miRTarBase - #MIRT000156


—
pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol RAD52   
Synonyms -
Description RAD52 homolog, DNA repair protein
Transcript NM_134424   
Expression
Putative miRNA Targets on RAD52
3'UTR of RAD52
(miRNA target sites are highlighted)		 
>RAD52|NM_134424|3'UTR
   1 CTGAGGCTCAGGCCACATAATTGGACTCTGTCACAAAGGGACTTTGGAAAACTACTTTTTGGTCATGAAATTGTTCATCG
  81 CTGCTGGAGAATGAACGTCATTGCGATTTATCTTGCTTCATTCTGAACCTTATCAAGAGGATCTGACTGAGAGCCCACTG
 161 CAGTTAGAGCTGAGCACTTTTGAAAAGCTTGTCCATCACTCTAGTAGGGAGAGGCTCTGGACAGATGAATACCTTTTCTT
 241 CGGCTTGTGAGGCTTCCCACTATTTATTACTGAACTATTATGTTAATGAAGATGGACATTTTAGGAATCACCAATGGCTC
 321 CTTGCCCTCAAGCAATATAGGCCAGACTTGGTCCTAAGCACCTGCCTCAGCAATTGTCTACATTCAGTTGTTTTGCATAA
 401 CGTCTGCCTTCTTTCCTTTACGGTCCATGCCTTTAATGTTGCCCACATTAAGCACTGTGGATCACGACAGGAAAAAGGTT
 481 GGAGCAGTGCTTTTCACTACTTTGTATCAATCCAGGCTACAATCTTCATTTAATATAAATAATTTATGGATTTATGACAT
 561 TACAATCCTGCATTGTTTCAAGACTGACATTTTTTCCTAAGGAAGGAAATAATCATCTAAGACCACGAAAAAAGGCTGTT
 641 TTTTGTTTTTTTTTTTTTTTTTTTTTTTGAGACGGGGTCTGGCTGTGTTGCCCTGACTGGAGTTCAGTGGTGCAAACACA
 721 GCTCTCTCCACAACCTCTTGGGCCCAAGTGATACTCCCACCTCTGCCTTACAAAATACAGGGATTACTGGTGTGAGCCAC
 801 TGTGTCTGGCCAGAAAAGGCATTTTTGAGAAAGCAAATCGTATACCTTATTAACAAAATAGAATATATATATATTGCTTA
 881 TCTGAAATGCTTGAAACCAGAATTGTTTTGCATTTTTTGAATATTTGTATACACATAATGAGACCTTGGGGATGGGACCC
 961 AAGTCTGAACGTGGAATTCACCTGTGTTTCGTGTATATGCCTCATACACATAATTTTGTGCATGAAACAGAGTTTTTGTA
1041 TAAGAAGATACACTGCAGCTGAAGAGGGCTGGGTTTTTTTTTCTCTTAGGGTCGCTGCATAAACTGTTGTATGCCTGGTG
1121 CTTTGCGACTTGTCACACGAGGTCACGTGTGGAATTTTCCACTTCTGGCATCACGTCAGTGCTCAGAAATTTTCTGATCT
1201 CAGAGCATTTCAATTAGGGATGCTCAAACGCAACTGTTTCTACTTCCCCATTTCAGGTGTGAGATGTAACCCACCTTGAC
1281 CATAAATTGGCTTTTCATAGTGCTCAGATGTTTCATAATTCTTCCCCCAAAATAATGAAGTTTGCAGTTTAACAACTTTT
1361 TTTTTGAGAGGGGGGGTCTGGCTCTGTAGCGCAGGCTGGAGTGCAGCGGTGCCATCTTGACTCATTGCAGCCTCCGCCTG
1441 CCAGGATTCAAGCAATTCTCCTGCCTCAGGCTCCCGAGTAGCTGGGATTACAGACACCCACCACGACGCCCGACTAATTT
1521 TTGTATTTTTAGTAGAGGAGACGGGGTTTCTCCATGTTGGCCAGGCTGGTCTCAAACTGACCTCAAGTGATCTGCCCACC
1601 TCGGCCTCCCAAAGTAAAAAGTACTAGAATTATAGGCATGAGCCATTGCGCCCAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agucggCGAC-AGUGUGCGUguc 5'
                | || ||| |||||   
Target 5' attaggGATGCTCAAACGCAact 3'
 1213 - 1235 116.00 -11.52
2 
miRNA  3' aguCGGCGACAGUGUGCGUGUc 5'
             |||    |||:|| ||:| 
Target 5' tatGCC----TCATACACATAa 3'
 996 - 1013 109.00 -10.10
3 
miRNA  3' agUCGGCGACAGUGUGCGUGuc 5'
            || | : ||| :| ||||  
Target 5' ccAGACTTGGTCCTAAGCACct 3'
 342 - 363 108.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
127054 315 ClinVar
127053 316 ClinVar
127052 317 ClinVar
127051 318 ClinVar
127050 320 ClinVar
127049 321 ClinVar
127048 322 ClinVar
127047 324 ClinVar
127046 325 ClinVar
127045 395 ClinVar
127044 453 ClinVar
127043 468 ClinVar
127042 992 ClinVar
127041 1194 ClinVar
COSN13362106 2 COSMIC
COSN16128360 9 COSMIC
COSN26561347 13 COSMIC
COSN13362105 80 COSMIC
COSN30152932 99 COSMIC
COSN24399322 161 COSMIC
COSN27323967 312 COSMIC
COSN20109047 316 COSMIC
COSN20547565 316 COSMIC
COSN20109045 318 COSMIC
COSN27323796 318 COSMIC
COSN20092467 323 COSMIC
COSN20109041 325 COSMIC
COSN20392225 373 COSMIC
COSN20109039 397 COSMIC
COSN18750405 644 COSMIC
COSN32063050 645 COSMIC
COSN16832399 825 COSMIC
COSN28016521 864 COSMIC
COSN23160611 875 COSMIC
COSN7307400 907 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1373718155 1 dbSNP
rs1438252773 4 dbSNP
rs769544789 5 dbSNP
rs373050675 7 dbSNP
rs1181777351 10 dbSNP
rs1466290913 12 dbSNP
rs201247532 13 dbSNP
rs746551852 14 dbSNP
rs779506339 17 dbSNP
rs199848371 24 dbSNP
rs1210153941 29 dbSNP
rs745561365 40 dbSNP
rs746381070 48 dbSNP
rs1467003350 57 dbSNP
rs925465340 57 dbSNP
rs990128109 64 dbSNP
rs978256493 78 dbSNP
rs956991033 79 dbSNP
rs1394648247 80 dbSNP
rs1321981561 84 dbSNP
rs1404693214 85 dbSNP
rs1470059534 88 dbSNP
rs1164406137 89 dbSNP
rs11571473 96 dbSNP
rs1461588078 97 dbSNP
rs1421602788 99 dbSNP
rs1003548474 100 dbSNP
rs11571474 104 dbSNP
rs1051669 105 dbSNP
rs1334730446 106 dbSNP
rs1033557173 116 dbSNP
rs1285933808 119 dbSNP
rs1186644086 125 dbSNP
rs368376808 127 dbSNP
rs1006160577 130 dbSNP
rs1257899949 133 dbSNP
rs149936932 134 dbSNP
rs1458398783 139 dbSNP
rs1197840416 140 dbSNP
rs1457012336 148 dbSNP
rs951971286 151 dbSNP
rs199892983 154 dbSNP
rs1012377541 156 dbSNP
rs1255615635 162 dbSNP
rs1026134694 163 dbSNP
rs139181458 165 dbSNP
rs1164663740 167 dbSNP
rs1423821861 169 dbSNP
rs556139368 177 dbSNP
rs897224357 180 dbSNP
rs1041143277 188 dbSNP
rs574576272 191 dbSNP
rs1396131172 195 dbSNP
rs1048252087 199 dbSNP
rs929851843 200 dbSNP
rs11571475 205 dbSNP
rs900159660 219 dbSNP
rs1278596586 233 dbSNP
rs1342611681 235 dbSNP
rs1335214700 238 dbSNP
rs184456047 241 dbSNP
rs576886633 242 dbSNP
rs1201137619 244 dbSNP
rs558533945 247 dbSNP
rs925560060 248 dbSNP
rs1187942751 250 dbSNP
rs1264310747 255 dbSNP
rs1466192971 257 dbSNP
rs1039077761 259 dbSNP
rs1042529807 269 dbSNP
rs1167822372 275 dbSNP
rs368735934 289 dbSNP
rs945598258 291 dbSNP
rs1466047913 296 dbSNP
rs985160662 297 dbSNP
rs947187661 305 dbSNP
rs991924519 311 dbSNP
rs959275080 313 dbSNP
rs104895067 315 dbSNP
rs377732641 315 dbSNP
rs104895066 316 dbSNP
rs104895065 317 dbSNP
rs104895064 318 dbSNP
rs1380332402 319 dbSNP
rs377435976 319 dbSNP
rs104895063 320 dbSNP
rs104895062 321 dbSNP
rs104895061 322 dbSNP
rs1471743945 322 dbSNP
rs377181881 323 dbSNP
rs104895060 324 dbSNP
rs104895059 325 dbSNP
rs386759399 326 dbSNP
rs369055375 327 dbSNP
rs373916614 328 dbSNP
rs1271004767 331 dbSNP
rs150794273 335 dbSNP
rs1200057029 336 dbSNP
rs984480458 351 dbSNP
rs1457797148 361 dbSNP
rs924197814 370 dbSNP
rs7301931 373 dbSNP
rs12320077 378 dbSNP
rs1208602929 380 dbSNP
rs1359029582 382 dbSNP
rs1287393909 388 dbSNP
rs1285159082 390 dbSNP
rs970714875 394 dbSNP
rs104895058 395 dbSNP
rs1433397747 397 dbSNP
rs11571476 399 dbSNP
rs1392693053 401 dbSNP
rs1311730773 410 dbSNP
rs965910399 421 dbSNP
rs1159125771 422 dbSNP
rs1346923803 423 dbSNP
rs1451271317 424 dbSNP
rs1288084691 426 dbSNP
rs1368109922 428 dbSNP
rs1447657145 434 dbSNP
rs1305959914 436 dbSNP
rs1441910090 436 dbSNP
rs1393868564 437 dbSNP
rs1368814957 439 dbSNP
rs7310449 442 dbSNP
rs1008327100 448 dbSNP
rs370416248 449 dbSNP
rs104895057 453 dbSNP
rs1214353318 457 dbSNP
rs1260505490 458 dbSNP
rs552243998 464 dbSNP
rs1392724527 465 dbSNP
rs1215149117 466 dbSNP
rs104895056 468 dbSNP
rs1453223272 469 dbSNP
rs1438847570 471 dbSNP
rs1409998176 473 dbSNP
rs530460752 476 dbSNP
rs1158382224 488 dbSNP
rs1378141305 489 dbSNP
rs563275074 490 dbSNP
rs1462839504 491 dbSNP
rs994015971 494 dbSNP
rs897028108 501 dbSNP
rs1392562368 513 dbSNP
rs1440191244 520 dbSNP
rs1439873697 522 dbSNP
rs12319965 524 dbSNP
rs1375707497 532 dbSNP
rs1222538858 534 dbSNP
rs1306980517 539 dbSNP
rs1040939583 540 dbSNP
rs1335845330 543 dbSNP
rs1008124588 544 dbSNP
rs1235562008 545 dbSNP
rs1270804941 562 dbSNP
rs55853926 563 dbSNP
rs757512422 565 dbSNP
rs751751046 572 dbSNP
rs1049400090 574 dbSNP
rs947102782 575 dbSNP
rs1234111504 585 dbSNP
rs904103998 586 dbSNP
rs1176503870 588 dbSNP
rs1418527532 590 dbSNP
rs1476028155 590 dbSNP
rs11571477 595 dbSNP
rs945496379 596 dbSNP
rs1216425618 609 dbSNP
rs1329845065 610 dbSNP
rs1356339027 618 dbSNP
rs1440136186 619 dbSNP
rs1351917122 621 dbSNP
rs918110075 624 dbSNP
rs114479395 626 dbSNP
rs935505798 627 dbSNP
rs937757918 629 dbSNP
rs1305215590 632 dbSNP
rs1273170625 633 dbSNP
rs1438690325 635 dbSNP
rs1332830907 636 dbSNP
rs924145294 638 dbSNP
rs982342693 639 dbSNP
rs1256506768 640 dbSNP
rs1475648899 641 dbSNP
rs970996307 641 dbSNP
rs1418921860 642 dbSNP
rs1358415489 643 dbSNP
rs916555792 643 dbSNP
rs1160193791 644 dbSNP
rs990853165 644 dbSNP
rs11571478 645 dbSNP
rs1311635804 645 dbSNP
rs1408208661 645 dbSNP
rs60815165 645 dbSNP
rs1419933391 646 dbSNP
rs952865887 646 dbSNP
rs1027077188 647 dbSNP
rs1423957172 647 dbSNP
rs878883128 648 dbSNP
rs994692771 648 dbSNP
rs1195061626 649 dbSNP
rs1208616468 649 dbSNP
rs796821152 649 dbSNP
rs1019436551 650 dbSNP
rs1188238663 650 dbSNP
rs148165100 650 dbSNP
rs869304972 650 dbSNP
rs1008072329 651 dbSNP
rs1395732263 651 dbSNP
rs984449344 651 dbSNP
rs1343871824 652 dbSNP
rs1401591100 652 dbSNP
rs540780898 652 dbSNP
rs1372483466 653 dbSNP
rs1429559049 653 dbSNP
rs867595271 653 dbSNP
rs1011250516 654 dbSNP
rs1231485203 654 dbSNP
rs1351322691 655 dbSNP
rs892828337 655 dbSNP
rs1052870335 656 dbSNP
rs1478720746 656 dbSNP
rs1208319747 657 dbSNP
rs1455592170 657 dbSNP
rs934428392 657 dbSNP
rs1191844516 658 dbSNP
rs902670053 658 dbSNP
rs1305538483 659 dbSNP
rs1247840190 660 dbSNP
rs1406214877 662 dbSNP
rs1193543149 663 dbSNP
rs1457069255 667 dbSNP
rs1277752066 669 dbSNP
rs1324614893 669 dbSNP
rs1326123717 669 dbSNP
rs1335900909 669 dbSNP
rs1396222887 669 dbSNP
rs1408503475 669 dbSNP
rs1438003141 669 dbSNP
rs1438517792 669 dbSNP
rs1452561760 669 dbSNP
rs1491514066 669 dbSNP
rs576306948 669 dbSNP
rs60090525 669 dbSNP
rs71441626 669 dbSNP
rs1294899300 670 dbSNP
rs1326724519 670 dbSNP
rs1349811434 670 dbSNP
rs1392647479 670 dbSNP
rs1396562142 670 dbSNP
rs1491505368 670 dbSNP
rs80274688 670 dbSNP
rs1332463553 671 dbSNP
rs141002865 671 dbSNP
rs1487573692 672 dbSNP
rs1265105440 673 dbSNP
rs1340104538 673 dbSNP
rs1265804989 674 dbSNP
rs972026790 688 dbSNP
rs1483009723 691 dbSNP
rs1189357984 693 dbSNP
rs1046614521 697 dbSNP
rs966244860 699 dbSNP
rs1217735577 707 dbSNP
rs1186341738 714 dbSNP
rs576626573 715 dbSNP
rs1463013873 718 dbSNP
rs1165636975 721 dbSNP
rs949591112 724 dbSNP
rs1369470864 736 dbSNP
rs11226 744 dbSNP
rs141377306 746 dbSNP
rs1345781861 759 dbSNP
rs576386310 760 dbSNP
rs1277591413 764 dbSNP
rs1399360980 770 dbSNP
rs554921390 778 dbSNP
rs758411666 782 dbSNP
rs1299819971 790 dbSNP
rs1431180521 796 dbSNP
rs1312191831 802 dbSNP
rs954123889 804 dbSNP
rs1229969683 808 dbSNP
rs1341598808 809 dbSNP
rs1358282968 809 dbSNP
rs919946680 818 dbSNP
rs61626161 829 dbSNP
rs1000786263 833 dbSNP
rs903866119 839 dbSNP
rs972831057 840 dbSNP
rs1169264877 848 dbSNP
rs1190628669 853 dbSNP
rs58411315 861 dbSNP
rs9282536 862 dbSNP
rs200735679 863 dbSNP
rs201986845 864 dbSNP
rs61409471 864 dbSNP
rs71896741 864 dbSNP
rs869067686 864 dbSNP
rs1426397326 865 dbSNP
rs1384108243 866 dbSNP
rs1386957459 866 dbSNP
rs749983756 866 dbSNP
rs1194934621 867 dbSNP
rs767124540 867 dbSNP
rs1483111528 868 dbSNP
rs961456887 869 dbSNP
rs10687302 873 dbSNP
rs11571481 875 dbSNP
rs67148032 875 dbSNP
rs753088800 875 dbSNP
rs1009835203 877 dbSNP
rs896754687 880 dbSNP
rs549797993 883 dbSNP
rs1019384766 892 dbSNP
rs986599576 893 dbSNP
rs938195642 898 dbSNP
rs549961855 899 dbSNP
rs1216810628 908 dbSNP
rs1247063281 910 dbSNP
rs1468482666 911 dbSNP
rs570726689 919 dbSNP
rs536557889 923 dbSNP
rs1280008093 924 dbSNP
rs1048845932 928 dbSNP
rs1028233963 932 dbSNP
rs1378139429 938 dbSNP
rs879180495 940 dbSNP
rs1159800592 944 dbSNP
rs138812304 946 dbSNP
rs918940606 951 dbSNP
rs1031781802 954 dbSNP
rs867455899 955 dbSNP
rs1318741534 963 dbSNP
rs906968757 970 dbSNP
rs746591120 971 dbSNP
rs1406287705 976 dbSNP
rs760441071 982 dbSNP
rs1365632215 984 dbSNP
rs554407947 985 dbSNP
rs1463604711 988 dbSNP
rs1403139012 991 dbSNP
rs104895055 992 dbSNP
rs1423692774 996 dbSNP
rs972171367 997 dbSNP
rs1183894806 998 dbSNP
rs1051672 1000 dbSNP
rs911834605 1001 dbSNP
rs1051673 1006 dbSNP
rs559807144 1006 dbSNP
rs1055376740 1010 dbSNP
rs570397963 1012 dbSNP
rs1196899562 1016 dbSNP
rs931587617 1020 dbSNP
rs530718506 1028 dbSNP
rs370744293 1030 dbSNP
rs1028323506 1033 dbSNP
rs979504309 1033 dbSNP
rs767332955 1035 dbSNP
rs11571483 1040 dbSNP
rs7963551 1042 dbSNP
rs896727660 1046 dbSNP
rs1229809914 1048 dbSNP
rs1299175140 1049 dbSNP
rs1376179725 1050 dbSNP
rs1383162097 1051 dbSNP
rs1335974533 1056 dbSNP
rs1308038383 1064 dbSNP
rs1287331605 1072 dbSNP
rs1320553945 1073 dbSNP
rs1204615253 1074 dbSNP
rs940071201 1079 dbSNP
rs912654521 1081 dbSNP
rs1002335408 1083 dbSNP
rs1035689620 1083 dbSNP
rs11381919 1083 dbSNP
rs986881254 1083 dbSNP
rs530602582 1089 dbSNP
rs569568666 1090 dbSNP
rs1404778067 1093 dbSNP
rs11571486 1094 dbSNP
rs1401873763 1095 dbSNP
rs1298213645 1096 dbSNP
rs1356418356 1099 dbSNP
rs1428351190 1100 dbSNP
rs1457846466 1105 dbSNP
rs1308019128 1106 dbSNP
rs1356451570 1108 dbSNP
rs930369445 1109 dbSNP
rs866946266 1110 dbSNP
rs897596237 1112 dbSNP
rs1028597527 1117 dbSNP
rs990069597 1126 dbSNP
rs188100141 1127 dbSNP
rs1031311560 1138 dbSNP
rs944402094 1139 dbSNP
rs911777565 1146 dbSNP
rs1290461060 1147 dbSNP
rs754282544 1153 dbSNP
rs142826878 1156 dbSNP
rs998522179 1160 dbSNP
rs369116905 1162 dbSNP
rs34381282 1165 dbSNP
rs1441718891 1166 dbSNP
rs879340046 1166 dbSNP
rs540918130 1174 dbSNP
rs11571487 1175 dbSNP
rs1012708752 1177 dbSNP
rs565068619 1179 dbSNP
rs1392081329 1180 dbSNP
rs1447760550 1181 dbSNP
rs1168467468 1182 dbSNP
rs1190632272 1183 dbSNP
rs931792241 1184 dbSNP
rs1332595976 1186 dbSNP
rs1359015790 1191 dbSNP
rs104895054 1194 dbSNP
rs762441097 1200 dbSNP
rs1488152077 1204 dbSNP
rs968102091 1213 dbSNP
rs1205327397 1215 dbSNP
rs1303989056 1217 dbSNP
rs776038607 1218 dbSNP
rs895305463 1220 dbSNP
rs1217468398 1221 dbSNP
rs1277612456 1225 dbSNP
rs143743662 1229 dbSNP
rs960994638 1230 dbSNP
rs1035256732 1234 dbSNP
rs1188023062 1242 dbSNP
rs11571488 1243 dbSNP
rs372457649 1244 dbSNP
rs1395834149 1245 dbSNP
rs1359859180 1251 dbSNP
rs898748310 1256 dbSNP
rs1284986719 1261 dbSNP
rs1424839423 1266 dbSNP
rs1401682784 1269 dbSNP
rs1322058203 1271 dbSNP
rs1386012232 1272 dbSNP
rs576446535 1287 dbSNP
rs1237549859 1297 dbSNP
rs1433976508 1302 dbSNP
rs1372585916 1303 dbSNP
rs1434179161 1307 dbSNP
rs1274210431 1312 dbSNP
rs1002471322 1321 dbSNP
rs1225265140 1324 dbSNP
rs969659320 1326 dbSNP
rs1037000900 1331 dbSNP
rs1307101260 1333 dbSNP
rs1027809168 1336 dbSNP
rs1385721217 1336 dbSNP
rs77760797 1338 dbSNP
rs554673472 1339 dbSNP
rs200396534 1341 dbSNP
rs1246640870 1346 dbSNP
rs940017108 1352 dbSNP
rs1161805167 1353 dbSNP
rs897563288 1360 dbSNP
rs202071770 1366 dbSNP
rs542992891 1366 dbSNP
rs912603695 1367 dbSNP
rs1392202644 1368 dbSNP
rs572466222 1368 dbSNP
rs56131726 1369 dbSNP
rs757088988 1369 dbSNP
rs1286223823 1370 dbSNP
rs1444365661 1370 dbSNP
rs200952154 1370 dbSNP
rs1050276880 1371 dbSNP
rs931887343 1373 dbSNP
rs1051110898 1375 dbSNP
rs925895938 1375 dbSNP
rs1185020152 1376 dbSNP
rs373924988 1376 dbSNP
rs1455885386 1377 dbSNP
rs1491559873 1377 dbSNP
rs59676475 1377 dbSNP
rs796245537 1377 dbSNP
rs1162116978 1379 dbSNP
rs1042863590 1390 dbSNP
rs1431483134 1391 dbSNP
rs1431519049 1392 dbSNP
rs932766634 1393 dbSNP
rs1306160018 1396 dbSNP
rs1369666082 1397 dbSNP
rs10849584 1398 dbSNP
rs1313634797 1400 dbSNP
rs1201533873 1402 dbSNP
rs182527470 1407 dbSNP
rs1262209829 1408 dbSNP
rs1340207305 1417 dbSNP
rs988648076 1417 dbSNP
rs990407492 1421 dbSNP
rs1212066909 1425 dbSNP
rs960709931 1425 dbSNP
rs556686716 1429 dbSNP
rs957270867 1434 dbSNP
rs924529668 1435 dbSNP
rs977367021 1436 dbSNP
rs971047210 1438 dbSNP
rs1023998763 1442 dbSNP
rs927940723 1443 dbSNP
rs191960190 1444 dbSNP
rs1012644334 1445 dbSNP
rs958719848 1448 dbSNP
rs148976270 1450 dbSNP
rs1333778981 1451 dbSNP
rs547977843 1460 dbSNP
rs771434357 1462 dbSNP
rs1014654872 1463 dbSNP
rs1402242641 1465 dbSNP
rs747186930 1466 dbSNP
rs1009077211 1470 dbSNP
rs1258102866 1473 dbSNP
rs890240607 1475 dbSNP
rs1464690999 1476 dbSNP
rs1199480158 1491 dbSNP
rs1262032948 1493 dbSNP
rs1004446271 1497 dbSNP
rs1465813770 1497 dbSNP
rs1379479242 1504 dbSNP
rs187426246 1505 dbSNP
rs565323194 1507 dbSNP
rs182998747 1508 dbSNP
rs921350945 1511 dbSNP
rs1042956833 1512 dbSNP
rs532245228 1514 dbSNP
rs145032067 1519 dbSNP
rs57038565 1519 dbSNP
rs11571490 1520 dbSNP
rs397758443 1520 dbSNP
rs935822100 1523 dbSNP
rs1387838202 1524 dbSNP
rs574121520 1525 dbSNP
rs1310769015 1532 dbSNP
rs977316563 1535 dbSNP
rs1269224242 1536 dbSNP
rs1056991821 1539 dbSNP
rs375827145 1542 dbSNP
rs916896404 1543 dbSNP
rs1276825211 1544 dbSNP
rs1468552392 1544 dbSNP
rs1443786687 1545 dbSNP
rs779936659 1546 dbSNP
rs1432329316 1547 dbSNP
rs1159550791 1548 dbSNP
rs980763104 1552 dbSNP
rs1327412372 1555 dbSNP
rs1157280006 1569 dbSNP
rs1387937354 1574 dbSNP
rs1333156066 1582 dbSNP
rs61917172 1586 dbSNP
rs1295734921 1588 dbSNP
rs1394516123 1589 dbSNP
rs1386771729 1590 dbSNP
rs1027809738 1597 dbSNP
rs529021936 1602 dbSNP
rs750384537 1603 dbSNP
rs1015745206 1607 dbSNP
rs1321721103 1614 dbSNP
rs1223150731 1615 dbSNP
rs1263231741 1618 dbSNP
rs1337536511 1619 dbSNP
rs1465163410 1620 dbSNP
rs962208984 1621 dbSNP
rs1253678403 1622 dbSNP
rs1399511387 1622 dbSNP
rs1168420366 1624 dbSNP
rs1180241592 1627 dbSNP
rs1411515646 1632 dbSNP
rs1015494446 1633 dbSNP
rs1166993287 1638 dbSNP
rs531713603 1642 dbSNP
rs1476321591 1646 dbSNP
rs762690566 1649 dbSNP
rs757009451 1650 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa , MCF-7
Disease MIMAT0000267;
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... "MiR-210 and miR-373 regulate the DNA repair genes RAD52 and RAD23B.//We find that miR-210 targets RAD52 ...

- Crosby ME; Kulshreshtha R; Ivan M; Glazer PM, 2009, Cancer research.

Article - Crosby ME; Kulshreshtha R; Ivan M; Glazer PM
- Cancer research, 2009
Genetic instability is a hallmark of cancer; the hypoxic tumor microenvironment has been implicated as a cause of this phenomenon. MicroRNAs (miR) are small nonprotein coding RNAs that can regulate various cellular pathways. We report here that two miRs, miR-210 and miR-373, are up-regulated in a hypoxia-inducible factor-1alpha-dependent manner in hypoxic cells. Bioinformatics analyses suggested that these miRs could regulate factors implicated in DNA repair pathways. Forced expression of miR-210 was found to suppress the levels of RAD52, which is a key factor in homology-dependent repair (HDR); the forced expression of miR-373 led to a reduction in the nucleotide excision repair (NER) protein, RAD23B, as well as in RAD52. Consistent with these results, both RAD52 and RAD23B were found to be down-regulated in hypoxia, but in both cases, the hypoxia-induced down-regulation could be partially reversed by antisense inhibition of miR-210 and miR-373. Importantly, luciferase reporter assays indicated that miR-210 is capable of interacting with the 3' untranslated region (UTR) of RAD52 and that miR-373 can act on the 3' UTR of RAD23B. These results indicate that hypoxia-inducible miR-210 and miR-373 play roles in modulating the expression levels of key proteins involved in the HDR and NER pathways, providing new mechanistic insight into the effect of hypoxia on DNA repair and genetic instability in cancer.
LinkOut: [PMID: 19141645]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293 , HUVEC , MCF7
Location of target site 3'UTR
Tools used in this research Literature survey
Original Description (Extracted from the article) ... "EFNA3 ...

- Fasanaro P; Greco S; Lorenzi M; Pescatori et al., 2009, The Journal of biological chemistry.

Article - Fasanaro P; Greco S; Lorenzi M; Pescatori et al.
- The Journal of biological chemistry, 2009
miR-210 is a key player of cell response to hypoxia, modulating cell survival, VEGF-driven endothelial cell migration, and the ability of endothelial cells to form capillary-like structures. A crucial step in understanding microRNA (miRNA) function is the identification of their targets. However, only few miR-210 targets have been identified to date. Here, we describe an integrated strategy for large-scale identification of new miR-210 targets by combining transcriptomics and proteomics with bioinformatic approaches. To experimentally validate candidate targets, the RNA-induced silencing complex (RISC) loaded with miR-210 was purified by immunoprecipitation along with its mRNA targets. The complex was significantly enriched in mRNAs of 31 candidate targets, such as BDNF, GPD1L, ISCU, NCAM, and the non-coding RNA Xist. A subset of the newly identified targets was further confirmed by 3'-untranslated region (UTR) reporter assays, and hypoxia induced down-modulation of their expression was rescued blocking miR-210, providing support for the approach validity. In the case of 9 targets, such as PTPN1 and P4HB, miR-210 seed-pairing sequences localized in the coding sequence or in the 5'-UTR, in line with recent data extending miRNA targeting beyond the "classic" 3'-UTR recognition. Finally, Gene Ontology analysis of the targets highlights known miR-210 impact on cell cycle regulation and differentiation, and predicts a new role of this miRNA in RNA processing, DNA binding, development, membrane trafficking, and amino acid catabolism. Given the complexity of miRNA actions, we view such a multiprong approach as useful to adequately describe the multiple pathways regulated by miR-210 during physiopathological processes.
LinkOut: [PMID: 19826008]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Devlin C; Greco S; Martelli F; Ivan M
- IUBMB life, 2011
Multiple studies have consistently established that miR (microRNA)-210 induction is a feature of the hypoxic response in both normal and transformed cells. Here, we discuss the emerging biochemical functions of this miRNA and anticipate potential clinical applications. miR-210 is a robust target of hypoxia-inducible factor, and its overexpression has been detected in a variety of cardiovascular diseases and solid tumors. High levels of miR-210 have been linked to an in vivo hypoxic signature and associated with adverse prognosis in cancer patients. A wide spectrum of miR-210 targets have been identified, with roles in mitochondrial metabolism, angiogenesis, DNA repair, and cell survival. Such targets may broadly affect the evolution of tumors and other pathological settings, such as ischemic disorders. Harnessing the knowledge of miR-210's actions may lead to novel diagnostic and therapeutic approaches.
LinkOut: [PMID: 21360638]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.296 0.01 0.207 0.06 59 Click to see details
BLCA -0.437 0.03 -0.498 0.02 18 Click to see details
STAD -0.323 0.04 -0.286 0.06 32 Click to see details
KIRC 0.22 0.04 0.286 0.01 68 Click to see details
CESC -0.986 0.05 -1.000 0.5 3 Click to see details
LUSC 0.204 0.11 0.281 0.04 38 Click to see details
KICH 0.247 0.12 0.175 0.2 25 Click to see details
UCEC 0.236 0.17 0.230 0.17 19 Click to see details
PAAD 0.626 0.19 0.400 0.3 4 Click to see details
HNSC -0.101 0.26 -0.138 0.19 42 Click to see details
CHOL -0.189 0.31 -0.133 0.37 9 Click to see details
LIHC 0.069 0.32 0.102 0.24 49 Click to see details
ESCA -0.136 0.35 -0.145 0.34 11 Click to see details
COAD -0.151 0.36 -0.476 0.12 8 Click to see details
PRAD 0.042 0.39 0.107 0.23 50 Click to see details
KIRP 0.028 0.44 0.102 0.29 32 Click to see details
PCPG -0.166 0.45 0.500 0.33 3 Click to see details
LUAD 0.041 0.45 0.007 0.49 12 Click to see details
BRCA 0.004 0.49 -0.047 0.34 84 Click to see details
BRCA 0.004 0.49 -0.047 0.34 84 Click to see details
BRCA 0.004 0.49 -0.047 0.34 84 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission