miRTarBase - #MIRT000223


—
pre-miRNA Information
pre-miRNA hsa-mir-195   
Genomic Coordinates chr17: 7017615 - 7017701
Description Homo sapiens miR-195 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-195-5p
Sequence 15| UAGCAGCACAGAAAUAUUGGC |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1311315368 2 dbSNP
rs1483556117 3 dbSNP
rs1257736738 4 dbSNP
rs1230392050 6 dbSNP
rs1354352122 9 dbSNP
rs1346604530 12 dbSNP
rs761226479 14 dbSNP
rs376953960 17 dbSNP
rs767045828 19 dbSNP
rs975705809 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BPLS91 miR-195-5p Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood Quantitative reverse transcription PCR
Gene Information
Gene Symbol E2F3   
Synonyms E2F-3
Description E2F transcription factor 3
Transcript NM_001949   
Expression
Putative miRNA Targets on E2F3
3'UTR of E2F3
(miRNA target sites are highlighted)		 
>E2F3|NM_001949|3'UTR
   1 TTATGCTTCGTGTGAACTCTCCTTAAAAACCGATATTTTTTTATCATGGAACCAGAACATCTGTCATGCAGTGTTGTCCC
  81 TTCCTACCTTCTTCCTCCAAGAGAGTATCATGAAGTAAACTACAAACTTCAGAAGAAAGCTGACATTTTAATGAATTTTT
 161 TAAAAAATTAATAAACAAATTGTCTAAACGCACAGTTGCAGGCTCCCTTGGGAAAGCCCTGCTTTGCTCCAGGCTCCAAG
 241 ATCTCCTGGCTAAGTCAGCAAGTGAGAAAATGTGCAATCAGGTGTCTCTCACCCCGAATTGTCCTTCCTCCTTCCTCCCC
 321 GGATTGGCTTGCTGTGCCTGACGGATGGGCTGTAGAATGGGGTCTGGCCACCTGGCCTGCTGGGAAACAGCAATCTTCCT
 401 TAATAGCATTTCAAGCCGTGCCTTCTCCGCAGAATGCATGTCTTTGAGGTCTGCTAATATGGAATGGAACTGCAGCAAAT
 481 GCAAACTTGAAGTCATGCAAAAGTATGAAATGGATTTCTTCAGCTCTTCTTAGGAATATTTAAATTACTGTCATAATTCA
 561 GTTTAAGCTATGAACTGTGTGTCCCAGTAGGAGGTCAAGAAAACCTCCACAGCCTTCTGGATGAAGAACCTGTTTTCAAA
 641 TATACTTGTTGCAGATACAGAAGACTAGTAGAGTTCTGCCACTCTAAGCTGTTGTGGATTTTCCTGTCTCCATGAACCAC
 721 TCCCATTCCCCCGTCCCCAATGTGTTTGTGAGTTTCCAGTTGATTTGTAGCAAATGCCTACTTAGTTCTTTGTGGATTGT
 801 TCTAGACTTTTAATTTTTTTAGCTGCCATTTAAGCATTCCTGTGGCACCCATCACCATTTCAATTTAATTGTTTACTTTG
 881 AAGCGGTTTTTGCAAATTCATATTACTTAAGCAGAGGGAGAGAACCTCTACTGATCAGAGCATCTAAACCTGTGTGATCT
 961 AAGGTTTATCAGCCTCTGCAAGGAGCTTTGTCCCATCGTGCTTCCATTCCCAGGAGGGGGAGCTTGGAGCGAGTCAGTCC
1041 TGGGGCTTGCTGACATGGGTGGCCCATTGGAAAGGAGAACCAGGTCAGATGATGTAACAGCCCCAAGGAGCAGCAGGCAT
1121 GGGTCCCTCCATCCTTGGGCTTCCCGGGCCCCTGTGACAGGGGAAAGGGCTCTCTTACACCGCACTCAGGGAGACCACTT
1201 CTCAGGATGGGGTCAGATGGAGAGACCTCTAGGGAGAAAGACATCCCCATTGTGTGAGTGGCATTTCCTTAAGCTGGCAG
1281 GAACAGGGAGCAGCCCTGTGTCGGGGGCTGGAATAGTTCTGGCCAGACCCCGTTCCCCTTCCTCTATGAAGGAATAAGTT
1361 GGACCAAGGGAAGTCGGGGACGTAAAAAATGAAGCAAAACAATGCCAGGGTGTCTCCCGCTTTACTCTTCAGGAATGGTG
1441 TCCCAAGTTGGAGGCTTTGTGTCAGCTGCAAATCCTACCAGTTATGTCCAAGAATGGCTTTCCCTCGGGCAGGTGGCAGC
1521 GGCCATCTCCCACTGGGAATATGGCGTAGTATCTCCGGTCCATTCCTTGGATGCTAAGGACTGCGGGAATGAGGGAGTCA
1601 GATAAAGAACAAACCTCGAAACGAACAGTTAAATTGAAATGCTATGTGCCTGACCCAATGGTAGGCACATAGTAGGCACT
1681 CAACTCATATGTTTAATTGAATTGAAAATATCCCTTAGGAAAAAAAAAAAACACACAAAAAACCACAAGAGCCCCAGCCA
1761 GTTTACTCCAGGTAGATTTCCACAATATGCAAAGTGGTGGTGGGGTCAAGACAGATGACACCAGCACTTTAAACTCTTTG
1841 TGTGGGTATGCGTGGGTGTATGTTTGGGAAGAAAAACAAAGGTGCAGACTATCTTCCTTTTTTTCTTCTTCAGCCTCCAT
1921 CCCTGGCCTCCTCCCCTCACACACACTGGACTTGGTACAAAATGTCGGTGTGGTCCTAGATGAAGCATTGGGGTGGGGGA
2001 GGGAGAGGGAGCTTTGTGTTAAGTGCCTACTGGAAATGCACTGTGGGGTTTTTTCCTGTATGGGAAACCATTTATGCCAA
2081 GCTTTTCCCCATTTCCCATATTTATCTCATCTGGTTAGCTGCCTCTGCTTCCAGCTTTGTGTAATTCTCTTTGCCAGCTG
2161 CACAAAGCTGATTTTTTCCAAAGTCTAAAGACTGAGCTCACCTGGCTAGATTGTTGTGTGTTTTGTTGAATTTTTTCATA
2241 ATGTAATGCCGTATTTATTGTTTTTAAAATGAAAGGAATACTAATAAGTCTTAAAAGTTCCTTCATGCATAAGATTTTTT
2321 TCCAGTTACTGGGTTTAACTGGTGTACATTAATTAGATGTCCATACTGTATTTTGTTTGCATTAAGTAATTTTCTTTTTG
2401 ACTTAGTATCCGGCACACAAAGTGGGTTAGTACTACAGTATTTGCGTTACTTTAAGTACTAAGTATGCAGGTTTCCTGGT
2481 ACCATTGAGTTGCTGCTATTAAAGCTCACACACGAAATGGCTAAAAGTTACAAGTGTGCAAATTATGACTGCGTGAGCCT
2561 TAGAAAATAAAATGTATAAAGGGCAACACATGAGCTGTCAAACAGTGTTAGGAGTGTGTTTATATGTACAGAGTTGTGCA
2641 TAGCAATCGTTTTATTTAAGTTGATATGTAGTCTACTCACATTTTCATTATTTAGCAATTTTGTACAAAAATAGCAATTA
2721 ATTTGTAAACACTGCCAGAATACTTTCTAGCTGCTTTGTAATTTTTTAAGAGTGTTATTTTGTTTTTGTTTTTCTGTTCT
2801 TTGTTGTGGCTCTTGTTTTCATTTTTGTTGTACGTGTAGATCTGTAAATAAAATTGCAGTATTTAAAGCTTAAGCTTTCA
2881 GGAAAAAGAAAATAAGAATTCAGTGTGTGCATGACAACTCGTGTGTATGAGAAGGAGGGATATGAAGGAAGATGGCTTGC
2961 AGAGTAAGTCGGGTGGCAATTGTCAGGGTGTGGGAATTTCTTTTCCTACGGGGTACGTGATTTTGTAAAAAGGAAGTATT
3041 TCTCCCAAAATTGGGAGTAGGCAAACTACTAATCAGTTTAGCTTTGTGTTGTATGCTAGTTTAAAAAAGAAAATATGTAA
3121 TATAATGTAAAAAAAAACAAAAAAAAGCTTTTATGATGGATTTTGTAAATAGATTTGTTACAGGGTGACCTGTTCTCTAG
3201 CTGTGATCTTACCACTTCAAATGGGTGTAATTTGAATAAATTTTGTATGGTAAAGGATCAATAAAATGATTTTTTTTAAG
3281 AGTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgguuaUAAAGACACGACGAu 5'
                |||    ||||||| 
Target 5' ggtaccATTGAGTTGCTGCTa 3'
 2478 - 2498 143.00 -12.26
2 
miRNA  3' cggUUAU-AAAGACACGACGAu 5'
             |||| |||||  |||||| 
Target 5' cagAATACTTTCT-AGCTGCTt 3'
 2736 - 2756 137.00 -11.20
3 
miRNA  3' cggUUAUAAAGACACGACGau 5'
             |||| | || ||:|||  
Target 5' tcaAATA-TACT-TGTTGCag 3'
 636 - 654 120.00 -5.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26974419 10 COSMIC
COSN14211145 11 COSMIC
COSN29840172 13 COSMIC
COSN31544974 32 COSMIC
COSN26974417 43 COSMIC
COSN30494068 43 COSMIC
COSN31513244 74 COSMIC
COSN30160857 102 COSMIC
COSN30468939 110 COSMIC
COSN30118943 133 COSMIC
COSN30464428 136 COSMIC
COSN30136784 156 COSMIC
COSN30186334 180 COSMIC
COSN5086288 212 COSMIC
COSN31590396 408 COSMIC
COSN21830139 578 COSMIC
COSN28679858 595 COSMIC
COSN31589538 611 COSMIC
COSN26577245 613 COSMIC
COSN31600769 669 COSMIC
COSN31563724 733 COSMIC
COSN31517906 789 COSMIC
COSN31544721 841 COSMIC
COSN31609187 866 COSMIC
COSN19008156 889 COSMIC
COSN31556649 901 COSMIC
COSN31564499 1006 COSMIC
COSN30545352 1084 COSMIC
COSN17331638 1155 COSMIC
COSN26509206 1170 COSMIC
COSN30165594 1183 COSMIC
COSN31607202 1376 COSMIC
COSN31594832 1383 COSMIC
COSN20628448 1469 COSMIC
COSN8513790 1571 COSMIC
COSN17658989 1618 COSMIC
COSN31482346 1637 COSMIC
COSN31610871 1731 COSMIC
COSN1329678 1732 COSMIC
COSN7866661 2049 COSMIC
COSN31557426 2154 COSMIC
COSN31537787 2413 COSMIC
COSN24301602 2495 COSMIC
COSN31545245 2584 COSMIC
COSN31545067 2596 COSMIC
COSN31482718 2687 COSMIC
COSN31555947 2709 COSMIC
COSN31606713 2767 COSMIC
COSN20091347 2791 COSMIC
COSN30161554 2826 COSMIC
COSN30541308 2835 COSMIC
COSN27681562 2844 COSMIC
COSN27683692 2847 COSMIC
COSN31489201 2902 COSMIC
COSN31590524 3018 COSMIC
COSN30540381 3097 COSMIC
COSN19662907 3128 COSMIC
COSN19660895 3129 COSMIC
COSN31532649 3138 COSMIC
COSN18854244 3139 COSMIC
COSN20102454 3139 COSMIC
COSN31596629 3140 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773227029 2 dbSNP
rs1226978922 3 dbSNP
rs750584037 3 dbSNP
rs1292211695 6 dbSNP
rs746883408 10 dbSNP
rs771049572 11 dbSNP
rs1256214385 13 dbSNP
rs759177070 22 dbSNP
rs1358425079 25 dbSNP
rs759892274 32 dbSNP
rs199852126 33 dbSNP
rs756538936 33 dbSNP
rs765548421 34 dbSNP
rs1248478834 35 dbSNP
rs780275342 35 dbSNP
rs1425694447 36 dbSNP
rs749610635 36 dbSNP
rs191550792 46 dbSNP
rs763387191 47 dbSNP
rs566721808 56 dbSNP
rs56364223 66 dbSNP
rs1474606537 87 dbSNP
rs1459293870 103 dbSNP
rs1194953661 106 dbSNP
rs1028632619 108 dbSNP
rs954347697 124 dbSNP
rs1008502425 125 dbSNP
rs1030771919 129 dbSNP
rs140174545 144 dbSNP
rs989028146 155 dbSNP
rs1338079085 156 dbSNP
