miRTarBase - #MIRT000218


—
pre-miRNA Information
pre-miRNA hsa-mir-196a-1   
Genomic Coordinates chr17: 48632490 - 48632559
Synonyms MIRN196-1, MIRN196A1, MIR196A1
Description Homo sapiens miR-196a-1 stem-loop
Comment Lagos-Quintana et al. .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-196a-2   
Genomic Coordinates chr12: 53991738 - 53991847
Synonyms MIRN196-2, MIRN196A2, MIR196A2
Description Homo sapiens miR-196a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-196a-5p
Sequence 25| UAGGUAGUUUCAUGUUGUUGGG |46
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 6 17 - 48632548 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30188818 11 COSMIC
COSN30130427 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1449318187 1 dbSNP
rs1167097656 4 dbSNP
rs767877229 4 dbSNP
rs750731061 10 dbSNP
rs756640169 12 dbSNP
rs931027203 13 dbSNP
rs185070757 13 dbSNP
rs569910454 16 dbSNP
rs190478598 17 dbSNP
rs755062780 17 dbSNP
rs751887895 18 dbSNP
rs1422312414 20 dbSNP
rs372978481 21 dbSNP
rs1289240119 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BMP4   
Synonyms BMP2B, BMP2B1, MCOPS6, OFC11, ZYME
Description bone morphogenetic protein 4
Transcript NM_001202   
Other Transcripts NM_130850 , NM_130851   
Expression
Putative miRNA Targets on BMP4
3'UTR of BMP4
(miRNA target sites are highlighted)		 
>BMP4|NM_001202|3'UTR
   1 GATCAGGCAGTCCTTGAGGATAGACAGATATACACACCACACACACACACCACATACACCACACACACACGTTCCCATCC
  81 ACTCACCCACACACTACACAGACTGCTTCCTTATAGCTGGACTTTTATTTAAAAAAAAAAAAAAAAAAGGAAAAAATCCC
 161 TAAACATTCACCTTGACCTTATTTATGACTTTACGTGCAAATGTTTTGACCATATTGATCATATATTTTGACAAAATATA
 241 TTTATAACTACGTATTAAAAGAAAAAAATAAAATGAGTCATTATTTTAAAGGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggGU-UGUUGUACUUUGAUGGAu 5'
            || || |||  |:|||:|:| 
Target 5' caCACACTACA-CAGACTGCTTc 3'
 88 - 109 127.00 -8.60
2 
miRNA  3' ggGUUGU-UGU-ACU-UUGAUGGAu 5'
            ||| | |:| | | |||||| | 
Target 5' gaCAAAATATATTTATAACTACGTa 3'
 230 - 254 124.00 -8.40
3 
miRNA  3' gggUUGUUGUACUU--UGAUGGAu 5'
             ||:|| ||||:  |:||::| 
Target 5' aaaAATAAAATGAGTCATTATTTt 3'
 264 - 287 121.00 -7.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
881588 28 ClinVar
881587 31 ClinVar
313350 35 ClinVar
313349 88 ClinVar
313348 131 ClinVar
313347 143 ClinVar
313346 148 ClinVar
1189262 149 ClinVar
313339 149 ClinVar
313341 149 ClinVar
313342 149 ClinVar
313343 149 ClinVar
313344 149 ClinVar
313345 149 ClinVar
313338 150 ClinVar
313340 150 ClinVar
313337 151 ClinVar
313336 251 ClinVar
883475 254 ClinVar
313335 272 ClinVar
COSN30188988 4 COSMIC
COSN26726235 16 COSMIC
COSN30040428 25 COSMIC
COSN30144599 31 COSMIC
COSN26967919 51 COSMIC
COSN30144830 55 COSMIC
COSN30136330 101 COSMIC
COSN6253810 122 COSMIC
COSN20078181 127 COSMIC
COSN6411862 130 COSMIC
COSN31594870 134 COSMIC
COSN31597115 145 COSMIC
COSN31545168 146 COSMIC
COSN19335809 147 COSMIC
COSN7021582 147 COSMIC
COSN15565142 148 COSMIC
COSN20111296 148 COSMIC
COSN18775328 149 COSMIC
COSN6637747 185 COSMIC
COSN21015876 193 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1297739595 7 dbSNP
rs1301532568 8 dbSNP
rs1232918247 13 dbSNP
rs1368403134 19 dbSNP
rs1345569984 22 dbSNP
rs200593196 26 dbSNP
rs185647938 28 dbSNP
rs374037026 31 dbSNP
rs886050540 35 dbSNP
rs1292384041 38 dbSNP
rs1326557007 43 dbSNP
rs759156963 46 dbSNP
rs773711120 49 dbSNP
rs756379131 51 dbSNP
rs778177706 51 dbSNP
rs1029166517 55 dbSNP
rs1394521191 56 dbSNP
rs545335907 61 dbSNP
rs1438269222 63 dbSNP
rs1195841961 66 dbSNP
rs990106703 70 dbSNP
rs1477954147 71 dbSNP
rs954247081 71 dbSNP
rs958329429 71 dbSNP
rs1399510931 73 dbSNP
rs1031397261 83 dbSNP
rs74054236 88 dbSNP
rs996100106 93 dbSNP
rs1399043788 96 dbSNP
rs1444335412 99 dbSNP
rs1327603221 101 dbSNP
rs1331617274 105 dbSNP
rs1232523924 113 dbSNP
rs562935859 113 dbSNP
rs1385822230 115 dbSNP
rs1341620207 127 dbSNP
rs61983162 128 dbSNP
rs1442596528 129 dbSNP
rs1424516316 130 dbSNP
rs76149166 131 dbSNP
rs1456569615 141 dbSNP
rs750395429 143 dbSNP
rs1436863109 144 dbSNP
rs1270371112 145 dbSNP
rs76335800 148 dbSNP
rs1375259361 149 dbSNP
rs1421383711 149 dbSNP
rs1491520594 149 dbSNP
rs74495140 149 dbSNP
rs796563569 149 dbSNP
rs869100801 149 dbSNP
rs869207844 149 dbSNP
rs878865302 149 dbSNP
rs1266241899 150 dbSNP
rs140085940 150 dbSNP
rs766600280 150 dbSNP
rs886050539 150 dbSNP
rs1356144562 151 dbSNP
rs878985651 151 dbSNP
rs1264508754 156 dbSNP
rs1036554906 157 dbSNP
rs1162300840 161 dbSNP
rs1193762750 162 dbSNP
rs142822714 189 dbSNP
rs894260389 194 dbSNP
rs895504337 195 dbSNP
rs555861118 211 dbSNP
rs1280510628 213 dbSNP
rs1457244951 214 dbSNP
rs1362387575 217 dbSNP
rs1056697004 220 dbSNP
rs1441863361 231 dbSNP
rs1055638307 232 dbSNP
rs1325730758 238 dbSNP
rs182481681 248 dbSNP
rs573118445 251 dbSNP
rs558175890 252 dbSNP
rs1042977218 268 dbSNP
rs568281464 272 dbSNP
rs190568291 276 dbSNP
rs1036019406 278 dbSNP
rs947243778 291 dbSNP
rs1177580829 293 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Braig S; Mueller DW; Rothhammer T; Bosserhoff AK
- Cellular and molecular life sciences : CMLS, 2010
Since bone morphogenetic proteins (BMPs) play an important role in melanoma progression, we aimed to determine the molecular mechanisms leading to overexpression of BMP4 in melanoma cells compared to normal melanocytes. With our experimental approach we revealed that loss of expression of a microRNA represents the starting point for a signaling cascade finally resulting in overexpression of BMP4 in melanoma cells. In detail, strongly reduced expression of the microRNA miR-196a in melanoma cells compared to healthy melanocytes leads to enhanced HOX-B7 mRNA and protein levels, which subsequently raise Ets-1 activity by inducing basic fibroblast growth factor (bFGF). Ets-1 finally accounts for induction of BMP4 expression. We were furthermore able to demonstrate that bFGF-mediated induction of migration is achieved via activation of BMP4, thus determining BMP4 as major modulator of migration in melanoma. In summary, our study provides insights into the early steps of melanoma progression and might thereby harbor therapeutic relevance.
LinkOut: [PMID: 20480203]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.512 5.3e-3 -0.625 5.5e-4 24 Click to see details
GSE27834 Pluripotent stem cells -0.42 5.3e-2 -0.591 8.0e-3 16 Click to see details
GSE17498 Multiple myeloma 0.228 7.9e-2 0.185 1.3e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells -0.262 1.1e-1 -0.039 4.3e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.361 1.1e-1 0.357 1.2e-1 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.403 1.4e-1 0.367 1.7e-1 9 Click to see details
GSE21687 Ependynoma primary tumors 0.112 1.9e-1 -0.125 1.6e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.167 2.1e-1 -0.068 3.7e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.171 2.2e-1 0.076 3.7e-1 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.135 2.6e-1 0.164 2.2e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.058 2.9e-1 -0.183 4.2e-2 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.116 3.1e-1 -0.275 1.2e-1 20 Click to see details
GSE21032 Prostate cancer -0.051 3.2e-1 -0.009 4.7e-1 83 Click to see details
GSE32688 Pancreatic cancer 0.084 3.2e-1 0.139 2.2e-1 32 Click to see details
GSE19783 ER+ ER+ breast cancer -0.108 3.3e-1 -0.018 4.7e-1 20 Click to see details
GSE38226 Liver fibrosis 0.088 3.5e-1 0.057 4.0e-1 21 Click to see details
GSE19783 ER- ER- breast cancer 0.033 3.9e-1 0.113 1.6e-1 79 Click to see details
GSE19536 Breast cancer -0.027 3.9e-1 0.075 2.3e-1 100 Click to see details
GSE19350 CNS germ cell tumors 0.084 4.0e-1 0.091 3.9e-1 12 Click to see details
GSE17306 Multiple myeloma -0.025 4.3e-1 0.071 3.1e-1 49 Click to see details
GSE17306 Multiple myeloma -0.025 4.3e-1 0.071 3.1e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.346 0.01 -0.323 0.01 47 Click to see details
CHOL 0.798 0.01 0.476 0.12 8 Click to see details
HNSC -0.332 0.02 -0.299 0.03 42 Click to see details
PAAD 0.947 0.03 0.800 0.1 4 Click to see details
KIRP 0.277 0.06 0.273 0.07 32 Click to see details
LIHC -0.173 0.15 -0.214 0.1 37 Click to see details
CESC -0.833 0.19 -1.000 0.5 3 Click to see details
LUAD -0.282 0.2 -0.173 0.31 11 Click to see details
PRAD -0.095 0.26 -0.119 0.21 50 Click to see details
BRCA -0.069 0.27 -0.080 0.23 84 Click to see details
UCEC 0.138 0.29 0.116 0.32 19 Click to see details
KICH 0.078 0.36 0.172 0.21 25 Click to see details
ESCA 0.113 0.37 -0.300 0.19 11 Click to see details
COAD 0.119 0.39 0.048 0.46 8 Click to see details
LUSC -0.045 0.39 -0.123 0.23 38 Click to see details
BLCA -0.065 0.4 -0.049 0.42 18 Click to see details
KIRC 0.005 0.48 -0.094 0.22 68 Click to see details
STAD 0.001 0.5 -0.075 0.34 31 Click to see details
PCPG -0.003 0.5 0.500 0.33 3 Click to see details
PCPG -0.003 0.5 0.500 0.33 3 Click to see details
PCPG -0.003 0.5 0.500 0.33 3 Click to see details
301 hsa-miR-196a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000218 BMP4 bone morphogenetic protein 4 1 1
MIRT000219 SPRR2C small proline rich protein 2C (pseudogene) 3 2
MIRT000220 S100A9 S100 calcium binding protein A9 3 2
MIRT000221 KRT5 keratin 5 3 2
MIRT000709 ANXA1 annexin A1 4 2
MIRT002266 HOXB8 homeobox B8 5 7
MIRT002940 HOXA7 homeobox A7 4 5
MIRT002941 HOXD8 homeobox D8 3 3
MIRT002942 HOXC8 homeobox C8 6 15
MIRT004244 HOXB7 homeobox B7 4 1
MIRT004718 BACH1 BTB domain and CNC homolog 1 6 3
MIRT004719 HMOX1 heme oxygenase 1 4 1
MIRT005065 CDKN1B cyclin dependent kinase inhibitor 1B 6 7
MIRT006802 HMGA1 high mobility group AT-hook 1 5 5
MIRT006803 HMGA2 high mobility group AT-hook 2 5 7
MIRT006906 HOXA5 homeobox A5 5 3
MIRT026026 IKBKB inhibitor of nuclear factor kappa B kinase subunit beta 1 1
MIRT026027 PDCD4 programmed cell death 4 1 1
MIRT026028 SRRT serrate, RNA effector molecule 2 9
MIRT026029 DIEXF digestive organ expansion factor homolog (zebrafish) 1 1
MIRT026030 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT026031 NR4A1 nuclear receptor subfamily 4 group A member 1 1 1
MIRT026032 ABT1 activator of basal transcription 1 1 1
MIRT026033 SPATA2 spermatogenesis associated 2 1 1
MIRT026034 NHLRC3 NHL repeat containing 3 1 1
MIRT026035 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT026036 CEP120 centrosomal protein 120 1 1
MIRT026037 PHC3 polyhomeotic homolog 3 1 1
MIRT026038 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT026039 C9orf41 carnosine N-methyltransferase 1 1 1
MIRT026040 PNP purine nucleoside phosphorylase 1 1
MIRT026041 COPS3 COP9 signalosome subunit 3 1 1
MIRT026042 NUP50 nucleoporin 50 1 1
MIRT026043 ZNF763 zinc finger protein 763 1 1
MIRT026044 FOXJ3 forkhead box J3 1 1
MIRT026045 BIN3 bridging integrator 3 1 1
MIRT026046 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT026047 RAD9A RAD9 checkpoint clamp component A 1 1
MIRT026048 PCGF3 polycomb group ring finger 3 1 1
MIRT026049 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT026050 SLC10A7 solute carrier family 10 member 7 1 1
MIRT026051 LBR lamin B receptor 1 1
MIRT026052 BCL11A B-cell CLL/lymphoma 11A 1 1
MIRT026053 GLMN glomulin, FKBP associated protein 1 1
MIRT026054 STK40 serine/threonine kinase 40 1 1
MIRT026055 TMEM135 transmembrane protein 135 1 1
MIRT026056 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 3
MIRT026057 POLR2D RNA polymerase II subunit D 2 5
MIRT026058 LGR4 leucine rich repeat containing G protein-coupled receptor 4 1 1
MIRT026059 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT026060 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT026061 RFX5 regulatory factor X5 1 1
MIRT026062 SYT9 synaptotagmin 9 1 1
MIRT026063 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT026064 IGF1R insulin like growth factor 1 receptor 1 1
MIRT026065 SMCR7L mitochondrial elongation factor 1 1 4
MIRT026066 SLC30A6 solute carrier family 30 member 6 2 3
MIRT026067 RAB31 RAB31, member RAS oncogene family 1 1
MIRT026068 KPNA5 karyopherin subunit alpha 5 1 1
MIRT026069 SLC20A1 solute carrier family 20 member 1 1 1
MIRT026070 TIMM23 translocase of inner mitochondrial membrane 23 1 1
MIRT026071 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT026072 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT026073 CCNT2 cyclin T2 1 1
MIRT026074 CCND2 cyclin D2 1 1
MIRT026075 USP24 ubiquitin specific peptidase 24 1 1
MIRT026076 TRPC3 transient receptor potential cation channel subfamily C member 3 2 4
MIRT026077 SMC3 structural maintenance of chromosomes 3 1 1
MIRT026078 TMEM2 transmembrane protein 2 1 1
MIRT026079 RDH10 retinol dehydrogenase 10 1 1
MIRT026080 C11orf57 chromosome 11 open reading frame 57 2 5
MIRT026081 FAM127A retrotransposon Gag like 8C 2 4
MIRT026082 PRUNE2 prune homolog 2 2 3
MIRT026083 SPRYD4 SPRY domain containing 4 1 1
MIRT026084 TMEM161B transmembrane protein 161B 1 1
MIRT026085 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT026086 FAM104A family with sequence similarity 104 member A 2 2
MIRT026087 RAB7L1 RAB29, member RAS oncogene family 1 1
MIRT026088 ITGAV integrin subunit alpha V 1 1
MIRT026089 CPD carboxypeptidase D 1 1
MIRT026090 ZNF354B zinc finger protein 354B 1 1
MIRT026091 TMEM194A nuclear envelope integral membrane protein 1 1 1
MIRT026092 EPHA7 EPH receptor A7 1 1
MIRT026093 KIAA1804 mitogen-activated protein kinase kinase kinase 21 1 1
MIRT026094 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT026095 TSPAN12 tetraspanin 12 1 1
MIRT026096 LIN28B lin-28 homolog B 1 1
MIRT026097 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT026098 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 1 1
MIRT026099 CCDC47 coiled-coil domain containing 47 1 1
MIRT026100 HAND1 heart and neural crest derivatives expressed 1 4 2
MIRT026101 LLGL1 LLGL1, scribble cell polarity complex component 1 1
MIRT048150 PGAM1 phosphoglycerate mutase 1 1 1
MIRT048151 PSMC3 proteasome 26S subunit, ATPase 3 1 1
MIRT048152 TMX2 thioredoxin related transmembrane protein 2 1 1
MIRT048153 KLHL7 kelch like family member 7 1 1
MIRT048154 RFC2 replication factor C subunit 2 1 1
MIRT048155 GLUL glutamate-ammonia ligase 1 1
MIRT048156 NRXN1 neurexin 1 1 1
MIRT048157 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT048158 HIST2H4B histone cluster 2 H4 family member b 1 1
MIRT048159 SPEN spen family transcriptional repressor 1 1
MIRT048160 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT048161 SAP18 Sin3A associated protein 18 1 1
MIRT048162 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 1 1
MIRT048163 MSL3 MSL complex subunit 3 1 1
MIRT048164 TSKU tsukushi, small leucine rich proteoglycan 1 1
MIRT048165 KMT2C lysine methyltransferase 2C 1 1
MIRT048166 LYRM2 LYR motif containing 2 1 1
MIRT048167 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT048168 C19orf55 proline and serine rich 3 1 1
MIRT048169 LRP2 LDL receptor related protein 2 1 1
MIRT048170 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT048171 NKX6-1 NK6 homeobox 1 1 1
MIRT048172 BRMS1L breast cancer metastasis-suppressor 1 like 1 1
MIRT048173 RPS2 ribosomal protein S2 1 1
MIRT048174 RBMX RNA binding motif protein, X-linked 1 1
MIRT048175 ZFP64 ZFP64 zinc finger protein 1 1
MIRT048176 REEP2 receptor accessory protein 2 1 1
MIRT048177 MED13 mediator complex subunit 13 1 1
MIRT048178 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048179 TRAPPC9 trafficking protein particle complex 9 1 1
MIRT048180 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 1 1
MIRT048181 VDAC3 voltage dependent anion channel 3 1 1
MIRT048182 ZNF529 zinc finger protein 529 1 1
MIRT048183 EWSR1 EWS RNA binding protein 1 1 1
MIRT048184 ATP6V1B2 ATPase H+ transporting V1 subunit B2 1 1
MIRT048185 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT048186 APP amyloid beta precursor protein 1 1
MIRT048187 PROSER1 proline and serine rich 1 1 1
MIRT048188 HIST1H2BB histone cluster 1 H2B family member b 1 1
MIRT048189 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT048190 TUBA1B tubulin alpha 1b 1 1
MIRT048191 USP19 ubiquitin specific peptidase 19 1 1
MIRT048192 COX3 cytochrome c oxidase III 1 1
MIRT048193 PSMD8 proteasome 26S subunit, non-ATPase 8 1 1
MIRT048194 TRA2B transformer 2 beta homolog 1 1
MIRT048195 MRPL35 mitochondrial ribosomal protein L35 1 1
MIRT048196 KCTD1 potassium channel tetramerization domain containing 1 1 1
MIRT048197 UBE2C ubiquitin conjugating enzyme E2 C 1 1
MIRT048198 ZNF581 zinc finger protein 581 1 1
MIRT048199 CNOT11 CCR4-NOT transcription complex subunit 11 1 1
MIRT048200 POTEG POTE ankyrin domain family member G 1 1
MIRT048201 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT048202 SRP9 signal recognition particle 9 2 5
MIRT048203 BCORL1 BCL6 corepressor like 1 1 1
MIRT048204 NRBP1 nuclear receptor binding protein 1 1 1
MIRT048205 LRRC41 leucine rich repeat containing 41 1 1
MIRT048206 ATP6 ATP synthase F0 subunit 6 1 1
MIRT048207 FKTN fukutin 1 1
MIRT048208 RANBP9 RAN binding protein 9 1 1
MIRT048209 SYVN1 synoviolin 1 1 1
MIRT048210 NR2F6 nuclear receptor subfamily 2 group F member 6 1 1
MIRT048211 ATG16L1 autophagy related 16 like 1 1 1
MIRT048212 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 1 1
MIRT048213 ECHDC1 ethylmalonyl-CoA decarboxylase 1 1 1
MIRT048214 HAUS6 HAUS augmin like complex subunit 6 1 1
MIRT048215 CKAP2L cytoskeleton associated protein 2 like 1 1
MIRT048216 IFNGR1 interferon gamma receptor 1 1 1
MIRT048217 ANXA7 annexin A7 1 1
MIRT048218 ENAH ENAH, actin regulator 1 1
MIRT048219 FOXO1 forkhead box O1 9 3
MIRT048220 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT048221 LSM14A LSM14A, mRNA processing body assembly factor 1 1
MIRT048222 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT048223 SLC25A17 solute carrier family 25 member 17 1 1
MIRT048224 ZNF398 zinc finger protein 398 1 1
MIRT048225 RASSF7 Ras association domain family member 7 1 1
MIRT048226 SBF1 SET binding factor 1 1 1
MIRT048227 TP53RK TP53 regulating kinase 1 1
MIRT048228 MED12 mediator complex subunit 12 1 1
MIRT048229 FLNA filamin A 1 1
MIRT048230 CCNE2 cyclin E2 1 1
MIRT048231 CANX calnexin 1 1
MIRT048232 PRPF8 pre-mRNA processing factor 8 1 1
MIRT048233 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT048234 KIF18B kinesin family member 18B 1 1
MIRT048235 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT048236 SH3GL3 SH3 domain containing GRB2 like 3, endophilin A3 1 1
MIRT048237 VCP valosin containing protein 1 1
MIRT048238 ETV3 ETS variant 3 1 1
MIRT048239 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT048240 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT048241 ZCCHC11 zinc finger CCHC-type containing 11 1 1
MIRT048242 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT048243 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT048244 ACTB actin beta 1 1
MIRT048245 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT048246 EIF2B4 eukaryotic translation initiation factor 2B subunit delta 1 1
MIRT048247 GMFB glia maturation factor beta 1 1
MIRT048248 PALLD palladin, cytoskeletal associated protein 1 1
MIRT048249 CASP3 caspase 3 1 1
MIRT048250 VCL vinculin 1 1
MIRT048251 IPO5 importin 5 1 1
MIRT048252 PATL1 PAT1 homolog 1, processing body mRNA decay factor 1 1
MIRT048253 NAP1L4 nucleosome assembly protein 1 like 4 1 1
MIRT048254 RUFY2 RUN and FYVE domain containing 2 2 1
MIRT048255 TUBB tubulin beta class I 1 1
MIRT048256 CCND1 cyclin D1 1 1
MIRT048257 GID8 GID complex subunit 8 homolog 1 1
MIRT048258 VDAC2 voltage dependent anion channel 2 1 1
MIRT048259 SLC6A8 solute carrier family 6 member 8 1 1
MIRT048260 FXR2 FMR1 autosomal homolog 2 1 1
MIRT048261 SCN11A sodium voltage-gated channel alpha subunit 11 1 1
MIRT048262 AHSA1 activator of HSP90 ATPase activity 1 1 1
MIRT048263 ATG9A autophagy related 9A 1 1
MIRT048264 NOTCH2 notch 2 1 1
MIRT048265 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT048266 ND4 NADH dehydrogenase, subunit 4 (complex I) 2 1
MIRT048267 OAT ornithine aminotransferase 1 1
MIRT048268 TRAP1 TNF receptor associated protein 1 1 1
MIRT048269 SKI SKI proto-oncogene 1 1
MIRT048270 GLTP glycolipid transfer protein 1 1
MIRT048271 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT048272 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 1 1
MIRT048273 GRIK4 glutamate ionotropic receptor kainate type subunit 4 1 1
MIRT048274 PDE6D phosphodiesterase 6D 1 1
MIRT048275 MPP2 membrane palmitoylated protein 2 1 1
MIRT048276 SAR1B secretion associated Ras related GTPase 1B 2 3
MIRT048277 MAP4 microtubule associated protein 4 1 1
MIRT048278 RAB21 RAB21, member RAS oncogene family 1 1
MIRT048279 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 1 1
MIRT048280 OGFRL1 opioid growth factor receptor like 1 1 1
MIRT048281 GOT2 glutamic-oxaloacetic transaminase 2 1 1
MIRT048282 NRDE2 NRDE-2, necessary for RNA interference, domain containing 1 1
MIRT048283 SBNO1 strawberry notch homolog 1 1 1
MIRT053067 NTN4 netrin 4 2 1
MIRT054025 RDX radixin 5 5
MIRT056750 ARID5B AT-rich interaction domain 5B 2 2
MIRT057645 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT076226 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT083303 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT095769 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT187720 SUOX sulfite oxidase 2 2
MIRT191923 CALM1 calmodulin 1 2 2
MIRT205504 SP100 SP100 nuclear antigen 2 2
MIRT209857 ACVR2B activin A receptor type 2B 2 2
MIRT229841 YIPF6 Yip1 domain family member 6 2 2
MIRT230833 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT235376 CALM3 calmodulin 3 2 2
MIRT251626 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT252333 SALL3 spalt like transcription factor 3 2 2
MIRT255317 CDV3 CDV3 homolog 2 2
MIRT324734 ACER2 alkaline ceramidase 2 4 3
MIRT386075 ZNF609 zinc finger protein 609 2 2
MIRT402060 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437422 NFKBIA NFKB inhibitor alpha 4 2
MIRT437980 TYMS thymidylate synthetase 1 1
MIRT437981 NRP2 neuropilin 2 1 1
MIRT437982 LSP1 lymphocyte-specific protein 1 1 1
MIRT439104 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT447143 KIF27 kinesin family member 27 2 2
MIRT447559 C14orf37 chromosome 14 open reading frame 37 2 2
MIRT449961 FMNL3 formin like 3 2 2
MIRT465087 TSPAN3 tetraspanin 3 2 2
MIRT470426 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT472726 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473801 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT474507 KLHDC8B kelch domain containing 8B 2 2
MIRT474917 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT486549 DCTN4 dynactin subunit 4 2 2
MIRT492430 RGL2 ral guanine nucleotide dissociation stimulator like 2 2 2
MIRT493925 FAM127B retrotransposon Gag like 8A 2 4
MIRT500972 SPTSSA serine palmitoyltransferase small subunit A 2 2
MIRT501431 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT502410 GATA6 GATA binding protein 6 2 8
MIRT506368 NUP155 nucleoporin 155 2 6
MIRT507497 E2F7 E2F transcription factor 7 2 6
MIRT520041 YOD1 YOD1 deubiquitinase 2 6
MIRT522366 NAP1L1 nucleosome assembly protein 1 like 1 2 4
MIRT531281 SLC7A7 solute carrier family 7 member 7 2 2
MIRT543674 FAM135A family with sequence similarity 135 member A 2 2
MIRT545199 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT546336 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT546452 SLC9A7 solute carrier family 9 member A7 2 2
MIRT546787 RCC2 regulator of chromosome condensation 2 2 4
MIRT547253 NXPE3 neurexophilin and PC-esterase domain family member 3 2 2
MIRT547454 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547581 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT547902 HOXA9 homeobox A9 2 4
MIRT549503 ABHD2 abhydrolase domain containing 2 2 2
MIRT549583 ZNF850 zinc finger protein 850 2 2
MIRT551888 MMS22L MMS22 like, DNA repair protein 2 2
MIRT552125 MED10 mediator complex subunit 10 2 2
MIRT554188 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT555552 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT556285 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT556980 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT559183 BRAP BRCA1 associated protein 2 2
MIRT561215 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT562352 EXOC8 exocyst complex component 8 2 2
MIRT565603 SLC35G1 solute carrier family 35 member G1 2 2
MIRT575599 Gnl1 guanine nucleotide binding protein-like 1 2 3
MIRT610363 GNL1 G protein nucleolar 1 (putative) 2 3
MIRT617860 FMO4 flavin containing monooxygenase 4 2 2
MIRT698193 TMEM66 store-operated calcium entry associated regulatory factor 1 1
MIRT704411 CTPS1 CTP synthase 1 2 2
MIRT732864 NARS asparaginyl-tRNA synthetase 3 0
MIRT732867 AJAP1 adherens junctions associated protein 1 3 0
MIRT732868 COL24A1 collagen type XXIV alpha 1 chain 3 0
MIRT735738 RASSF4 Ras association domain family member 4 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-196a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-196a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-196a Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-196a Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-196a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-196a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-196a Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a Narangin NULL 442428 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a Proanthocyanin NULL 108065 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-196a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-196a-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 sensitive
hsa-miR-196a-5p 1-[4-(5,6-diphenyl-1,2,4-triazin-3-yl)piperazin-1-yl]-2-[4-(4-methoxyphenyl)piperazin-1-yl]ethanone 54612996 NSC749161 sensitive
hsa-miR-196a-5p 2-[(e)-[6-(4-chloro-3-nitrophenyl)-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 16099315 NSC728901 resistant
hsa-miR-196a-5p 2-amino-6-(benzylamino)-4-(2-chlorophenyl)pyridine-3,5-dicarbonitrile 24205132 NSC734396 resistant
hsa-miR-196a-5p 7-[(3,4-dimethoxyphenyl)methyl]-6-phenyl-4,5-dihydropyrrolo[3,4-g][1,2]benzoxazole 60148271 NSC754077 sensitive
hsa-miR-196a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-196a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-196a-5p Dimethylarsinothious acid, 2,4-pyrimidinediyl ester 294741 NSC163664 resistant
hsa-miR-196a-5p Ethyl 5-(2,4-dichlorobenzoyl)oxy-4-oxo-1,3-diphenyl-2-thioxo-thieno[2,3-d]pyrimidine-6-carboxylate 383097 NSC671141 resistant
hsa-miR-196a-5p Gw620972x 766949 NSC756282 sensitive
hsa-miR-196a-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 sensitive
hsa-miR-196a-5p Methyl 6-[2-(diethylamino)ethoxy]-7-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]-3-methyl-1-benzofuran-2-carboxylate;hydrochloride 24204523 NSC732112 resistant
hsa-miR-196a-5p N'-[2-(1,3-benzoxazol-2-ylamino)-6-methylpyrimidin-4-yl]-2-hydroxybenzohydrazide 24205702 NSC736401 resistant
hsa-miR-196a-5p N-(1,3-benzothiazol-2-yl)-2-[4-[(Z)-(3-oxo-1-benzofuran-2-ylidene)methyl]phenoxy]acetamide 45028625 NSC743506 resistant
hsa-miR-196a-5p N,n'-bis[(z)-(2-hydroxyphenyl)methylideneamino]decanediamide 135408549 NSC49488 resistant
hsa-miR-196a-5p NSC617562 NSC617562 resistant
hsa-miR-196a-5p NSC756998 NSC756998 sensitive
hsa-miR-196a-5p Tellurium, trichloro[1,2-hexanedioato(2-)-o,o']-, ammonium 498945 NSC641009 resistant
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3, 2008, OVCAR10, OVCAR3, HeLa, MCF7, MDA-MB-468)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, Hep-394, Hep-SWX, Huh-7)
hsa-miR-196a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-196a-5p 10-Hydroxycamptothecin 97226 NSC107124 sensitive High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-196a-5p Fulvestrant 17756771 NSC719276 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-196a-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-196a-5p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (TAMR1, TAMR4, TAMR8)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-196a-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-196a-5p Cytoxan + Doxorubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Cytoxan + Epirubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Cytoxan + Pirarubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Doxorubicin + Taxol resistant High Breast Cancer tissue
hsa-miR-196a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-196a-5p Yuanhuadine 6440572 resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145R)
hsa-miR-196a-5p Paclitaxel + Cisplatin sensitive Low Esophageal Squamous Cell Carcinoma tissue
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-196a-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-196a-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Trastuzumab resistant High Breast Cancer cell line (MDA‐MB‐231, SKBR3, HEK‐293T)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Epithelial Ovarian Cancer cell line (SKOV3)
hsa-miR-196a-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-196a-5p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-196a-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-196a-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-196a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission