>TCEAL1|NM_001006639|3'UTR
   1 TGTGTTCGGCCTTTAATTCTGTTTTGCCTGCTAATAGTATTGCCATTGCCACCTGGACTTTCTGTTTGCATTTTCTTAAT
  81 GCCTTTTCCCATATTCTGAATTTTAACTTTTTGTGAGGCTTTATTTTAGATGTTTAGCATGTAACTCGCTTAAAGTTGAG
 161 GTTTCCCCCTAAAATCTACAAGTTTCCCTCTTTCAGTCATGAGCCCTACACATTTGCATGAAAGATGTACATTATATATT
 241 GTGAAACGAAAAAAGCAATTTTCAAATGGTATATATTGTATCCCATTTTTGTAAAAAAAATGTATATTTATATATTAATA
 321 TGCAAAGAAAAAGCTAAAAGTATAGACTTCAAAGGCATAACAGTGGTTGTGTGGTAAGATAATAGGTGATTTTTTAAATT
 401 TTTGTTTTATCTGAATTTCTCATTTTTTCAGGACAAACGTTTTACTTGTGTTGCAAAAATATATAATGAAAAAATCACAC
 481 AATTTTGAAGAAAACTGTCAATCAGCTTATAACGACAATGTGGCACTTAATAAATACTTGTCAGAACTTTAAAAAAAAAA
 561 AAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaUGGACGU----GAUAUUCGUGAAAu 5' ||||| | ||:| |||:||| Target 5' ccACCTGGACTTTCTGTTTGCATTTTc 3'	49 - 75	147.00	-14.80
2	miRNA 3' gaUGGACGUGAUAUUCGUGAAau 5' | | || |:| :|||||| Target 5' atAACGACAATGT-GGCACTTaa 3'	509 - 530	132.00	-7.70
3	miRNA 3' gauggacgugaUAUUCGUGAAAu 5' | ||||| ||| Target 5' tgtgaaacgaaAAAAGCAATTTt 3'	240 - 262	120.00	-5.10

Mutant ID	Mutant Position	Mutant Source
rs1474367727	3	dbSNP
rs1281708245	4	dbSNP
rs1486912490	5	dbSNP
rs1202541825	8	dbSNP
rs192613410	9	dbSNP
rs1485034742	10	dbSNP
rs1481120612	12	dbSNP
rs753432409	15	dbSNP
rs754781799	17	dbSNP
rs1381993212	20	dbSNP
rs368676927	28	dbSNP
rs1172738481	38	dbSNP
rs1458815075	64	dbSNP
rs936883591	82	dbSNP
rs987825541	86	dbSNP
rs913533876	101	dbSNP
rs1327399432	118	dbSNP
rs756887171	137	dbSNP
rs1286422829	140	dbSNP
rs1415512215	148	dbSNP
rs949176454	166	dbSNP
rs1311350852	168	dbSNP
rs971638061	187	dbSNP
rs1445631317	188	dbSNP
rs1309564413	204	dbSNP
rs1046166664	205	dbSNP
rs764932514	238	dbSNP
rs1375017890	248	dbSNP
rs905056124	256	dbSNP
rs1415563057	270	dbSNP
rs1183985463	271	dbSNP
rs1311678597	277	dbSNP
rs977246972	292	dbSNP
rs113787890	293	dbSNP
rs1233870040	293	dbSNP
rs750079859	293	dbSNP
rs758701849	299	dbSNP
rs1436394665	300	dbSNP
rs1223671632	301	dbSNP
rs1234421612	301	dbSNP
rs76325304	301	dbSNP
rs78717942	302	dbSNP
rs1334343498	303	dbSNP
rs957250291	304	dbSNP
rs1291475488	305	dbSNP
rs1275171884	311	dbSNP
rs1374356024	321	dbSNP
rs12689903	326	dbSNP
rs1351348359	328	dbSNP
rs755549355	328	dbSNP
rs1326565740	334	dbSNP
rs1048380986	340	dbSNP
rs35790941	344	dbSNP
rs12689905	345	dbSNP
rs12689938	346	dbSNP
rs15098	348	dbSNP
rs1406835218	351	dbSNP
rs1175053177	356	dbSNP
rs1180492071	358	dbSNP
rs1413510052	396	dbSNP
rs1248812639	397	dbSNP
rs185604237	400	dbSNP
rs932452803	408	dbSNP
rs986954070	413	dbSNP
rs1210706094	414	dbSNP
rs1398678571	420	dbSNP
rs1004502622	423	dbSNP
rs762768691	435	dbSNP
rs1331350359	436	dbSNP
rs780000937	439	dbSNP
rs1014937663	440	dbSNP
rs1302119375	441	dbSNP
rs1440144429	448	dbSNP
rs1392235522	457	dbSNP
rs940192191	462	dbSNP
rs753721552	464	dbSNP
rs1379589457	469	dbSNP
rs773504200	476	dbSNP
rs1156573588	488	dbSNP
rs749537802	496	dbSNP
rs1415786495	512	dbSNP
rs189393268	513	dbSNP
rs997578365	519	dbSNP
rs1251686167	536	dbSNP
rs1190996670	546	dbSNP
rs181683905	550	dbSNP
rs755027145	553	dbSNP
rs1258723757	557	dbSNP

- Blood, 2009

Aberrant overexpression of the miR-17-92 polycistron is strongly associated with B-cell lymphomagenesis. Recent studies have shown that miR-17-92 down-regulates the proapoptotic protein Bim, leading to overexpression of Bcl2, which likely plays a key role in lymphomagenesis. However, the fact that Jeko-1 cells derived from mantle cell lymphoma exhibit both homozygous deletion of BIM and overexpression of miR-17-92 suggests other targets are also involved in B-cell lymphomagenesis. To identify essential target(s) of miR-17-92 in lymphomagenesis, we first transfected miR-17-92 into 2 genetically distinct B-cell lymphoma cell lines: Raji, which overexpress c-Myc, and SUDHL4, which overexpress Bcl2. Raji transfected with miR-17-19b-1 exhibited down-regulated expression of Bim and a slight up-regulation in Bcl2 expression. On the other hand, SUDHL4 transfectants showed aggressive cell growth reflecting facilitated cell cycle progression at the G(1) to S transition and decreased expression of CDKN1A mRNA and p21 protein (CDKN1A/p21) that was independent of p53 expression. Conversely, transfection of antisense oligonucleotides against miR-17 and miR-20a into Jeko-1 led to up-regulation of CDKN1A/p21, resulting in decreased cell growth with G(1) to S arrest. Thus, CDKN1A/p21 appears to be an essential target of miR-17-92 during B-cell lymphomagenesis, which suggests the miR-17-92 polycistron has distinct targets in different B-cell lymphoma subtypes.

- Cell death and differentiation, 2013

Hypoxia-inducible factor 1 (HIF-1) is a crucial transcription factor for the cellular adaptive response to hypoxia, which contributes to multiple events in cancer biology. MicroRNAs (miRNAs) are involved in almost all cellular activities such as differentiation, proliferation, and apoptosis. In this work, we use miRNA microarrays to profile miRNA expression in acute myeloid leukemia (AML) cells with inducible HIF-1alpha expression, and identify 19 differentially expressed miRNAs. Our study shows that HIF-1alpha represses the expression of miR-17 and miR-20a by downregulating c-Myc expression. These two miRNAs alleviate hypoxia and HIF-1alpha-induced differentiation of AML cells. More intriguingly, miR-17 and miR-20a directly inhibit the p21 and STAT3 (signal transducer and activator of transcription 3) expression, both of which can reverse miR-17/miR-20a-mediated abrogation of HIF-1alpha-induced differentiation. Moreover, we show in vivo that miR-20a contributes to HIF-1alpha-induced differentiation of leukemic cells. Taken together, our results suggest that HIF-1alpha regulates the miRNA network to interfere with AML cell differentiation, representing a novel molecular mechanism for HIF-1-mediated anti-leukemic action.