rs1391813139 156 dbSNP
rs1400453674 162 dbSNP
rs558655818 162 dbSNP
rs576846225 168 dbSNP
rs4134983 169 dbSNP
rs1459480645 173 dbSNP
rs980321710 181 dbSNP
rs1342482054 190 dbSNP
rs927517720 191 dbSNP
rs182906095 199 dbSNP
rs1194831612 200 dbSNP
rs1057441109 218 dbSNP
rs1265850508 226 dbSNP
rs1193462636 227 dbSNP
rs1489147722 228 dbSNP
rs535500716 230 dbSNP
rs1278160464 232 dbSNP
rs1315681105 234 dbSNP
rs1259652389 262 dbSNP
rs1218988965 274 dbSNP
rs1299049691 277 dbSNP
rs1388466593 296 dbSNP
rs1368321469 297 dbSNP
rs907989682 300 dbSNP
rs186978420 305 dbSNP
rs1402704619 313 dbSNP
rs1247514416 321 dbSNP
rs764084652 322 dbSNP
rs1376307995 323 dbSNP
rs1265655729 328 dbSNP
rs1037546149 330 dbSNP
rs1407980908 333 dbSNP
rs1177451012 335 dbSNP
rs751571493 343 dbSNP
rs1207714000 344 dbSNP
rs1240281392 355 dbSNP
rs1198918356 362 dbSNP
rs1460664961 363 dbSNP
rs866450335 371 dbSNP
rs1235235080 372 dbSNP
rs1488349402 375 dbSNP
rs1306265780 377 dbSNP
rs931911800 383 dbSNP
rs1379254365 394 dbSNP
rs1192829379 418 dbSNP
rs1452208862 419 dbSNP
rs542072016 429 dbSNP
rs556692128 430 dbSNP
rs1363702909 433 dbSNP
rs1008556509 435 dbSNP
rs1437234877 437 dbSNP
rs1165138575 438 dbSNP
rs1367694820 440 dbSNP
rs1178800016 450 dbSNP
rs1457553600 471 dbSNP
rs1253722144 478 dbSNP
rs1201942675 480 dbSNP
rs1483479741 507 dbSNP
rs1285176028 511 dbSNP
rs1161942289 518 dbSNP
rs1031076652 527 dbSNP
rs1310087576 527 dbSNP
rs1245425272 537 dbSNP
rs892222800 545 dbSNP
rs1011031840 551 dbSNP
rs1396941441 553 dbSNP
rs1021808219 573 dbSNP
rs572345281 578 dbSNP
rs575132721 580 dbSNP
rs1362510127 612 dbSNP
rs968904066 622 dbSNP
rs1361818252 623 dbSNP
rs191402559 658 dbSNP
rs1034640365 659 dbSNP
rs960273097 659 dbSNP
rs1189231870 660 dbSNP
rs1398307271 663 dbSNP
rs1313807614 664 dbSNP
rs992853187 695 dbSNP
rs1321518328 702 dbSNP
rs1489229895 705 dbSNP
rs1242111130 707 dbSNP
rs1209297186 710 dbSNP
rs564632005 714 dbSNP
rs531681460 729 dbSNP
rs4134984 733 dbSNP
rs183649544 734 dbSNP
rs940806296 741 dbSNP
rs1326156281 749 dbSNP
rs973866112 761 dbSNP
rs920665413 768 dbSNP
rs1283271969 779 dbSNP
rs1341665767 781 dbSNP
rs931838156 783 dbSNP
rs1182402963 788 dbSNP
rs1387977949 800 dbSNP
rs755216364 806 dbSNP
rs1050214261 807 dbSNP
rs1421882036 811 dbSNP
rs530017043 814 dbSNP
rs890405747 815 dbSNP
rs1181951216 821 dbSNP
rs1478710445 827 dbSNP
rs1263773334 842 dbSNP
rs1382456077 843 dbSNP
rs779212686 847 dbSNP
rs1449884422 852 dbSNP
rs944586815 854 dbSNP
rs1158051118 855 dbSNP
rs1052108463 862 dbSNP
rs1256463627 867 dbSNP
rs1220825052 871 dbSNP
rs1319075215 872 dbSNP
rs1343521164 884 dbSNP
rs892101153 885 dbSNP
rs1328783548 886 dbSNP
rs1010559047 888 dbSNP
rs1386909119 889 dbSNP
rs1303962662 900 dbSNP
rs187910150 916 dbSNP
rs1466952640 924 dbSNP
rs904941451 927 dbSNP
rs772446034 932 dbSNP
rs1377100316 937 dbSNP
rs1477002823 938 dbSNP
rs1379366036 939 dbSNP
rs1432552405 949 dbSNP
rs1457408232 951 dbSNP
rs566758940 952 dbSNP
rs527511531 953 dbSNP
rs1236541634 960 dbSNP
rs1200782597 975 dbSNP
rs1458450844 979 dbSNP
rs1278368089 981 dbSNP
rs552061012 991 dbSNP
rs960283091 993 dbSNP
rs1276015538 995 dbSNP
rs1234346784 998 dbSNP
rs993466309 1012 dbSNP
rs570543556 1017 dbSNP
rs537505973 1018 dbSNP
rs556130215 1019 dbSNP
rs1313475713 1031 dbSNP
rs751465698 1031 dbSNP
rs920716222 1032 dbSNP
rs1255395568 1040 dbSNP
rs1482143400 1041 dbSNP
rs1200372828 1046 dbSNP
rs932057664 1052 dbSNP
rs1180672049 1082 dbSNP
rs1440547453 1083 dbSNP
rs985934420 1085 dbSNP
rs911686262 1086 dbSNP
rs944658216 1092 dbSNP
rs369329259 1095 dbSNP
rs1279908486 1099 dbSNP
rs1216546175 1101 dbSNP
rs1052811138 1104 dbSNP
rs1440488289 1109 dbSNP
rs913802483 1111 dbSNP
rs1178280847 1118 dbSNP
rs1373589073 1120 dbSNP
rs1283285062 1121 dbSNP
rs567765034 1123 dbSNP
rs756498022 1130 dbSNP
rs1435019480 1136 dbSNP
rs1177395534 1141 dbSNP
rs1359163989 1146 dbSNP
rs193045881 1147 dbSNP
rs1043404996 1159 dbSNP
rs1413311104 1173 dbSNP
rs1180371486 1177 dbSNP
rs904953086 1181 dbSNP
rs1238421975 1182 dbSNP
rs1401512908 1183 dbSNP
rs1309440995 1184 dbSNP
rs1001916911 1187 dbSNP
rs1288854286 1196 dbSNP
rs1487589202 1196 dbSNP
rs1218136837 1207 dbSNP
rs554075842 1213 dbSNP
rs778227610 1223 dbSNP
rs1055993959 1230 dbSNP
rs1358122792 1235 dbSNP
rs572380681 1236 dbSNP
rs185351691 1245 dbSNP
rs1338311913 1246 dbSNP
rs1300010152 1249 dbSNP
rs4134985 1250 dbSNP
rs1220404508 1251 dbSNP
rs1015613846 1252 dbSNP
rs1349396787 1264 dbSNP
rs1162870634 1273 dbSNP
rs962314975 1278 dbSNP
rs576489430 1294 dbSNP
rs995278674 1304 dbSNP
rs1027577764 1316 dbSNP
rs1477073922 1319 dbSNP
rs543504487 1326 dbSNP
rs986153645 1332 dbSNP
rs562156542 1333 dbSNP
rs966296438 1343 dbSNP
rs987990972 1345 dbSNP
rs913841617 1347 dbSNP
rs189929537 1348 dbSNP
rs946621123 1352 dbSNP
rs1215098685 1359 dbSNP
rs1424752313 1368 dbSNP
rs1291849699 1375 dbSNP
rs1043416905 1376 dbSNP
rs1395466372 1376 dbSNP
rs926256158 1377 dbSNP
rs541416153 1382 dbSNP
rs770466832 1383 dbSNP
rs896217449 1384 dbSNP
rs560471133 1390 dbSNP
rs1014874352 1403 dbSNP
rs375068453 1415 dbSNP
rs1292375880 1419 dbSNP
rs1343118882 1420 dbSNP
rs1036521515 1421 dbSNP
rs1220345109 1425 dbSNP
rs1469453296 1437 dbSNP
rs776063248 1439 dbSNP
rs1278810085 1443 dbSNP
rs1317048414 1446 dbSNP
rs898078015 1449 dbSNP
rs995010112 1454 dbSNP
rs1027628681 1467 dbSNP
rs1205037282 1477 dbSNP
rs527559660 1485 dbSNP
rs181590088 1486 dbSNP
rs541918297 1491 dbSNP
rs1007498226 1507 dbSNP
rs1371855181 1508 dbSNP
rs1308735727 1511 dbSNP
rs1019488005 1512 dbSNP
rs1222618776 1519 dbSNP
rs966147066 1522 dbSNP
rs1299088246 1540 dbSNP
rs1465898939 1543 dbSNP
rs988388470 1546 dbSNP
rs139667103 1547 dbSNP
rs572737857 1557 dbSNP
rs979316507 1561 dbSNP
rs1196446285 1575 dbSNP
rs1264608978 1585 dbSNP
rs1437426179 1586 dbSNP
rs531531614 1600 dbSNP
rs1482827538 1604 dbSNP
rs775238500 1610 dbSNP
rs937682403 1616 dbSNP
rs1166444920 1618 dbSNP
rs1416425215 1619 dbSNP
rs991819432 1623 dbSNP
rs1405538377 1625 dbSNP
rs917690216 1634 dbSNP
rs1308029366 1638 dbSNP
rs939750999 1647 dbSNP
rs1377467296 1650 dbSNP
rs1305052684 1655 dbSNP
rs1435890824 1659 dbSNP
rs762788898 1661 dbSNP
rs1363129445 1673 dbSNP
rs1360517801 1681 dbSNP
rs1036940521 1683 dbSNP
rs1417371860 1687 dbSNP
rs1298717807 1688 dbSNP
rs897970445 1691 dbSNP
rs1182116676 1718 dbSNP
rs1422977572 1718 dbSNP
rs1029182658 1720 dbSNP
rs1332684130 1720 dbSNP
rs747112786 1720 dbSNP
rs930909223 1721 dbSNP
rs1049328510 1731 dbSNP
rs1491049039 1731 dbSNP
rs549503893 1731 dbSNP
rs879099108 1732 dbSNP
rs1428568660 1733 dbSNP
rs567797275 1737 dbSNP
rs1007550693 1743 dbSNP
rs4134986 1747 dbSNP
rs35111005 1749 dbSNP
rs1229075892 1750 dbSNP
rs1291382891 1754 dbSNP
rs1357359491 1760 dbSNP
rs553321334 1761 dbSNP
rs1158727573 1767 dbSNP
rs1457098771 1771 dbSNP
rs749381101 1773 dbSNP
rs901928066 1775 dbSNP
rs1166799333 1781 dbSNP
rs1009633207 1794 dbSNP
rs1262340503 1801 dbSNP
rs1446873786 1804 dbSNP
rs561508460 1807 dbSNP
rs1380320312 1824 dbSNP
rs1262528312 1835 dbSNP
rs1209389746 1836 dbSNP
rs1487618133 1837 dbSNP
rs1191695573 1839 dbSNP
rs183947206 1840 dbSNP
rs1317720689 1842 dbSNP
rs1473354683 1847 dbSNP
rs1221016335 1853 dbSNP
rs1180901907 1857 dbSNP
rs1327608870 1862 dbSNP
rs188385499 1864 dbSNP
rs1420982223 1866 dbSNP
rs1388096574 1874 dbSNP
rs1327539551 1883 dbSNP
rs1461728886 1886 dbSNP
rs1158661339 1893 dbSNP
rs1422676871 1895 dbSNP
rs1168371923 1898 dbSNP
rs562213888 1898 dbSNP
rs979243026 1903 dbSNP
rs1398837051 1906 dbSNP
rs1336133372 1909 dbSNP
rs1359500309 1911 dbSNP
rs1447085269 1912 dbSNP
rs4134987 1913 dbSNP
rs1380778644 1914 dbSNP
rs1033634104 1915 dbSNP
rs529375562 1916 dbSNP
rs991829293 1918 dbSNP
rs779170092 1920 dbSNP
rs558333687 1922 dbSNP
rs939784174 1923 dbSNP
rs576605115 1927 dbSNP
rs1340650468 1930 dbSNP
rs1274817472 1931 dbSNP
rs972480976 1934 dbSNP
rs761912445 1938 dbSNP
rs543981914 1942 dbSNP
rs1441189446 1944 dbSNP
rs1399184724 1948 dbSNP
rs1329032381 1950 dbSNP
rs1049213285 1964 dbSNP
rs1397080640 1966 dbSNP
rs180850030 1967 dbSNP
rs1241697877 1968 dbSNP
rs1441105085 1969 dbSNP
rs1194429416 1970 dbSNP
rs1439313977 1978 dbSNP
rs1178899097 1988 dbSNP
rs1236639950 1989 dbSNP
rs1184388916 1992 dbSNP
rs1438788251 1993 dbSNP
rs1278478926 2002 dbSNP
rs866694422 2005 dbSNP
rs1379117565 2010 dbSNP
rs1199260266 2013 dbSNP
rs574154470 2017 dbSNP
rs943585144 2020 dbSNP
rs1234462794 2038 dbSNP
rs1174230003 2040 dbSNP
rs1402903110 2049 dbSNP
rs1444053249 2050 dbSNP
rs1336148881 2056 dbSNP
rs1333363100 2061 dbSNP
rs1413839770 2075 dbSNP
rs1040798307 2085 dbSNP
rs1377272014 2087 dbSNP
rs1174324968 2090 dbSNP
rs1209043919 2091 dbSNP
rs748476997 2092 dbSNP
rs1449229610 2098 dbSNP
rs1009971341 2099 dbSNP
rs1277008364 2112 dbSNP
rs1021063402 2115 dbSNP
rs1486935550 2119 dbSNP
rs903934000 2121 dbSNP
rs541452906 2141 dbSNP
rs1332348687 2142 dbSNP
rs1335226057 2158 dbSNP
rs1281636248 2161 dbSNP
rs1225125163 2162 dbSNP
rs1351041314 2172 dbSNP
rs766472230 2187 dbSNP
rs753805799 2188 dbSNP
rs1237049628 2200 dbSNP
rs544644267 2206 dbSNP
rs1357264436 2209 dbSNP
rs184958522 2217 dbSNP
rs1399428903 2221 dbSNP
rs1343523622 2223 dbSNP
rs755092438 2226 dbSNP
rs190937838 2241 dbSNP
rs1413423177 2243 dbSNP
rs1161807104 2244 dbSNP
rs959276506 2247 dbSNP
rs545827310 2249 dbSNP
rs1419156114 2251 dbSNP
rs562787983 2252 dbSNP
rs1487640975 2255 dbSNP
rs750466715 2261 dbSNP
rs1223463477 2270 dbSNP
rs992064833 2277 dbSNP
rs1459400409 2279 dbSNP
rs1198856513 2282 dbSNP
rs35225726 2293 dbSNP
rs1231183578 2295 dbSNP
rs1249449188 2299 dbSNP
rs1343922119 2310 dbSNP
rs1217942904 2312 dbSNP
rs765326057 2325 dbSNP
rs748284638 2329 dbSNP
rs1042317 2335 dbSNP
rs1377716321 2337 dbSNP
rs57922460 2340 dbSNP
rs1431641758 2342 dbSNP
rs149773947 2345 dbSNP
rs549540677 2346 dbSNP
rs1174230718 2348 dbSNP
rs1170502457 2353 dbSNP
rs1425470177 2354 dbSNP
rs1422342792 2355 dbSNP
rs1465992329 2359 dbSNP
rs1245719347 2371 dbSNP
rs1475478697 2371 dbSNP
rs1211456172 2376 dbSNP
rs1469596002 2382 dbSNP
rs1273578188 2383 dbSNP
rs1171636578 2391 dbSNP
rs972790773 2403 dbSNP
rs919711701 2405 dbSNP
rs1305674676 2409 dbSNP
rs952430738 2411 dbSNP
rs1215193021 2412 dbSNP
rs561465783 2413 dbSNP
rs560743891 2415 dbSNP
rs1331784028 2419 dbSNP
rs1249050056 2430 dbSNP
rs747485409 2432 dbSNP
rs182027017 2446 dbSNP
rs1040659012 2447 dbSNP
rs766807450 2447 dbSNP
rs1320429135 2466 dbSNP
rs1356756329 2468 dbSNP
rs1171760556 2480 dbSNP
rs1409984742 2486 dbSNP
rs527963114 2490 dbSNP
rs1366400266 2491 dbSNP
rs187074627 2510 dbSNP
rs945438696 2512 dbSNP
rs1042771056 2514 dbSNP
rs1253295435 2515 dbSNP
rs1177745851 2521 dbSNP
rs1211292420 2523 dbSNP
rs1252946629 2529 dbSNP
rs1205146804 2531 dbSNP
rs903943809 2532 dbSNP
rs1278275533 2535 dbSNP
rs1267394354 2537 dbSNP
rs1308853884 2539 dbSNP
rs1000911597 2540 dbSNP
rs771357661 2541 dbSNP
rs112065694 2545 dbSNP
rs77872144 2546 dbSNP
rs747501848 2550 dbSNP
rs145742366 2553 dbSNP
rs894951039 2554 dbSNP
rs1478024248 2557 dbSNP
rs4134988 2575 dbSNP
rs1436090836 2581 dbSNP
rs1395273626 2583 dbSNP
rs745847670 2596 dbSNP
rs1417019806 2599 dbSNP
rs549615225 2599 dbSNP
rs757646504 2602 dbSNP
rs1485295516 2617 dbSNP
rs1165260521 2618 dbSNP
rs1366249095 2624 dbSNP
rs1255377648 2626 dbSNP
rs1213071336 2629 dbSNP
rs1348726818 2641 dbSNP
rs570309015 2647 dbSNP
rs60408508 2649 dbSNP
rs1026570396 2650 dbSNP
rs952483683 2650 dbSNP
rs1354082050 2660 dbSNP
rs985149294 2669 dbSNP
rs555963268 2674 dbSNP
rs1416042926 2680 dbSNP
rs1375531066 2681 dbSNP
rs745328770 2696 dbSNP
rs1287856063 2707 dbSNP
rs910959307 2712 dbSNP
rs1295247690 2715 dbSNP
rs1365239427 2725 dbSNP
rs1159531794 2731 dbSNP
rs769370298 2741 dbSNP
rs976656703 2744 dbSNP
rs1190008507 2758 dbSNP
rs1246499772 2759 dbSNP
rs79842081 2761 dbSNP
rs75902881 2763 dbSNP
rs1265715561 2770 dbSNP
rs191574805 2772 dbSNP
rs769686639 2776 dbSNP
rs577740898 2777 dbSNP
rs1358092926 2794 dbSNP
rs535204793 2797 dbSNP
rs4134989 2801 dbSNP
rs553431353 2804 dbSNP
rs1185891031 2810 dbSNP
rs1259361863 2813 dbSNP
rs1340514761 2818 dbSNP
rs577991553 2828 dbSNP
rs1294214516 2829 dbSNP
rs1380073549 2830 dbSNP
rs1386640066 2831 dbSNP
rs144083937 2834 dbSNP
rs571021462 2835 dbSNP
rs568802323 2837 dbSNP
rs1055243409 2841 dbSNP
rs1386168728 2844 dbSNP
rs1444238928 2845 dbSNP
rs1166914406 2850 dbSNP
rs1161683420 2856 dbSNP
rs1362558970 2857 dbSNP
rs1454728721 2859 dbSNP
rs1288842555 2863 dbSNP
rs1383236991 2865 dbSNP
rs895214264 2869 dbSNP
rs1013459338 2881 dbSNP
rs1312982890 2885 dbSNP
rs1046622156 2895 dbSNP
rs1381503140 2896 dbSNP
rs1243337204 2901 dbSNP
rs1467370342 2905 dbSNP
rs897073518 2911 dbSNP
rs1214774522 2918 dbSNP
rs1339281481 2921 dbSNP
rs528804010 2922 dbSNP
rs1353846203 2935 dbSNP
rs547168892 2946 dbSNP
rs564249216 2949 dbSNP
rs1026621298 2956 dbSNP
rs952412411 2958 dbSNP
rs768568055 2971 dbSNP
rs1484108931 2972 dbSNP
rs1018020311 2977 dbSNP
rs1395632397 2980 dbSNP
rs1166105853 2994 dbSNP
rs1463535030 2996 dbSNP
rs1200748955 3005 dbSNP
rs1242311217 3010 dbSNP
rs568666935 3011 dbSNP
rs965495428 3017 dbSNP
rs1182015287 3018 dbSNP
rs1437647870 3037 dbSNP
rs976283014 3084 dbSNP
rs576255311 3087 dbSNP
rs1159007131 3094 dbSNP
rs967002994 3098 dbSNP
rs978308592 3111 dbSNP
rs748907544 3117 dbSNP
rs543226128 3124 dbSNP
rs146499346 3126 dbSNP
rs1436868358 3128 dbSNP
rs1468036350 3128 dbSNP
rs754411000 3129 dbSNP
rs879698734 3129 dbSNP
rs925512077 3129 dbSNP
rs1438924089 3130 dbSNP
rs1405839305 3135 dbSNP
rs936678365 3135 dbSNP
rs1449973292 3136 dbSNP
rs878972635 3137 dbSNP
rs201254207 3138 dbSNP
rs990816209 3138 dbSNP
rs199794702 3139 dbSNP
rs79489313 3139 dbSNP
rs949460078 3139 dbSNP
rs1046249257 3147 dbSNP
rs1222773387 3149 dbSNP
rs1438875709 3154 dbSNP
rs896952937 3156 dbSNP
rs1313822142 3157 dbSNP
rs1233902686 3160 dbSNP
rs929814698 3179 dbSNP
rs1484415775 3182 dbSNP
rs767293643 3183 dbSNP
rs1281944383 3184 dbSNP
rs1262230601 3193 dbSNP
rs781575132 3211 dbSNP
rs1240983650 3221 dbSNP
rs1351001414 3233 dbSNP
rs1201989040 3246 dbSNP
rs1377369808 3250 dbSNP
rs1048324571 3258 dbSNP
rs888363260 3266 dbSNP
rs1006547470 3270 dbSNP
rs1160623821 3270 dbSNP
rs1470734067 3278 dbSNP
rs1417710244 3280 dbSNP
rs773235226 3281 dbSNP
rs1017859586 3282 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MHCC-97L , Hep3B , Huh7 , SMMC-7721 , QGY-7703 , HepG2 , HCT-116 , L-02 , U-2OS
Disease MIMAT0000461;
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... "miR-195 Directly Inhibits the Expression of Cyclin D1 ...

- Xu T; Zhu Y; Xiong Y; Ge YY; Yun JP; Zhuang SM, 2009, Hepatology (Baltimore, Md.).

Article - Xu T; Zhu Y; Xiong Y; Ge YY; Yun JP; Zhuang SM
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: Growing evidence indicates that deregulation of microRNAs (miRNAs) contributes to tumorigenesis. Down-regulation of miR-195 has been observed in various types of cancers. However, the biological function of miR-195 is still largely unknown. In this study we aimed to elucidate the pathophysiologic role of miR-195. Our results showed that miR-195 expression was significantly reduced in as high as 85.7% of hepatocellular carcinoma (HCC) tissues and in all of the five HCC cell lines examined. Moreover, introduction of miR-195 dramatically suppressed the ability of HCC and colorectal carcinoma cells to form colonies in vitro and to develop tumors in nude mice. Furthermore, ectopic expression of miR-195 blocked G(1)/S transition, whereas inhibition of miR-195 promoted cell cycle progression. Subsequent investigation characterized multiple G(1)/S transition-related molecules, including cyclin D1, CDK6, and E2F3, as direct targets of miR-195. Silencing of cyclin D1, CDK6, or E2F3 phenocopied the effect of miR-195, whereas overexpression of these proteins attenuated miR-195-induced G(1) arrest. In addition, miR-195 significantly repressed the phosphorylation of Rb as well as the transactivation of downstream target genes of E2F. These results imply that miR-195 may block the G(1)/S transition by repressing Rb-E2F signaling through targeting multiple molecules, including cyclin D1, CDK6, and E2F3. CONCLUSION: Our data highlight an important role of miR-195 in cell cycle control and in the molecular etiology of HCC, and implicate the potential application of miR-195 in cancer therapy.
LinkOut: [PMID: 19441017]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions U87MG , LN-308 , LN-229 , A172?/T98G , U251 , LN-428 , U373 , U138 , 293T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... CCND3 and E2F3 Were Identi茂卢聛ed as Functional Targets of miR-195 in Glioblastoma Cells ...

- Zhang QQ; Xu H; Huang MB; Ma LM; Huang QJ; et al., 2012, Neuro-oncology.

Article - Zhang QQ; Xu H; Huang MB; Ma LM; Huang QJ; et al.
- Neuro-oncology, 2012
Accumulating evidence has implicated the deregluation of miRNAs in tumorigenesis. Previous studies have reported that microRNA-195 (miR-195) is markedly down-regulated in human glioblastoma cells, compared with normal brain tissue, but the biological role of miR-195 in glioblastoma development is currently unknown. In this study, we define a tumor-suppressor role for miR-195 in human glioblastoma cells. Over-expression of miR-195 in glioblastoma cell lines robustly arrested cell cycle progression and significantly repressed cellular invasion. We identified E2F3 and CCND3 as functional downstream targets of miR-195 in glioblastoma cells. Through knockdown studies, we demonstrated that E2F3 was the dominant effector of miR-195-mediated cell cycle arrest and that CCND3 was a key mediator of miR-195-induced inhibition of glioblastoma cell invasion. Furthermore, we showed that p27(Kip1) was an important regulator downstream of CCND3 and that the accumulation of p27(Kip1) in the cytoplasm might be responsible for the miR-195-mediated cell invasion inhibition in glioblastoma cells. This work provides evidence for the initial mechanism by which miR-195 negatively regulates both the proliferation and invasion of glioblastoma cells, suggesting that the down-regulation of miR-195 might contribute to the malignant transformation of glioblastoma cells and could be a molecular signature associated with glioblastoma progression.
LinkOut: [PMID: 22217655]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.825 6.4e-7 -0.571 2.2e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.693 3.5e-4 0.856 7.4e-7 20 Click to see details
GSE19536 Breast cancer -0.332 3.7e-4 -0.321 5.6e-4 100 Click to see details
GSE19783 ER- ER- breast cancer -0.323 1.8e-3 -0.272 7.7e-3 79 Click to see details
GSE32688 Pancreatic cancer 0.407 1.0e-2 0.138 2.3e-1 32 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.664 2.6e-2 0.867 1.2e-3 9 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.38 3.0e-2 -0.048 4.1e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.232 3.3e-2 -0.237 3.0e-2 64 Click to see details
GSE19783 ER+ ER+ breast cancer -0.405 3.8e-2 -0.532 7.9e-3 20 Click to see details
GSE19350 CNS germ cell tumors -0.451 7.1e-2 -0.448 7.2e-2 12 Click to see details
GSE21032 Prostate cancer 0.155 8.1e-2 0.242 1.4e-2 83 Click to see details
GSE28544 Breast cancer 0.268 1.0e-1 0.123 2.8e-1 24 Click to see details
GSE17306 Multiple myeloma -0.173 1.2e-1 -0.134 1.8e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.239 1.2e-1 0.385 2.9e-2 25 Click to see details
GSE21849 B cell lymphoma -0.184 1.7e-1 0.289 6.4e-2 29 Click to see details
GSE17498 Multiple myeloma -0.145 1.9e-1 -0.124 2.2e-1 40 Click to see details
GSE27834 Pluripotent stem cells -0.17 2.6e-1 -0.009 4.9e-1 16 Click to see details
GSE14794 Lymphoblastoid cells -0.052 3.1e-1 0.013 4.5e-1 90 Click to see details
GSE28260 Renal cortex and medulla -0.114 3.6e-1 -0.137 3.3e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.073 3.7e-1 -0.042 4.2e-1 24 Click to see details
GSE38226 Liver fibrosis -0.067 3.9e-1 0.099 3.3e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.337 0 0.350 0 68 Click to see details
STAD -0.441 0.01 -0.420 0.01 32 Click to see details
LUSC -0.297 0.04 -0.426 0 38 Click to see details
BRCA 0.18 0.05 0.129 0.12 84 Click to see details
KICH 0.333 0.05 0.351 0.04 25 Click to see details
HNSC 0.254 0.05 0.101 0.26 42 Click to see details
CESC -0.984 0.06 -1.000 0.5 3 Click to see details
LIHC -0.194 0.09 -0.259 0.04 49 Click to see details
ESCA -0.332 0.16 -0.418 0.1 11 Click to see details
UCEC -0.225 0.18 -0.182 0.23 19 Click to see details
PCPG -0.823 0.19 -1.000 0.5 3 Click to see details
PAAD -0.581 0.21 -0.400 0.3 4 Click to see details
KIRP 0.132 0.24 0.162 0.19 32 Click to see details
LUAD -0.213 0.25 -0.315 0.16 12 Click to see details
BLCA 0.085 0.37 0.197 0.22 18 Click to see details
COAD -0.086 0.42 0.214 0.31 8 Click to see details
CHOL 0.05 0.45 0.000 0.5 9 Click to see details
PRAD 0.014 0.46 0.001 0.5 50 Click to see details
THCA 0.004 0.49 0.019 0.44 59 Click to see details
THCA 0.004 0.49 0.019 0.44 59 Click to see details
THCA 0.004 0.49 0.019 0.44 59 Click to see details
618 hsa-miR-195-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000222 WEE1 WEE1 G2 checkpoint kinase 13 8
MIRT000223 E2F3 E2F transcription factor 3 5 3
MIRT000224 CDK6 cyclin dependent kinase 6 6 4
MIRT000225 CCND1 cyclin D1 6 8
MIRT000785 BCL2L11 BCL2 like 11 2 1
MIRT000795 MECP2 methyl-CpG binding protein 2 2 1
MIRT004273 VEGFA vascular endothelial growth factor A 7 16
MIRT004390 SKI SKI proto-oncogene 4 4
MIRT004669 CCL4 C-C motif chemokine ligand 4 3 1
MIRT004937 KRT7 keratin 7 2 1
MIRT005362 BCL2 BCL2, apoptosis regulator 5 3
MIRT006077 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 3 2
MIRT006080 RUNX2 runt related transcription factor 2 3 1
MIRT006235 SLC2A3 solute carrier family 2 member 3 4 5
MIRT006245 TBCCD1 TBCC domain containing 1 3 2
MIRT006246 CCND3 cyclin D3 2 2
MIRT006252 CDK4 cyclin dependent kinase 4 2 2
MIRT006995 CDC42 cell division cycle 42 3 2
MIRT007054 CAB39 calcium binding protein 39 2 1
MIRT007169 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007170 TAB3 TGF-beta activated kinase 1 and MAP3K7 binding protein 3 1 1
MIRT007219 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT007237 CCNE1 cyclin E1 5 7
MIRT007370 BCL2L2 BCL2 like 2 2 1
MIRT044858 JAK2 Janus kinase 2 1 1
MIRT044859 CAMKV CaM kinase like vesicle associated 1 1
MIRT044860 AGER advanced glycosylation end-product specific receptor 1 1
MIRT044861 LSM11 LSM11, U7 small nuclear RNA associated 2 4
MIRT044862 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT044863 ZNF280C zinc finger protein 280C 1 1
MIRT044864 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT044865 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT044866 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT044867 COPB1 coatomer protein complex subunit beta 1 1 1
MIRT044868 RPL10 ribosomal protein L10 1 1
MIRT044869 TMC6 transmembrane channel like 6 1 1
MIRT044870 TPI1 triosephosphate isomerase 1 1 1
MIRT044871 SH3BGRL2 SH3 domain binding glutamate rich protein like 2 1 1
MIRT044872 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT053194 DICER1 dicer 1, ribonuclease III 3 2
MIRT053228 FASN fatty acid synthase 5 5
MIRT053467 ARL2 ADP ribosylation factor like GTPase 2 4 1
MIRT054417 BIRC5 baculoviral IAP repeat containing 5 2 1
MIRT054418 WNT7A Wnt family member 7A 2 1
MIRT054890 MYB MYB proto-oncogene, transcription factor 3 1
MIRT054904 ATG14 autophagy related 14 4 3
MIRT055424 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055817 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057517 CEP55 centrosomal protein 55 2 8
MIRT057735 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057909 STXBP3 syntaxin binding protein 3 1 1
MIRT061007 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061249 AMOTL1 angiomotin like 1 2 12
MIRT061531 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063399 ETNK1 ethanolamine kinase 1 1 1
MIRT064688 CCND2 cyclin D2 2 4
MIRT065716 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066296 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066314 USP15 ubiquitin specific peptidase 15 2 2
MIRT068658 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071211 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072825 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074533 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075254 SNTB2 syntrophin beta 2 2 4
MIRT075277 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075896 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076795 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077785 MINK1 misshapen like kinase 1 1 1
MIRT078285 RPS6KB1 ribosomal protein S6 kinase B1 5 3
MIRT079658 NAPG NSF attachment protein gamma 2 12
MIRT080014 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082988 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083269 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084465 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085217 CCNT2 cyclin T2 1 1
MIRT086012 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087426 ZNRF3 zinc and ring finger 3 2 2
MIRT087557 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088106 SEPT2 septin 2 1 1
MIRT089111 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089211 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090450 CDV3 CDV3 homolog 1 1
MIRT090691 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091673 RARB retinoic acid receptor beta 2 6
MIRT092195 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092213 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093687 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT095434 PURA purine rich element binding protein A 1 1
MIRT096238 CANX calnexin 2 2
MIRT098830 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT100210 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100368 HSPA1B heat shock protein family A (Hsp70) member 1B 2 7
MIRT100571 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100899 CD2AP CD2 associated protein 2 2
MIRT102439 CALU calumenin 2 3
MIRT102635 UBN2 ubinuclein 2 2 11
MIRT102973 EN2 engrailed homeobox 2 2 6
MIRT103096 MAFK MAF bZIP transcription factor K 2 5
MIRT103858 FOXK1 forkhead box K1 2 3
MIRT104019 USP42 ubiquitin specific peptidase 42 2 6
MIRT104235 DMTF1 cyclin D binding myb like transcription factor 1 2 3
MIRT106297 ZFHX4 zinc finger homeobox 4 2 6
MIRT106736 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107220 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT107688 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT108985 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109244 ZNF275 zinc finger protein 275 2 2
MIRT110056 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112974 LUZP1 leucine zipper protein 1 2 6
MIRT114927 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117659 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120683 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT125925 PDCD4 programmed cell death 4 1 1
MIRT127735 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128805 UBE4A ubiquitination factor E4A 1 1
MIRT129059 ARCN1 archain 1 1 1
MIRT130383 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131102 TMEM138 transmembrane protein 138 1 1
MIRT132746 RASSF5 Ras association domain family member 5 1 1
MIRT132836 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133339 BCL7A BCL tumor suppressor 7A 1 1
MIRT137521 RCOR1 REST corepressor 1 1 1
MIRT140151 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140827 SMAD3 SMAD family member 3 1 1
MIRT141246 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141285 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142244 DCTN5 dynactin subunit 5 2 9
MIRT144030 PSKH1 protein serine kinase H1 1 1
MIRT145386 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146023 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146359 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146502 SNX11 sorting nexin 11 1 1
MIRT148310 RNF138 ring finger protein 138 1 1
MIRT150358 IER2 immediate early response 2 1 1
MIRT152285 TNFSF9 TNF superfamily member 9 2 3
MIRT152512 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152753 KIF3B kinesin family member 3B 1 1
MIRT152932 NOL4L nucleolar protein 4 like 2 3
MIRT154051 RASSF2 Ras association domain family member 2 2 2
MIRT154403 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156463 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158529 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT159005 EPT1 selenoprotein I 1 1
MIRT159592 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160173 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163261 PRKCD protein kinase C delta 1 1
MIRT164271 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164961 TADA2B transcriptional adaptor 2B 1 1
MIRT165180 GRAMD3 GRAM domain containing 2B 2 3
MIRT165896 CREBRF CREB3 regulatory factor 2 3
MIRT168591 HMGA1 high mobility group AT-hook 1 3 2
MIRT168685 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169070 IRF4 interferon regulatory factor 4 1 1
MIRT170158 KLHDC10 kelch domain containing 10 1 1
MIRT170740 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171604 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172819 HMBOX1 homeobox containing 1 1 1
MIRT174792 RNF38 ring finger protein 38 1 1
MIRT175236 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175527 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179012 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180911 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186374 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189763 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189964 AGO4 argonaute 4, RISC catalytic component 3 2
MIRT190187 GPR180 G protein-coupled receptor 180 2 6
MIRT191457 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191628 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194241 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194907 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196278 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196455 TAOK1 TAO kinase 1 2 2
MIRT201458 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204596 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204627 MOB4 MOB family member 4, phocein 2 8
MIRT204743 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206022 NUP50 nucleoporin 50 2 7
MIRT211200 FGF2 fibroblast growth factor 2 5 4
MIRT211316 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212610 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217747 TBPL1 TATA-box binding protein like 1 2 3
MIRT223692 FZD6 frizzled class receptor 6 2 6
MIRT224968 BAG4 BCL2 associated athanogene 4 2 2
MIRT229349 ZNF449 zinc finger protein 449 2 2
MIRT229863 YIPF6 Yip1 domain family member 6 2 2
MIRT230122 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234345 MSL1 male specific lethal 1 homolog 2 8
MIRT245006 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246940 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247239 ELK4 ELK4, ETS transcription factor 2 4
MIRT247370 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248555 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248768 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249452 ZNF691 zinc finger protein 691 2 4
MIRT251494 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255337 SRPRB SRP receptor beta subunit 2 5
MIRT256310 CDC42SE2 CDC42 small effector 2 2 2
MIRT258413 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265058 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265078 CHEK1 checkpoint kinase 1 5 4
MIRT267256 TMEM109 transmembrane protein 109 1 1
MIRT267531 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270456 SIRT4 sirtuin 4 1 1
MIRT270555 SETD1B SET domain containing 1B 2 2
MIRT273668 HOXC8 homeobox C8 2 2
MIRT274744 RAB3IP RAB3A interacting protein 2 2
MIRT277508 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282537 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286970 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289633 CBX2 chromobox 2 2 2
MIRT294286 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295814 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297781 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300108 STRADB STE20-related kinase adaptor beta 4 3
MIRT300997 MTMR3 myotubularin related protein 3 2 2
MIRT302617 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302828 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307144 CTDSPL CTD small phosphatase like 2 4
MIRT313678 ITGA2 integrin subunit alpha 2 2 2
MIRT314054 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317724 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319334 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320630 ZNRF2 zinc and ring finger 2 2 2
MIRT324841 IFT74 intraflagellar transport 74 1 1
MIRT326305 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327966 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT367267 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT437657 ALOX12 arachidonate 12-lipoxygenase, 12S type 2 1
MIRT437658 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437659 CGNL1 cingulin like 1 2 1
MIRT437660 KIF21A kinesin family member 21A 2 1
MIRT437661 RASGEF1B RasGEF domain family member 1B 2 1
MIRT437662 TUFT1 tuftelin 1 2 1
MIRT437663 PDIA6 protein disulfide isomerase family A member 6 4 5
MIRT437664 SNX16 sorting nexin 16 4 7
MIRT437665 TRIP10 thyroid hormone receptor interactor 10 2 1
MIRT437792 CDC25A cell division cycle 25A 4 4
MIRT437793 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 3 2
MIRT438296 INSR insulin receptor 3 1
MIRT438377 ELN elastin 3 1
MIRT438609 RET ret proto-oncogene 1 1
MIRT438896 Bace1 beta-secretase 1 1 1
MIRT443814 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446505 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447775 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448444 TLL1 tolloid like 1 2 2
MIRT449187 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451836 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453285 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453751 CSNK1E casein kinase 1 epsilon 2 2
MIRT454967 TPM2 tropomyosin 2 2 2
MIRT456864 ZNF460 zinc finger protein 460 2 10
MIRT460221 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460435 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461561 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463166 ZNF367 zinc finger protein 367 2 10
MIRT464664 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464747 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465164 TSC22D2 TSC22 domain family member 2 2 2
MIRT465567 TOB2 transducer of ERBB2, 2 2 2
MIRT465928 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466011 TMEM189 transmembrane protein 189 2 8
MIRT466295 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466434 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466919 STK38 serine/threonine kinase 38 2 10
MIRT466999 SSRP1 structure specific recognition protein 1 2 5
MIRT468056 SIK1 salt inducible kinase 1 2 3
MIRT468148 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468678 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469087 RNF168 ring finger protein 168 2 2
MIRT469412 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471036 PISD phosphatidylserine decarboxylase 2 10
MIRT471493 PDE4D phosphodiesterase 4D 2 4
MIRT471953 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472264 NFIC nuclear factor I C 2 2
MIRT472666 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474317 LAMC1 laminin subunit gamma 1 2 2
MIRT474832 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475066 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475120 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475536 HOXA3 homeobox A3 2 8
MIRT475717 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475840 HDGF heparin binding growth factor 2 4
MIRT476257 GNB1 G protein subunit beta 1 2 7
MIRT476274 GNAL G protein subunit alpha L 2 6
MIRT476697 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477562 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477846 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478909 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479985 CARD10 caspase recruitment domain family member 10 2 2
MIRT481180 AVL9 AVL9 cell migration associated 2 6
MIRT482115 AKT3 AKT serine/threonine kinase 3 2 4
MIRT482372 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482552 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482579 ABHD2 abhydrolase domain containing 2 2 2
MIRT484775 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485217 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487391 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492712 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494349 CASKIN1 CASK interacting protein 1 2 2
MIRT495144 ZNRF1 zinc and ring finger 1 2 2
MIRT496016 CD180 CD180 molecule 2 2
MIRT497773 KIAA0895 KIAA0895 2 2
MIRT498981 ORC4 origin recognition complex subunit 4 2 8
MIRT499453 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499617 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500094 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500323 ZNF622 zinc finger protein 622 2 9
MIRT500421 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500577 USP53 ubiquitin specific peptidase 53 2 2
MIRT500862 SYPL1 synaptophysin like 1 2 8
MIRT500939 SRPR SRP receptor alpha subunit 2 7
MIRT500950 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501086 SMAD7 SMAD family member 7 3 9
MIRT501503 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502037 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502149 KIF5B kinesin family member 5B 2 9
MIRT502499 FAM122B family with sequence similarity 122B 2 8
MIRT502569 E2F7 E2F transcription factor 7 2 11
MIRT502647 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502917 CDCA4 cell division cycle associated 4 2 9
MIRT502949 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503145 ATG9A autophagy related 9A 2 7
MIRT504335 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504537 ZNF620 zinc finger protein 620 2 6
MIRT504853 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505117 YTHDC1 YTH domain containing 1 2 6
MIRT505347 TMEM245 transmembrane protein 245 2 6
MIRT505397 TMEM100 transmembrane protein 100 2 2
MIRT505503 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505685 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505909 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505927 RCAN3 RCAN family member 3 2 4
MIRT506109 PPIG peptidylprolyl isomerase G 2 6
MIRT506134 PLRG1 pleiotropic regulator 1 2 4
MIRT506167 PLAG1 PLAG1 zinc finger 2 9
MIRT506193 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506489 MYO5A myosin VA 2 7
MIRT506855 KIF23 kinesin family member 23 2 7
MIRT507000 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507821 CDK1 cyclin dependent kinase 1 2 6
MIRT507851 CCNE2 cyclin E2 2 6
MIRT507880 CBX6 chromobox 6 2 2
MIRT508038 AXIN2 axin 2 2 6
MIRT508642 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509365 DMPK DM1 protein kinase 2 11
MIRT509691 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510044 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511844 GPATCH8 G-patch domain containing 8 2 5
MIRT512284 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512643 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513859 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514023 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT518092 TRIM35 tripartite motif containing 35 2 2
MIRT518531 FLCN folliculin 2 6
MIRT518995 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521204 SBNO1 strawberry notch homolog 1 2 6
MIRT521813 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522101 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522776 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537816 EFNB2 ephrin B2 2 4
MIRT539900 RPL14 ribosomal protein L14 2 4
MIRT540844 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541220 HOXA10 homeobox A10 2 2
MIRT541431 CBX4 chromobox 4 5 4
MIRT542807 PHC3 polyhomeotic homolog 3 2 3
MIRT542834 PDCD1 programmed cell death 1 2 7
MIRT543060 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543080 APP amyloid beta precursor protein 2 2
MIRT543307 ZNF585B zinc finger protein 585B 2 2
MIRT543409 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543526 PRSS21 protease, serine 21 2 2
MIRT543798 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543836 GSG1 germ cell associated 1 2 2
MIRT544572 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544590 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544913 CLSPN claspin 2 2
MIRT544966 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545187 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545348 CCDC83 coiled-coil domain containing 83 2 2
MIRT545683 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545956 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545976 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546115 USP48 ubiquitin specific peptidase 48 2 4
MIRT546606 SALL1 spalt like transcription factor 1 2 4
MIRT546618 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546637 RTN4 reticulon 4 2 2
MIRT547064 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547129 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547232 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547301 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547410 MKX mohawk homeobox 2 2
MIRT547461 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547550 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547665 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547701 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547971 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT547997 HCFC2 host cell factor C2 2 4
MIRT548016 GRB2 growth factor receptor bound protein 2 2 4
MIRT548221 FKBP1A FK506 binding protein 1A 2 2
MIRT548277 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548728 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548805 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548948 CDK17 cyclin dependent kinase 17 2 3
MIRT549079 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549126 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549277 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549387 AMOT angiomotin 2 2
MIRT550403 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550467 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550616 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550824 FAM229B family with sequence similarity 229 member B 2 2
MIRT551380 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551618 ZNF267 zinc finger protein 267 2 2
MIRT551738 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552036 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552345 ZNF704 zinc finger protein 704 2 2
MIRT552750 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553440 TPM3 tropomyosin 3 2 2
MIRT553563 TMEM161B transmembrane protein 161B 2 2
MIRT553617 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553773 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553810 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554701 RNF149 ring finger protein 149 2 2
MIRT554963 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555033 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555148 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555226 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555277 PRDM4 PR/SET domain 4 2 2
MIRT555437 PPAP2B phospholipid phosphatase 3 2 2
MIRT556384 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556854 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557282 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557481 GPR27 G protein-coupled receptor 27 2 4
MIRT558038 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558508 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558590 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558663 CNKSR3 CNKSR family member 3 2 2
MIRT559012 CA8 carbonic anhydrase 8 2 2
MIRT559157 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559532 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560853 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561151 KRT33B keratin 33B 2 2
MIRT561401 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561875 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562028 LANCL1 LanC like 1 2 2
MIRT562202 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562878 KIAA1456 KIAA1456 2 2
MIRT563087 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563504 DLGAP3 DLG associated protein 3 2 2
MIRT563702 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563846 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563897 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564333 CCNT1 cyclin T1 2 2
MIRT564479 ZNF391 zinc finger protein 391 2 2
MIRT564553 CCDC80 coiled-coil domain containing 80 2 2
MIRT564841 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564951 XKR7 XK related 7 2 2
MIRT564988 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565043 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565396 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566121 RASEF RAS and EF-hand domain containing 2 2
MIRT566651 NCKAP1 NCK associated protein 1 2 2
MIRT566832 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567020 KLHL15 kelch like family member 15 2 2
MIRT567447 GNG12 G protein subunit gamma 12 2 2
MIRT567478 FZD9 frizzled class receptor 9 2 2
MIRT568022 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568144 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568471 ARMC12 armadillo repeat containing 12 2 2
MIRT568573 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568623 ACVR2A activin A receptor type 2A 2 2
MIRT570465 TLK1 tousled like kinase 1 2 3
MIRT571120 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571284 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571429 RIF1 replication timing regulatory factor 1 2 2
MIRT571661 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571829 PHF19 PHD finger protein 19 2 2
MIRT574058 PROSC pyridoxal phosphate binding protein 2 2
MIRT574204 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574596 N4BP1 NEDD4 binding protein 1 2 3
MIRT575883 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575925 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576097 Pdcd1 programmed cell death 1 2 5
MIRT576597 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614701 TRAK1 trafficking kinesin protein 1 2 2
MIRT616468 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618897 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT619615 RNF41 ring finger protein 41 2 2
MIRT621499 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640539 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645511 BSPRY B-box and SPRY domain containing 2 2
MIRT646596 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648785 KLHL40 kelch like family member 40 2 2
MIRT655813 NOTCH2 notch 2 2 3
MIRT658794 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659257 CUL3 cullin 3 2 2
MIRT680983 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682282 RS1 retinoschisin 1 2 2
MIRT682515 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691710 FLOT2 flotillin 2 2 3
MIRT693931 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701507 NEGR1 neuronal growth regulator 1 2 2
MIRT702093 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702874 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713420 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714439 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716433 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717462 ADORA3 adenosine A3 receptor 2 2
MIRT720148 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725128 SYNRG synergin gamma 2 2
MIRT726004 ZNF91 zinc finger protein 91 1 1
MIRT726082 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726125 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726130 CHMP3 charged multivesicular body protein 3 1 1
MIRT726141 VCL vinculin 1 1
MIRT726155 USP3 ubiquitin specific peptidase 3 1 1
MIRT726163 USP31 ubiquitin specific peptidase 31 1 1
MIRT726219 TUBB tubulin beta class I 1 1
MIRT726235 TRAM1 translocation associated membrane protein 1 1 1
MIRT726277 TMEM69 transmembrane protein 69 1 1
MIRT726285 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726304 TMEM135 transmembrane protein 135 1 1
MIRT726316 TLE4 transducin like enhancer of split 4 1 1
MIRT726319 TKTL1 transketolase like 1 1 1
MIRT726323 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726335 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726346 TCF3 transcription factor 3 1 1
MIRT726354 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726365 TBC1D20 TBC1 domain family member 20 1 1
MIRT726370 TBC1D14 TBC1 domain family member 14 1 1
MIRT726382 TASP1 taspase 1 1 1
MIRT726408 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726419 STX17 syntaxin 17 1 1
MIRT726453 SRPK1 SRSF protein kinase 1 1 1
MIRT726460 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726480 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726504 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726508 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726542 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726546 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726675 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726678 RPS5 ribosomal protein S5 1 1
MIRT726682 RPL36 ribosomal protein L36 1 1
MIRT726710 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726714 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726717 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726754 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726760 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726770 RELT RELT, TNF receptor 1 1
MIRT726786 RAP2C RAP2C, member of RAS oncogene family 4 1
MIRT726809 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726824 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726851 PSMB5 proteasome subunit beta 5 1 1
MIRT726872 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726899 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726908 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726965 PGD phosphogluconate dehydrogenase 1 1
MIRT726972 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727019 PANK1 pantothenate kinase 1 1 1
MIRT727025 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727036 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727065 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727094 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727135 MTMR4 myotubularin related protein 4 1 1
MIRT727151 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727174 MLXIP MLX interacting protein 1 1
MIRT727196 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727220 MED11 mediator complex subunit 11 1 1
MIRT727226 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727260 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727265 LRRC57 leucine rich repeat containing 57 1 1
MIRT727269 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727295 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727346 KLC2 kinesin light chain 2 1 1
MIRT727375 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727384 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727423 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727480 HYOU1 hypoxia up-regulated 1 1 1
MIRT727521 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727582 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727603 GANAB glucosidase II alpha subunit 1 1
MIRT727616 GABARAP GABA type A receptor-associated protein 1 1
MIRT727645 FRYL FRY like transcription coactivator 1 1
MIRT727698 FAM73A mitoguardin 1 1 1
MIRT727717 AMER1 APC membrane recruitment protein 1 1 1
MIRT727812 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727854 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727857 DPP8 dipeptidyl peptidase 8 1 1
MIRT727864 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727907 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727911 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727914 CUL2 cullin 2 1 1
MIRT727922 CSDE1 cold shock domain containing E1 1 1
MIRT727934 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727950 CPNE1 copine 1 1 1
MIRT727997 RHOV ras homolog family member V 1 1
MIRT728003 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728017 CDC27 cell division cycle 27 1 1
MIRT728044 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728089 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728098 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728125 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728129 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728192 BSG basigin (Ok blood group) 1 1
MIRT728236 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728263 ATP13A3 ATPase 13A3 1 1
MIRT728287 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728327 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728381 AFF4 AF4/FMR2 family member 4 1 1
MIRT728397 ACOX1 acyl-CoA oxidase 1 1 1
MIRT732257 NKD1 naked cuticle homolog 1 3 1
MIRT734040 CTBP1-AS CTBP1 antisense RNA 3 0
MIRT735246 SGK1 serum/glucocorticoid regulated kinase 1 5 0
MIRT735431 YAP1 Yes associated protein 1 8 1
MIRT736810 GPER1 G protein-coupled estrogen receptor 1 3 0
MIRT755496 FOSL1 FOS like 1, AP-1 transcription factor subunit 3 1
MIRT755897 SNHG1 small nucleolar RNA host gene 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-195 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-195 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-195 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-195 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-195 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-195 Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-195 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 up-regulated
miR-195 Aidi injection NULL NULL Quantitative real-time PCR human breast cancer cells 21563499 2011 up-regulated
miR-195 Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-195 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-195 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-195 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-195 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-195 Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-195 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-195 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-195 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-195 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-195 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-195-5p (11E)-11-(3-aminopropylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 9978660 NSC724562 resistant
hsa-miR-195-5p (11E)-15,16-dimethoxy-20-methyl-11-[3-(methylamino)propylidene]-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027834 NSC727048 resistant
hsa-miR-195-5p (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 resistant
hsa-miR-195-5p (2-azanidylcyclohexyl)azanide;tetrachloroplatinum(2+) 430475 NSC363813 resistant
hsa-miR-195-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-195-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-195-5p (3-sulfanylidene-5,6-dihydroimidazo[2,1-c][1,2,4]thiadiazol-7-yl) 2-[[4-(trifluoromethoxy)phenyl]sulfonylamino]-4,5-dihydroimidazole-1-carbodithioate 24205510 NSC736065 sensitive
hsa-miR-195-5p (3R,5R,8R,9S,10S,13R,14S,17R)-17-[(2R)-4-(4,5-dihydro-1H-imidazol-2-yl)butan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol 391085 NSC689620 resistant
hsa-miR-195-5p (4aS,4bR,10bS,12aS)-2-butyl-12a-methyl-8-(2-pyrrolidin-1-ylethoxy)-4,4a,4b,5,6,10b,11,12-octahydronaphtho[2,1-f]isoquinoline-1,3-dione 383426 NSC671765 resistant
hsa-miR-195-5p (4e)-2-(2-hydroxybenzoyl)-5-methyl-4-[(3,4,5-trimethoxyphenyl)methylene]pyrazol-3-one 5467421 NSC652182 sensitive
hsa-miR-195-5p (Z)-3-amino-1-(5-amino-3-phenylpyrazol-1-yl)-3-phenylprop-2-en-1-one 21825201 NSC749518 sensitive
hsa-miR-195-5p .alpha.-chloro-n-(p-methoxyphenyl)succinimide 99724 NSC191909 resistant
hsa-miR-195-5p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 resistant
hsa-miR-195-5p [3-methoxy-2-[methyl(octadecyl)amino]propyl] 2-(trimethylazaniumyl)ethyl phosphate 131966 NSC643826 resistant
hsa-miR-195-5p [3,4,5-triacetyloxy-6-[5-[(2-methoxyphenyl)methyl]-3-phenyl-6-sulfanylidene-1,2,4-triazin-1-yl]oxan-2-yl]methyl acetate 362262 NSC625873 sensitive
hsa-miR-195-5p [4-[[4-[4-(3-azidophenothiazin-10-yl)butyl]piperazin-1-yl]methyl]phenyl]-phenylmethanone;(Z)-but-2-enedioic acid 5351430 NSC676963 resistant
hsa-miR-195-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 sensitive
hsa-miR-195-5p 1-(2-chloro-6-fluorophenyl)-6-methoxy-1,3-dihydro-[1,3]thiazolo[3,4-a]benzimidazole 396040 NSC701312 sensitive
hsa-miR-195-5p 1-(4,8-dioxothieno[2,3-f][1]benzothiol-2-yl)ethyl acetate 388025 NSC682450 sensitive
hsa-miR-195-5p 1-[(z)-(4-methoxyphenyl)methylideneamino]-3-naphthalen-1-ylurea 5914027 NSC680934 sensitive
hsa-miR-195-5p 1-[4-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]butyl]-5,10-dihydroxynaphtho[2,3-f]indole-4,11-dione 406508 NSC724635 resistant
hsa-miR-195-5p 1-[phenyl(2-pyridinyl)methylene]-4-(2-methylphenyl)thiosemicarbazide 6148953 NSC668326 resistant
hsa-miR-195-5p 1-benzyl-3-[[5-(4-chlorophenyl)-7-(p-tolyl)pyrrolo[2,3-d]pyrimidin-4-yl]amino]thiourea 3001721 NSC667707 resistant
hsa-miR-195-5p 1-butan-2-yl-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135440008 NSC674098 resistant
hsa-miR-195-5p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 resistant
hsa-miR-195-5p 14-[2-(dimethylamino)ethyl]-n-[3-[3-[[14-[2-(dimethylamino)ethyl]-4-methoxy-8,14,15-triazatetracyclo[7.6.1.02,7.013,16]hexadeca-1(15),2(7),3,5,9,11,13(16)-heptaene-10-carbonyl]amino]propyl-methylamino 135426710 NSC710552 resistant
hsa-miR-195-5p 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethylamino]-5-methoxy-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2(7),3,5,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392061 NSC691851 resistant
hsa-miR-195-5p 1h-indole, 5-bromo-3-[2-(2-pyridinyl)-4-thiazolyl]- 397551 NSC705871 resistant
hsa-miR-195-5p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-195-5p 2-(3-ethoxy-4-hydroxyphenyl)-3-[2-[2-(3-ethoxy-4-hydroxyphenyl)-4-oxo-1,3-thiazolidin-3-yl]-[1,3]thiazolo[5,4-f][1,3]benzothiazol-6-yl]-1,3-thiazolidin-4-one 398511 NSC708422 sensitive
hsa-miR-195-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-195-5p 2-(4-aminobutyl)-1,4-dihydroxyanthracene-9,10-dione;hydrochloride 439019 NSC699139 resistant
hsa-miR-195-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-195-5p 2-[(z)-6-(2-fluorophenyl)hex-3-en-1,5-diynyl]aniline 24204954 NSC733691 sensitive
hsa-miR-195-5p 2-[[1-[[(1r,4s,5r,8s,9r,10s,12r,13r)-1,5,9-trimethyl-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadecan-10-yl]oxy]-3-[[(1r,4s,5r,8s,9r,10s,13r)-1,5,9-trimethyl-11,14,15,16-tetraoxatetracyclo[ 45027898 NSC735846 resistant
hsa-miR-195-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-195-5p 2-[2-[(z)-1-benzamido-2-(2-hydroxyphenyl)vinyl]-5-oxo-oxazolidin-4-yl]acetic acid 6477540 NSC686413 sensitive
hsa-miR-195-5p 2-[4-[5-[2,6-dimethoxy-4-[5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1,2-oxazol-3-yl]phenoxy]pentoxy]-3-methoxyphenyl]-2,3-dihydro-1H-quinazolin-4-one 45029290 NSC746035 sensitive
hsa-miR-195-5p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-195-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-195-5p 2-hydroxy-N-[(E)-1-[6-[(E)-N-[(2-hydroxybenzoyl)amino]-C-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]benzamide 5779747 NSC617573 resistant
hsa-miR-195-5p 2-mercapto-6-(2-phenylhydrazino)-4-pyrimidinol 3005146 NSC677260 resistant
hsa-miR-195-5p 2-methyl-4-methoxy-5-piperidino-6h-furo[2,3-c]xanthen-6-one 389281 NSC685034 resistant
hsa-miR-195-5p 2-phenyl-12-amino-4h-1-oxa-7-azabenz[a]anthracen-4-one 385046 NSC675967 resistant
hsa-miR-195-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-195-5p 2,4-diethoxyestra-1,3,5(10)trien-3,17.beta.-diol 388044 NSC682505 sensitive
hsa-miR-195-5p 2,6-bis[1-(3-ethylthioureidoimino)ethyl]pyridine 6393657 NSC668337 resistant
hsa-miR-195-5p 2,6-dipyridin-2-ylpyridine;4-methylpyridine;platinum(2+);tetrafluoroborate 24202574 NSC694500 resistant
hsa-miR-195-5p 3-(4-chlorophenyl)thieno[2,3-b]pyrrolizin-8-one 388525 NSC683509 sensitive
hsa-miR-195-5p 3-(9-amino-4-methoxy-6-methyl-7,8-dihydro-5h-[1,3]dioxolo[4,5-g]isoquinolin-5-yl)-6,7-dimethoxy-3h-2-benzofuran-1-one;hydrochloride 45028024 NSC740642 sensitive
hsa-miR-195-5p 3-[(3-chlorophenyl)methyl]-5-methyl-4-oxo-N-phenylthieno[2,3-d]pyrimidine-6-carboxamide 1191776 NSC732903 sensitive
hsa-miR-195-5p 3-[(e)-1-(2-hydroxy-4-methoxy-phenyl)ethylideneamino]-1,1-dimethyl-thiourea 135493996 NSC689547 resistant
hsa-miR-195-5p 3-methyl-4-methylsulfanyl-5-phenyl-6h-pyrazolo[3,4-c]pyrazole 135450457 NSC692021 resistant
hsa-miR-195-5p 3-N',5-N'-bis(2-hydroxybenzoyl)-2,6-dimethyl-1,4-dihydropyridine-3,5-dicarbohydrazide 377030 NSC658247 sensitive
hsa-miR-195-5p 3,4-diphenylisoxazolo[3,4-d]pyridazin-7(6h)-one 54613569 NSC749505 sensitive
hsa-miR-195-5p 3,5,12,14-tetrabutyl-7,10-dithia-8,9-diselena-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-diselone 395765 NSC700584 resistant
hsa-miR-195-5p 4-(4-fluorophenyl)-2-[8-[[4-(4-fluorophenyl)-5-propyl-1h-imidazol-2-yl]sulfanyl]octylsulfanyl]-5-propyl-1h-imidazole;methanesulfonic acid 374589 NSC652562 sensitive
hsa-miR-195-5p 4-[(4-methyl-1,2-oxazol-5-yl)amino]naphthalene-1,2-dione 384244 NSC673785 sensitive
hsa-miR-195-5p 4-[(6-chloro-4h-1,3-benzodioxin-8-yl)methylsulfanyl]pyrrolo[1,2-a]quinoxaline 331156 NSC321491 sensitive
hsa-miR-195-5p 4-[2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethyl]benzene-1,2-diol 24205774 NSC736609 resistant
hsa-miR-195-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-195-5p 4-amino-3,5-dichloro-n-(3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)benzamide 379857 NSC664993 resistant
hsa-miR-195-5p 4,4-dibromo-1-(3-bromo-4-methylpentyl)cyclopentene 382925 NSC670802 resistant
hsa-miR-195-5p 4,4,4-trifluoro-3-hydroxy-1-(3-hydroxy-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1h-cyclopenta[a]phenanthren-17-yl)butan-1-one NSC45236 resistant
hsa-miR-195-5p 5-[(E)-3-[4-(diethylamino)phenyl]prop-2-enylidene]-2-sulfanylidene-1,3-diazinane-4,6-dione 6376062 NSC684567 sensitive
hsa-miR-195-5p 5-[[4-[5-(4-chloroanilino)-1,3,4-thiadiazol-2-yl]anilino]methyl]-n-(4-chlorophenyl)-1,3,4-thiadiazol-2-amine NSC697140 resistant
hsa-miR-195-5p 5-benzyl-9-hydroxy-5h-indeno[1,2-b]indol-10-one 406582 NSC724794 sensitive
hsa-miR-195-5p 5-bromo-n-(2-methyl-3-oxo-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1h-indole-2-carboxamide 24205438 NSC735532 resistant
hsa-miR-195-5p 5-fluoranyl-7-nitro-quinolin-8-ol 260644 NSC92207 resistant
hsa-miR-195-5p 5-fluoro-N-(2-methyl-3-oxo-8-phenyl-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1H-indole-2-carboxamide 24205446 NSC735540 resistant
hsa-miR-195-5p 6-(11-aminoundecyl)indeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 16221323 NSC740510 resistant
hsa-miR-195-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-195-5p 6-(4-methylphenyl)-8-(4-chlorophenyl)imidazo[1,2-a]pyrazine 11336170 NSC731104 sensitive
hsa-miR-195-5p 6-(aziridin-1-yl)-7-methoxy-2,3-dihydro-1h-pyrrolo[1,2-a]benzimidazole-5,8-dione 383842 NSC672472 resistant
hsa-miR-195-5p 6-[2-[2-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]ethylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027833 NSC726973 resistant
hsa-miR-195-5p 6-[2-[3-[2-(2,3-dimethoxy-5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]propylamino]ethyl]-2,3-dimethoxyindeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027895 NSC735372 resistant
hsa-miR-195-5p 6-[3-[2-[3-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)propylamino]ethylamino]propyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027830 NSC726767 resistant
hsa-miR-195-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 sensitive
hsa-miR-195-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-195-5p 6-chloro-5-(2-piperazin-1-ylethyl)-1,3-dihydroindol-2-one 22181640 NSC762889 sensitive
hsa-miR-195-5p 6,13-bis[2-[(2,3,4-trimethoxyphenyl)methylamino]ethyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone;4-methylbenzenesulfonic acid;hydrate 60147730 NSC752278 resistant
hsa-miR-195-5p 7-methoxy-5,11-dimethyl-10h-pyrido[3,4-b]carbazole 379120 NSC663334 resistant
hsa-miR-195-5p 9-[2-(2,5-dimethylpyrrol-1-yl)phenyl]-7-hydroxy-5,6-di(propan-2-yloxy)-3-oxa-1-azatricyclo[6.3.1.04,12]dodeca-4,6,8(12),10-tetraen-2-one 389261 NSC685014 resistant
hsa-miR-195-5p 9-[4-[(4,6-dimethylpyrimidin-2-yl)sulfamoyl]anilino]-n-(2-hydroxyethyl)acridine-4-carboxamide 384527 NSC674498 resistant
hsa-miR-195-5p Aklavin 264889 NSC100290 resistant
hsa-miR-195-5p Amonafide 50515 NSC308847 resistant
hsa-miR-195-5p Antineoplastic-92909 261046 NSC92909 sensitive
hsa-miR-195-5p Basic yellow k 7081 NSC13973 resistant
hsa-miR-195-5p Butanedioic acid;10-[3-(4-methylpiperazin-1-yl)propyl]-2-(trifluoromethyl)phenothiazine 5351168 NSC46061 resistant
hsa-miR-195-5p Chlorodestruxin 370710 NSC644211 resistant
hsa-miR-195-5p Cinnoline, 4-nitro-, 1-oxide 100397 NSC294846 resistant
hsa-miR-195-5p Crotoxin cd NSC636009 sensitive
hsa-miR-195-5p Deferoxamine hydrochloride 2973 NSC268993 approved resistant
hsa-miR-195-5p Destruxin b NSC236580 resistant
hsa-miR-195-5p Diaziridinone, bis(.alpha.,.alpha.-dimethylphenethyl)- 391928 NSC691608 resistant
hsa-miR-195-5p Diethyl 1,6-dihydropyrrolo[2,3-e]indole-2,7-dicarboxylate 389557 NSC685862 sensitive
hsa-miR-195-5p Diethyl(acetylamino)[(6-nitro-1h-indol-3-yl)methyl]propanedioate 249442 NSC67774 sensitive
hsa-miR-195-5p Dimethyl 12-cyclohexyl-8-oxo-1-phenyl-12-azatricyclo[7.2.1.02,7]dodeca-2,4,6,10-tetraene-10,11-dicarboxylate 394469 NSC697942 resistant
hsa-miR-195-5p Edelfosine 1392 NSC324368 resistant
hsa-miR-195-5p Emofolin sodium 135488934 NSC139490 resistant
hsa-miR-195-5p Entinostat 4261 NSC706995 resistant
hsa-miR-195-5p Ethanol, 2-[4-(2,2':6',2"-terpyridin-4'-yl)phenoxy]- 368990 NSC640499 resistant
hsa-miR-195-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 sensitive
hsa-miR-195-5p Ethyl 4-(1,3-thiazol-2-ylcarbamoylamino)benzoate 307683 NSC205795 sensitive
hsa-miR-195-5p From combretum caffrum plant 5386397 NSC609397 sensitive
hsa-miR-195-5p Hexadecyl-(2-hydroxyethyl)-(1H-imidazol-5-ylmethyl)-methylazanium;chloride 21144688 NSC265875 resistant
hsa-miR-195-5p J-400634 385621 NSC676944 resistant
hsa-miR-195-5p J7x181m78y 395460 NSC700023 sensitive
hsa-miR-195-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-195-5p L-cysteine, s-[(4-chlorophenyl)diphenylmethyl]- 275977 NSC123138 sensitive
hsa-miR-195-5p L-lys-l-p-no2phe-l-ala-l-p-no2phenh2 386384 NSC678355 resistant
hsa-miR-195-5p Lomondomycin 135426834 NSC156939 sensitive
hsa-miR-195-5p Ls-133613 365597 NSC633398 resistant
hsa-miR-195-5p Massoia lactone 39914 NSC720841 resistant
hsa-miR-195-5p Methanesulfonic acid;10-[3-[3-[(9-methoxy-5,11-dimethyl-6h-pyrido[4,3-b]carbazol-1-yl)amino]propyl-methylamino]propylamino]-1,14-diazatetracyclo[7.6.1.02,7.013,16]hexadeca-2,4,6,9,11,13(16),14-heptaen 438996 NSC695938 resistant
hsa-miR-195-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 sensitive
hsa-miR-195-5p Methyl 2-[33,34,35,36-tetrahydroxy-11,19,27-tris(2-methoxy-2-oxoethyl)-7,15,23,31-tetramethyl-3,11,19,27-tetrazapentacyclo[27.3.1.15,9.113,17.121,25]hexatriaconta-1(32),5,7,9(36),13,15,17(35),21(34),2 395595 NSC700325 resistant
hsa-miR-195-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-195-5p Miltefosin c 3599 NSC605583 resistant
hsa-miR-195-5p N'-(1-(1-hydroxy-1lambda(5)-pyridin-2-yl)ethyl)-4-(2-pyridinyl)-1-piperazinecarbothiohydrazide 3003953 NSC352741 resistant
hsa-miR-195-5p N'-[8-(4-hydroxy-3,5-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]-4-methylbenzenesulfonohydrazide 383134 NSC671175 sensitive
hsa-miR-195-5p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-2-(4-hydroxy-2-oxochromen-3-yl)-2-oxoacetamide 54693275 NSC649811 sensitive
hsa-miR-195-5p N-(3-methoxyphenethyl)-3,3,3-triphenylpropionamide 11453337 NSC730691 resistant
hsa-miR-195-5p N-[(22s)-13-methoxy-18-methylsulfanyl-19-oxo-4,11-diazapentacyclo[12.10.0.03,12.05,10.015,21]tetracosa-1,3,5,7,9,11,13,15,17,20-decaen-22-yl]acetamide 395872 NSC700913 sensitive
hsa-miR-195-5p N-[(e)-[4-(diethylamino)-2-hydroxyphenyl]methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968272 NSC747458 resistant
hsa-miR-195-5p N-[(E)-1-(6-methylpyridin-2-yl)ethylideneamino]-3-azabicyclo[3.2.2]nonane-3-carbothioamide 5464837 NSC335789 resistant
hsa-miR-195-5p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 resistant
hsa-miR-195-5p N-[(Z)-1-(4-oxo-3,1-benzoxazin-2-yl)-2-phenylethenyl]benzamide 5917766 NSC686428 sensitive
hsa-miR-195-5p N-[2-(1h-indol-3-yl)ethyl]-4-[[[(e)-3-(4-phenylphenyl)prop-2-enoyl]amino]methyl]benzamide 5470491 NSC702137 resistant
hsa-miR-195-5p N-[2-(dimethylamino)ethyl]-9-fluorophenazine-1-carboxamide;hydrochloride 386521 NSC678925 resistant
hsa-miR-195-5p N-[2-[[4,5-dihydroxy-2-methyl-6-(7H-purin-6-ylamino)oxan-3-yl]amino]-2-oxoethyl]-14-methylpentadecanamide 4366047 NSC268251 resistant
hsa-miR-195-5p N-[3-(dimethylamino)propyl]-9-oxo-2-thia-11,14-diazatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7,12,14,16-heptaene-13-carboxamide 385059 NSC675988 resistant
hsa-miR-195-5p N-[8-hydroxy-7-(piperidin-1-ylmethyl)quinolin-5-yl]acetamide 279612 NSC130876 resistant
hsa-miR-195-5p N,N'-bis[(5E)-5-[(3,4-dihydroxyphenyl)methylidene]-2-(2-hydroxynaphthalen-1-yl)-4-oxo-1,3-thiazolidin-3-yl]decanediamide 5470052 NSC697192 resistant
hsa-miR-195-5p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-195-5p Neuro_000347 438571 NSC645835 resistant
hsa-miR-195-5p NSC697653 NSC697653 resistant
hsa-miR-195-5p NSC755523 NSC755523 resistant
hsa-miR-195-5p Octadecylphosphocholine 125219 NSC282880 resistant
hsa-miR-195-5p Oxin 1923 NSC2039 approved resistant
hsa-miR-195-5p P-fuchsin 11292 NSC10460 sensitive
hsa-miR-195-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-195-5p Paullone analog 9 396412 NSC702378 resistant
hsa-miR-195-5p Perifosine 148177 NSC639966 resistant
hsa-miR-195-5p Proflavine hcl 197873 NSC605756 resistant
hsa-miR-195-5p Questiomycin a 72725 NSC94945 sensitive
hsa-miR-195-5p Replaced cas registry number(s): 66835-31-2 312122 NSC220334 sensitive
hsa-miR-195-5p Sc-60646 419381 NSC114382 sensitive
hsa-miR-195-5p Sodium;3-hydroxy-4-[(1-hydroxynaphthalen-2-yl)diazenyl]-8-nitronaphthalene-1-sulfonate 135488931 NSC85561 resistant
hsa-miR-195-5p Sr16388 54612678 NSC745098 sensitive
hsa-miR-195-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-195-5p Tellurium, trichloro[1,2-hexanedioato(2-)-o,o']-, ammonium 498945 NSC641009 resistant
hsa-miR-195-5p Tert-butyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 386493 NSC678637 sensitive
hsa-miR-195-5p Thujaplicin mixture 252101 NSC73300 resistant
hsa-miR-195-5p Tris(1,10-phenanthroline)neodymium(iii)-trithiocyanate 24202207 NSC632730 resistant
hsa-miR-195-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 resistant
hsa-miR-195-5p Z24759926 4853660 NSC743408 sensitive
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251MG)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved resistant High Head And Neck Squamous Cell Carcinoma cell line (UMSCC-1, SQ20B)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (BEL-7402)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (BEL-7402)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Epidermoid Carcinoma cell line (KB-3-1, KB-CP.5, KB-CP20)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive Low Colon Cancer cell line (HT-29, LOVO)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved sensitive High Non-Small Cell Lung Cancer cell line (SK-MES-1, NCI-H1975, NCI-H460)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-195-5p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (IOSE386, IOSE397, A2780, KF, SKOV3, TOUS3,TU-OC-1, OVCAR-3, OV2008, CI3)
hsa-miR-195-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (COC1)
hsa-miR-195-5p Prednisolone 5755 NSC9120 approved sensitive Low Ulcerative Colitis tissue
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-195-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-195-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-195-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Melanoma cell line (UACC-62, SK-MEL-5)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Melanoma cell line (UACC-62, SK-MEL-5)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-195-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Azacitidine 9444 NSC102816 approved resistant High Acute Myeloid Leukemia tissue
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (Caco-2, HCT8, HCT-116, SW480)
hsa-miR-195-5p Eribulin 73425383 approved sensitive Low Non-Small Cell Lung Cancer cell line (H1299)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive Low Prostate Cancer cell line (DU-145)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (SW620, HT-29)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (MKN28)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Gastric Cancer cell line (MKN28)
hsa-miR-195-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U251MG)
hsa-miR-195-5p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-195-5p Trastuzumab sensitive Low HER2-Positive Breast Cancer cell line (BT-474)
hsa-miR-195-5p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (SGC-7901, AGS)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3, HO8910, ES-2, A2780)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-116, RKO)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT-116, RKO)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (MGC-803)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (W1)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (W1)
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-195-5p Platinum 23939 sensitive High High-Grade Serous Ovarian Cancer tissue
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, Hep3B)
hsa-miR-195-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-195-5p Fluorouracil