120 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT050121 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT050122 BTBD3 BTB domain containing 3 1 1
MIRT050123 AHR aryl hydrocarbon receptor 1 1
MIRT050124 EEF1B2 eukaryotic translation elongation factor 1 beta 2 1 1
MIRT050125 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT050126 SETD2 SET domain containing 2 1 1
MIRT050127 LRP6 LDL receptor related protein 6 1 1
MIRT050128 RHOBTB1 Rho related BTB domain containing 1 1 1
MIRT050129 HIST1H4J histone cluster 1 H4 family member j 1 1
MIRT050130 MYO10 myosin X 1 1
MIRT050131 ATP7B ATPase copper transporting beta 1 1
MIRT050132 CSRP2BP lysine acetyltransferase 14 1 1
MIRT050133 RBM39 RNA binding motif protein 39 1 1
MIRT050134 C14orf37 chromosome 14 open reading frame 37 2 3
MIRT050135 SFMBT1 Scm like with four mbt domains 1 1 1
MIRT050136 KIAA1704 GPALPP motifs containing 1 1 1
MIRT050137 ABCB9 ATP binding cassette subfamily B member 9 1 1
MIRT050138 ADM adrenomedullin 2 11
MIRT050139 USP7 ubiquitin specific peptidase 7 1 1
MIRT050140 TTN titin 1 1
MIRT050141 HNRNPU heterogeneous nuclear ribonucleoprotein U 1 1
MIRT050142 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT050143 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT050144 HOXC8 homeobox C8 1 1
MIRT050145 CTBP1 C-terminal binding protein 1 1 1
MIRT050146 SET SET nuclear proto-oncogene 1 1
MIRT050147 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT050148 TPGS2 tubulin polyglutamylase complex subunit 2 1 1
MIRT050149 CA2 carbonic anhydrase 2 1 1
MIRT050150 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT050151 ACTN4 actinin alpha 4 1 1
MIRT050152 EPG5 ectopic P-granules autophagy protein 5 homolog 1 1
MIRT050153 OLA1 Obg like ATPase 1 1 1
MIRT050154 RRM2 ribonucleotide reductase regulatory subunit M2 1 1
MIRT050155 BBX BBX, HMG-box containing 1 1
MIRT050156 NUP205 nucleoporin 205 1 1
MIRT050157 C6orf47 chromosome 6 open reading frame 47 1 1
MIRT050158 CFLAR CASP8 and FADD like apoptosis regulator 1 1
MIRT050159 SEC31A SEC31 homolog A, COPII coat complex component 1 1
MIRT050160 GLG1 golgi glycoprotein 1 1 1
MIRT050161 TBC1D16 TBC1 domain family member 16 1 1
MIRT050162 BTBD9 BTB domain containing 9 1 1
MIRT050163 RND2 Rho family GTPase 2 1 1
MIRT050164 TUBG1 tubulin gamma 1 1 1
MIRT050165 AHRR aryl-hydrocarbon receptor repressor 1 1
MIRT050166 CNTD2 cyclin N-terminal domain containing 2 1 1
MIRT050167 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT050168 CCDC43 coiled-coil domain containing 43 1 1
MIRT050169 MSH6 mutS homolog 6 1 1
MIRT050170 HIST4H4 histone cluster 4 H4 1 1
MIRT050171 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT050172 SLC25A30 solute carrier family 25 member 30 1 1
MIRT050173 USB1 U6 snRNA biogenesis phosphodiesterase 1 1 1
MIRT050174 MYH10 myosin heavy chain 10 1 1
MIRT050175 LINS lines homolog 1 1 1
MIRT050176 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 2
MIRT050177 ZNF207 zinc finger protein 207 1 1
MIRT050178 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT050179 TXNL1 thioredoxin like 1 1 1
MIRT050180 FOXO3 forkhead box O3 1 1
MIRT050181 COPB1 coatomer protein complex subunit beta 1 1 1
MIRT050182 FASN fatty acid synthase 1 1
MIRT050183 SARS seryl-tRNA synthetase 1 1
MIRT050184 DDB1 damage specific DNA binding protein 1 1 1
MIRT050185 PPIA peptidylprolyl isomerase A 1 1
MIRT050186 SLC35A4 solute carrier family 35 member A4 1 1
MIRT050187 TXNDC11 thioredoxin domain containing 11 1 1
MIRT050188 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT050189 TRAP1 TNF receptor associated protein 1 1 1
MIRT050190 SDCBP syndecan binding protein 1 1
MIRT050191 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT050192 KDM5C lysine demethylase 5C 1 1
MIRT050193 DST dystonin 1 1
MIRT050194 CLIC4 chloride intracellular channel 4 1 1
MIRT050195 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT050196 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT050197 RPL13 ribosomal protein L13 1 1
MIRT050198 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT052649 MCL1 MCL1, BCL2 family apoptosis regulator 1 1
MIRT052903 CHD1 chromodomain helicase DNA binding protein 1 2 1
MIRT053077 CKS2 CDC28 protein kinase regulatory subunit 2 4 3
MIRT053097 PRKCD protein kinase C delta 4 2
MIRT053251 BAG4 BCL2 associated athanogene 4 2 1
MIRT053574 FGF9 fibroblast growth factor 9 3 1
MIRT054062 ACVR1 activin A receptor type 1 2 1
MIRT054415 AMACR alpha-methylacyl-CoA racemase 3 1
MIRT054432 ATM ATM serine/threonine kinase 3 1
MIRT054484 RCBTB1 RCC1 and BTB domain containing protein 1 3 1
MIRT054645 HGF hepatocyte growth factor 3 1
MIRT054676 LIN28B lin-28 homolog B 3 1
MIRT054677 ZCCHC11 zinc finger CCHC-type containing 11 3 1
MIRT060004 VANGL2 VANGL planar cell polarity protein 2 2 4
MIRT062177 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT064905 ZBTB18 zinc finger and BTB domain containing 18 2 6
MIRT066809 ZDHHC18 zinc finger DHHC-type containing 18 2 3
MIRT067540 METAP2 methionyl aminopeptidase 2 1 1
MIRT072092 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 5
MIRT072125 RTF1 RTF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT073375 ABHD2 abhydrolase domain containing 2 1 1
MIRT075111 C16ORF70 chromosome 16 open reading frame 70 2 5
MIRT080605 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 8
MIRT085205 SLC5A3 solute carrier family 5 member 3 2 2
MIRT086007 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087899 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT089450 TET3 tet methylcytosine dioxygenase 3 2 3
MIRT089599 MAT2A methionine adenosyltransferase 2A 2 11
MIRT090517 SLC25A36 solute carrier family 25 member 36 2 2
MIRT097631 POLR3G RNA polymerase III subunit G 1 1
MIRT118410 DNMT3B DNA methyltransferase 3 beta 4 1
MIRT122040 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT133477 EP400 E1A binding protein p400 1 1
MIRT134087 KLHL42 kelch like family member 42 1 1
MIRT136529 KPNA6 karyopherin subunit alpha 6 1 1
MIRT137414 RLF rearranged L-myc fusion 1 1
MIRT137577 RCOR1 REST corepressor 1 1 1
MIRT137722 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT147274 KPNA2 karyopherin subunit alpha 2 2 10
MIRT151691 CHAF1A chromatin assembly factor 1 subunit A 1 1
MIRT156734 FAM126B family with sequence similarity 126 member B 2 2
MIRT159273 RASGRP3 RAS guanyl releasing protein 3 1 1
MIRT166022 SFXN1 sideroflexin 1 1 1
MIRT166592 ZSWIM6 zinc finger SWIM-type containing 6 1 1
MIRT168865 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT168937 IRF4 interferon regulatory factor 4 1 1
MIRT169515 TTK TTK protein kinase 1 1
MIRT169560 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT170138 KLHDC10 kelch domain containing 10 1 1
MIRT175075 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT183141 WEE1 WEE1 G2 checkpoint kinase 2 1
MIRT187790 ANKRD52 ankyrin repeat domain 52 1 1
MIRT191753 ZNF410 zinc finger protein 410 2 2
MIRT193070 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT193726 USP3 ubiquitin specific peptidase 3 1 1
MIRT203408 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT206543 RHOQ ras homolog family member Q 2 2
MIRT210981 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT213685 PTPN13 protein tyrosine phosphatase, non-receptor type 13 3 1
MIRT215349 CREBRF CREB3 regulatory factor 2 2
MIRT227685 TBC1D13 TBC1 domain family member 13 2 2
MIRT243962 MAP1B microtubule associated protein 1B 2 2
MIRT250410 TNRC6A trinucleotide repeat containing 6A 2 7
MIRT262152 OTUD1 OTU deubiquitinase 1 1 1
MIRT277212 AKIRIN1 akirin 1 2 2
MIRT286389 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 3
MIRT308147 PDE12 phosphodiesterase 12 2 2
MIRT319694 UBN2 ubinuclein 2 2 3
MIRT327077 KLHL15 kelch like family member 15 2 10
MIRT346489 SSX2IP SSX family member 2 interacting protein 1 1
MIRT438130 ADAM17 ADAM metallopeptidase domain 17 6 3
MIRT438159 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT438209 CHEK1 checkpoint kinase 1 2 1
MIRT438638 TDG thymine DNA glycosylase 1 1
MIRT438656 PHB prohibitin 3 1
MIRT444707 ZNF772 zinc finger protein 772 2 2
MIRT448615 OTUD4 OTU deubiquitinase 4 2 2
MIRT451358 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT457292 ZBTB45 zinc finger and BTB domain containing 45 2 2
MIRT458763 CES2 carboxylesterase 2 2 2
MIRT458855 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT460261 SLC26A2 solute carrier family 26 member 2 2 2
MIRT461702 ZNF426 zinc finger protein 426 2 2
MIRT465730 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT466688 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT468541 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT468809 SACS sacsin molecular chaperone 2 11
MIRT470198 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT476009 GTF2A1 general transcription factor IIA subunit 1 2 8
MIRT477228 ETF1 eukaryotic translation termination factor 1 2 4
MIRT477752 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT478346 DDIT4 DNA damage inducible transcript 4 2 2
MIRT478525 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT480793 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 2 6
MIRT482242 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 2 2
MIRT486465 MDM2 MDM2 proto-oncogene 2 10
MIRT487561 LOXL2 lysyl oxidase like 2 2 2
MIRT498663 ZNF664 zinc finger protein 664 2 8
MIRT499509 RNF6 ring finger protein 6 2 6
MIRT502456 FRAT2 FRAT2, WNT signaling pathway regulator 2 6
MIRT502713 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT502853 CHEK2 checkpoint kinase 2 2 6
MIRT507558 DEPDC1 DEP domain containing 1 2 6
MIRT524742 BRCA1 BRCA1, DNA repair associated 2 2
MIRT527178 LRRTM4 leucine rich repeat transmembrane neuronal 4 2 2
MIRT527909 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT532895 ZNF451 zinc finger protein 451 2 2
MIRT533588 TOB1 transducer of ERBB2, 1 2 7
MIRT534368 SETD8 lysine methyltransferase 5A 2 4
MIRT535060 PPP2R5D protein phosphatase 2 regulatory subunit B'delta 2 4
MIRT536204 MAD2L1 mitotic arrest deficient 2 like 1 2 2
MIRT537233 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539774 KIAA0408 KIAA0408 2 6
MIRT540867 ZBTB24 zinc finger and BTB domain containing 24 2 2
MIRT541042 SOGA3 SOGA family member 3 2 6
MIRT541350 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT544949 TUB tubby bipartite transcription factor 2 4
MIRT545809 ZNF608 zinc finger protein 608 2 2
MIRT547008 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT551188 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT551973 TMEM19 transmembrane protein 19 2 2
MIRT552044 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT553325 TSC22D2 TSC22 domain family member 2 2 2
MIRT554367 SFPQ splicing factor proline and glutamine rich 2 2
MIRT555741 PDCD10 programmed cell death 10 2 2
MIRT556346 MAN2A1 mannosidase alpha class 2A member 1 2 3
MIRT560389 TMEM254 transmembrane protein 254 2 2
MIRT560465 SMIM9 small integral membrane protein 9 2 2
MIRT561122 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT562626 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT564084 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT564207 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT565191 TSHZ1 teashirt zinc finger homeobox 1 2 2
MIRT567887 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT568259 BMP2K BMP2 inducible kinase 2 2
MIRT568505 ARF1 ADP ribosylation factor 1 2 2
MIRT572178 CDV3 CDV3 homolog 2 2
MIRT574711 HAUS8 HAUS augmin like complex subunit 8 2 3
MIRT610597 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT614445 WDR92 WD repeat domain 92 2 2
MIRT615442 FAXC failed axon connections homolog 2 2
MIRT618503 HSPD1 heat shock protein family D (Hsp60) member 1 2 2
MIRT618903 CDK9 cyclin dependent kinase 9 2 2
MIRT620083 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT620286 GLTP glycolipid transfer protein 2 2
MIRT622464 RNF11 ring finger protein 11 2 2
MIRT624644 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT624697 AQR aquarius intron-binding spliceosomal factor 2 2
MIRT625256 ZNF566 zinc finger protein 566 2 2
MIRT628258 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT628872 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT630720 FPR1 formyl peptide receptor 1 2 2
MIRT631887 SLFN13 schlafen family member 13 2 2
MIRT637716 MYOZ3 myozenin 3 2 2
MIRT639892 SSR3 signal sequence receptor subunit 3 2 2
MIRT642506 ORC6 origin recognition complex subunit 6 2 2
MIRT644723 SEPT14 septin 14 2 2
MIRT645341 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT648886 TUBGCP5 tubulin gamma complex associated protein 5 2 2
MIRT653565 SLC35B3 solute carrier family 35 member B3 2 2
MIRT656095 MTA3 metastasis associated 1 family member 3 2 2
MIRT660204 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660753 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT661379 RHCG Rh family C glycoprotein 2 2
MIRT662310 ADM2 adrenomedullin 2 2 2
MIRT662628 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT663688 ZNF347 zinc finger protein 347 2 2
MIRT665109 FKTN fukutin 2 2
MIRT665262 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT666273 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666646 RBM48 RNA binding motif protein 48 2 2
MIRT667511 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT669228 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT669271 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT671783 RGS17 regulator of G protein signaling 17 2 2
MIRT672379 RPL37 ribosomal protein L37 2 2
MIRT673464 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT673600 HPSE heparanase 2 4
MIRT676269 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT676514 RNF216 ring finger protein 216 2 2
MIRT676653 LRRC27 leucine rich repeat containing 27 2 2
MIRT677335 PHAX phosphorylated adaptor for RNA export 2 2
MIRT677523 OCIAD2 OCIA domain containing 2 2 2
MIRT677548 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677724 SSR1 signal sequence receptor subunit 1 2 2
MIRT677800 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT677885 DCP1A decapping mRNA 1A 2 2
MIRT678104 MICA MHC class I polypeptide-related sequence A 2 2
MIRT678431 PDE4C phosphodiesterase 4C 2 2
MIRT678488 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT678898 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT679296 SSBP2 single stranded DNA binding protein 2 2 2
MIRT679572 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT680003 ZNF860 zinc finger protein 860 2 2
MIRT694963 PLAC8 placenta specific 8 2 2
MIRT697861 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT698310 TMEM2 transmembrane protein 2 2 2
MIRT701712 MTMR12 myotubularin related protein 12 2 2
MIRT705964 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT714342 DIP2A disco interacting protein 2 homolog A 2 2
MIRT715309 POLR2E RNA polymerase II subunit E 2 2
MIRT717477 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT719604 PRKX protein kinase, X-linked 2 2
MIRT724483 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT726021 ZNF680 zinc finger protein 680 1 1
MIRT726041 ZNF254 zinc finger protein 254 1 1
MIRT726096 WNT5A Wnt family member 5A 1 1
MIRT726288 TMEM30A transmembrane protein 30A 1 1
MIRT726312 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT726446 SSH2 slingshot protein phosphatase 2 1 1
MIRT726486 SMEK1 protein phosphatase 4 regulatory subunit 3A 1 1
MIRT726514 SLC7A1 solute carrier family 7 member 1 1 1
MIRT726535 SLC38A2 solute carrier family 38 member 2 1 1
MIRT726657 SASS6 SAS-6 centriolar assembly protein 1 1
MIRT726778 REEP4 receptor accessory protein 4 1 1
MIRT726937 PIK3R4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT726989 PDE4B phosphodiesterase 4B 1 1
MIRT727060 NUDT19 nudix hydrolase 19 1 1
MIRT727062 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 1
MIRT727485 HSPA13 heat shock protein family A (Hsp70) member 13 1 1
MIRT727488 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT727508 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT727675 FBXO11 F-box protein 11 1 1
MIRT727780 ELAVL2 ELAV like RNA binding protein 2 1 1
MIRT727786 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT727793 EHD1 EH domain containing 1 1 1
MIRT727863 DNMBP dynamin binding protein 1 1
MIRT727903 DCTN4 dynactin subunit 4 1 1
MIRT727941 CPSF2 cleavage and polyadenylation specific factor 2 1 1
MIRT727966 COX5A cytochrome c oxidase subunit 5A 1 1
MIRT728000 CHORDC1 cysteine and histidine rich domain containing 1 3 1
MIRT728203 BID BH3 interacting domain death agonist 1 1
MIRT728213 BCL7B BCL tumor suppressor 7B 1 1
MIRT728306 ARPP19 cAMP regulated phosphoprotein 19 1 1
MIRT728331 AP1S3 adaptor related protein complex 1 sigma 3 subunit 1 1
MIRT728396 ACSL3 acyl-CoA synthetase long chain family member 3 1 1
MIRT731168 ITGA5 integrin subunit alpha 5 2 1
MIRT731390 DUSP4 dual specificity phosphatase 4 3 1
MIRT732062 NRAS NRAS proto-oncogene, GTPase 3 1
MIRT732063 E2F2 E2F transcription factor 2 3 1
MIRT732182 PTGS2 prostaglandin-endoperoxide synthase 2 6 2
MIRT732280 JAG1 jagged 1 3 1
MIRT732490 NRP1 neuropilin 1 1 0
MIRT732621 MS multiple sclerosis 1 0
MIRT733344 CREB1 cAMP responsive element binding protein 1 4 0
MIRT733365 ADIPOQ adiponectin, C1Q and collagen domain containing 1 0
MIRT733699 NORAD non-coding RNA activated by DNA damage 2 0
MIRT733700 UBE3A ubiquitin protein ligase E3A 2 0
MIRT733702 CCND1 cyclin D1 2 0
MIRT733703 TGFBR1 transforming growth factor beta receptor 1 2 0
MIRT734551 SHC4 SHC adaptor protein 4 2 0
MIRT734552 PFDN4 prefoldin subunit 4 2 0
MIRT734721 CD38 CD38 molecule 3 0
MIRT736775 MAP2 microtubule associated protein 2 2 0
MIRT736838 USP35 ubiquitin specific peptidase 35 2 0
MIRT736852 EIF2A eukaryotic translation initiation factor 2A 2 0
MIRT737078 ULK1 unc-51 like autophagy activating kinase 1 3 0
MIRT737079 SNHG6 small nucleolar RNA host gene 6 3 0
MIRT737091 ULK2 unc-51 like autophagy activating kinase 2 3 0
MIRT737491 FLI1 Fli-1 proto-oncogene, ETS transcription factor 2 0
MIRT755414 NEK6 NIMA related kinase 6 3 1
MIRT755509 ICAM1 intercellular adhesion molecule 1 1 1
MIRT755687 RUNX2 runt related transcription factor 2 3 1
MIRT755688 SPP1 secreted phosphoprotein 1 3 1
MIRT755689 ALPL alkaline phosphatase, liver/bone/kidney 3 1
MIRT756239 NEAT1 nuclear paraspeckle assembly transcript 1 (non-protein coding) 2 1
MIRT756240 FANCE Fanconi anemia complementation group E 3 1
MIRT756287 ZBTB7C zinc finger and BTB domain containing 7C 3 1
MIRT756352 PLCB1 phospholipase C beta 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-26a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-26a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-26a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-26a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-26a Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 down-regulated
miR-26a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-26a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-26a Tamoxifen approved 2733526 Quantitative real-time PCR breast cancer 22094936 2012 up-regulated
miR-26a CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
miR-26a Metformin approved 4091 Quantitative real-time PCR Pancreatic Neoplasms 22245693 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 up-regulated
miR-26a Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 up-regulated
miR-26a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-26a 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-26a Sevoflurane approved 5206 Quantitative real-time PCR lung cell 23124245 2012 down-regulated
miR-26a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-26a Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-26a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-26a Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-26a Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 up-regulated
miR-26a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-26a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-26a Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-26a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-26a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-26a Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-26a Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-26a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-26a-5p [(1R,2R,3E,7S,11E,13S,15S)-15-hydroxy-7-methyl-5-oxo-6-oxabicyclo[11.3.0]hexadeca-3,11-dien-2-yl] (2R)-2-(dimethylamino)-3-methylbutanoate;hydrochloride 45028997 NSC745103 resistant
hsa-miR-26a-5p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 sensitive
hsa-miR-26a-5p 1-[phenyl(2-pyridinyl)methylene]-4-(2-methylphenyl)thiosemicarbazide 6148953 NSC668326 sensitive
hsa-miR-26a-5p 1-cyclohexyl-3-[(e)-[phenyl(2-pyridyl)methylene]amino]urea 6179448 NSC689539 sensitive
hsa-miR-26a-5p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 resistant
hsa-miR-26a-5p 2-hydroxy-N-[(E)-1-[6-[(E)-N-[(2-hydroxybenzoyl)amino]-C-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]benzamide 5779747 NSC617573 sensitive
hsa-miR-26a-5p 2,7-dicyanoxanthone 363841 NSC629107 resistant
hsa-miR-26a-5p 3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]-1,1-bis(pyridin-2-ylmethyl)thiourea 5466413 NSC689533 sensitive
hsa-miR-26a-5p 3-imino-n-(4-methylphenyl)-5-(methylthio)-1-phenyl-2,3-dihydro-1h-pyrazole-4-carboxamide 390314 NSC687606 resistant
hsa-miR-26a-5p 3,5,12,14-tetrabutyl-7,10-dithia-8,9-diselena-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-diselone 395765 NSC700584 sensitive
hsa-miR-26a-5p 4-amino-2-(4-chloroanilino)-5-(4-methylbenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472799 NSC721554 resistant
hsa-miR-26a-5p 4-amino-8-chloro-2-(4-chlorophenyl)iminopyrimido[2,1-b][1,3]benzothiazole-3-carbonitrile 45029233 NSC745678 resistant
hsa-miR-26a-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 sensitive
hsa-miR-26a-5p 5-chloro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572096 NSC703111 sensitive
hsa-miR-26a-5p 5-fluoro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572046 NSC693634 sensitive
hsa-miR-26a-5p 5-nitro-n-[(e)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519692 NSC693620 sensitive
hsa-miR-26a-5p 7-[3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]-3h-thieno[3,4-d]pyrimidine-4-thione 3005067 NSC670036 sensitive
hsa-miR-26a-5p 9-[(2e)-2-(4-chlorophenyl)-2-hydroxyiminoethoxy]chromeno[3,4-b]chromene-6,12-dione 9572588 NSC721045 resistant
hsa-miR-26a-5p 9-acridinamine, n-(4-ethoxyphenyl)-, monohydrochloride 2788193 NSC165714 resistant
hsa-miR-26a-5p Crambescidin 800 trihydrochloride 400719 NSC713155 resistant
hsa-miR-26a-5p Crotonosid 223996 NSC12161 sensitive
hsa-miR-26a-5p Cryptophycin b 5468424 NSC670038 resistant
hsa-miR-26a-5p Laurusin 135476719 NSC106486 sensitive
hsa-miR-26a-5p N'-(2-hydroxy-5-(hydroxy(oxido)amino)benzylidene)-1-piperidinecarbothiohydrazide 135484941 NSC689530 sensitive
hsa-miR-26a-5p N-(2-hydroxy-5-methylphenyl)-4-[[[2-(trifluoromethyl)pyridin-4-yl]amino]methyl]benzamide 54613415 NSC748715 sensitive
hsa-miR-26a-5p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 sensitive
hsa-miR-26a-5p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 sensitive
hsa-miR-26a-5p N,N'-bis[5-[[5-[(3-amino-3-iminopropyl)carbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]butanediamide;hydrochloride 367397 NSC637124 resistant
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved resistant Low Lung Cancer tissue
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved resistant Low Gastric Cancer tissue
hsa-miR-26a-5p Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (KM12C)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MDA-MB-231, MCF-7, MDA-MB-435, MDA-MB-468, MCF-10A, 184A1)
hsa-miR-26a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-26a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myeloid Leukemia tissue
hsa-miR-26a-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant Low Ovarian Cancer tissue
hsa-miR-26a-5p Cetuximab resistant High Colon Cancer cell line
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-26a-5p Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-26a-5p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-26a-5p Gefitinib 123631 NSC715055 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H520, SW900, H2170, PC-9)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-26a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4)
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-26a-5p Trastuzumab sensitive Low HER2-Positive Breast Cancer cell line (BT-474, HCC1954)
hsa-miR-26a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-miR-26a-5p Docetaxel 148124 NSC628503 approved sensitive Low Lung Adenocarcinoma tissue and cell line (SPC-A1, H1299)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-26a-5p Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-miR-26a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low ER-Positive Breast Cancer cell line (MCF-7, T47D)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-26a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87MG, HEK293T)
hsa-miR-26a-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, SMMC-7721)
hsa-miR-26a-5p Dabrafenib 44462760 NSC764134 approved sensitive Low Melanoma cell line (A375 , MEL624)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Osteosarcoma cell line (U-2-OS)
hsa-miR-26a-5p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line (RPMI8226, MM.1S, H929)
hsa-miR-26a-5p Melphalan 460612 NSC8806 approved sensitive Low Multiple Myeloma cell line (RPMI8226, MM.1S, H929)
hsa-miR-26a-5p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma tissue
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-26a-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer tissue
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CP20)
hsa-miR-26a-5p Cetuximab sensitive Low Endometrial Cancer cell line (HEC-1A, RL-952)
hsa-miR-26a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-26a-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-26a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-26a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-26a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-26a-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-26a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-26a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-26a-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-26a-5p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-26a-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (200 nM)
hsa-miR-26a-5p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)
hsa-miR-26a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission