| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-195 |
| Genomic Coordinates | chr17: 7017615 - 7017701 |
| Description | Homo sapiens miR-195 stem-loop |
| Comment | This miRNA sequence is predicted based on homology to a verified miRNA from mouse . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | ||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-195-5p | |||||||||||||||||||||||||||||||||
| Sequence | 15| UAGCAGCACAGAAAUAUUGGC |35 | |||||||||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||||||||
| Experiments | Cloned | |||||||||||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Biomarker Information |
| ||||||
|---|---|---|---|---|---|---|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | CCND1 | ||||||||||||||||||||
| Synonyms | BCL1, D11S287E, PRAD1, U21B31 | ||||||||||||||||||||
| Description | cyclin D1 | ||||||||||||||||||||
| Transcript | NM_053056 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on CCND1 | |||||||||||||||||||||
| 3'UTR of CCND1 (miRNA target sites are highlighted) |
>CCND1|NM_053056|3'UTR 1 GGGCGCCAGGCAGGCGGGCGCCACCGCCACCCGCAGCGAGGGCGGAGCCGGCCCCAGGTGCTCCCCTGACAGTCCCTCCT 81 CTCCGGAGCATTTTGATACCAGAAGGGAAAGCTTCATTCTCCTTGTTGTTGGTTGTTTTTTCCTTTGCTCTTTCCCCCTT 161 CCATCTCTGACTTAAGCAAAAGAAAAAGATTACCCAAAAACTGTCTTTAAAAGAGAGAGAGAGAAAAAAAAAATAGTATT 241 TGCATAACCCTGAGCGGTGGGGGAGGAGGGTTGTGCTACAGATGATAGAGGATTTTATACCCCAATAATCAACTCGTTTT 321 TATATTAATGTACTTGTTTCTCTGTTGTAAGAATAGGCATTAACACAAAGGAGGCGTCTCGGGAGAGGATTAGGTTCCAT 401 CCTTTACGTGTTTAAAAAAAAGCATAAAAACATTTTAAAAACATAGAAAAATTCAGCAAACCATTTTTAAAGTAGAAGAG 481 GGTTTTAGGTAGAAAAACATATTCTTGTGCTTTTCCTGATAAAGCACAGCTGTAGTGGGGTTCTAGGCATCTCTGTACTT 561 TGCTTGCTCATATGCATGTAGTCACTTTATAAGTCATTGTATGTTATTATATTCCGTAGGTAGATGTGTAACCTCTTCAC 641 CTTATTCATGGCTGAAGTCACCTCTTGGTTACAGTAGCGTAGCGTGCCCGTGTGCATGTCCTTTGCGCCTGTGACCACCA 721 CCCCAACAAACCATCCAGTGACAAACCATCCAGTGGAGGTTTGTCGGGCACCAGCCAGCGTAGCAGGGTCGGGAAAGGCC 801 ACCTGTCCCACTCCTACGATACGCTACTATAAAGAGAAGACGAAATAGTGACATAATATATTCTATTTTTATACTCTTCC 881 TATTTTTGTAGTGACCTGTTTATGAGATGCTGGTTTTCTACCCAACGGCCCTGCAGCCAGCTCACGTCCAGGTTCAACCC 961 ACAGCTACTTGGTTTGTGTTCTTCTTCATATTCTAAAACCATTCCATTTCCAAGCACTTTCAGTCCAATAGGTGTAGGAA 1041 ATAGCGCTGTTTTTGTTGTGTGTGCAGGGAGGGCAGTTTTCTAATGGAATGGTTTGGGAATATCCATGTACTTGTTTGCA 1121 AGCAGGACTTTGAGGCAAGTGTGGGCCACTGTGGTGGCAGTGGAGGTGGGGTGTTTGGGAGGCTGCGTGCCAGTCAAGAA 1201 GAAAAAGGTTTGCATTCTCACATTGCCAGGATGATAAGTTCCTTTCCTTTTCTTTAAAGAAGTTGAAGTTTAGGAATCCT 1281 TTGGTGCCAACTGGTGTTTGAAAGTAGGGACCTCAGAGGTTTACCTAGAGAACAGGTGGTTTTTAAGGGTTATCTTAGAT 1361 GTTTCACACCGGAAGGTTTTTAAACACTAAAATATATAATTTATAGTTAAGGCTAAAAAGTATATTTATTGCAGAGGATG 1441 TTCATAAGGCCAGTATGATTTATAAATGCAATCTCCCCTTGATTTAAACACACAGATACACACACACACACACACACACA 1521 CAAACCTTCTGCCTTTGATGTTACAGATTTAATACAGTTTATTTTTAAAGATAGATCCTTTTATAGGTGAGAAAAAAACA 1601 ATCTGGAAGAAAAAAACCACACAAAGACATTGATTCAGCCTGTTTGGCGTTTCCCAGAGTCATCTGATTGGACAGGCATG 1681 GGTGCAAGGAAAATTAGGGTACTCAACCTAAGTTCGGTTCCGATGAATTCTTATCCCCTGCCCCTTCCTTTAAAAAACTT 1761 AGTGACAAAATAGACAATTTGCACATCTTGGCTATGTAATTCTTGTAATTTTTATTTAGGAAGTGTTGAAGGGAGGTGGC 1841 AAGAGTGTGGAGGCTGACGTGTGAGGGAGGACAGGCGGGAGGAGGTGTGAGGAGGAGGCTCCCGAGGGGAAGGGGCGGTG 1921 CCCACACCGGGGACAGGCCGCAGCTCCATTTTCTTATTGCGCTGCTACCGTTGACTTCCAGGCACGGTTTGGAAATATTC 2001 ACATCGCTTCTGTGTATCTCTTTCACATTGTTTGCTGCTATTGGAGGATCAGTTTTTTGTTTTACAATGTCATATACTGC 2081 CATGTACTAGTTTTAGTTTTCTCTTAGAACATTGTATTACAGATGCCTTTTTTGTAGTTTTTTTTTTTTTTATGTGATCA 2161 ATTTTGACTTAATGTGATTACTGCTCTATTCCAAAAAGGTTGCTGTTTCACAATACCTCATGCTTCACTTAGCCATGGTG 2241 GACCCAGCGGGCAGGTTCTGCCTGCTTTGGCGGGCAGACACGCGGGCGCGATCCCACACAGGCTGGCGGGGGCCGGCCCC 2321 GAGGCCGCGTGCGTGAGAACCGCGCCGGTGTCCCCAGAGACCAGGCTGTGTCCCTCTTCTCTTCCCTGCGCCTGTGATGC 2401 TGGGCACTTCATCTGATCGGGGGCGTAGCATCATAGTAGTTTTTACAGCTGTGTTATTCTTTGCGTGTAGCTATGGAAGT 2481 TGCATAATTATTATTATTATTATTATAACAAGTGTGTCTTACGTGCCACCACGGCGTTGTACCTGTAGGACTCTCATTCG 2561 GGATGATTGGAATAGCTTCTGGAATTTGTTCAAGTTTTGGGTATGTTTAATCTGTTATGTACTAGTGTTCTGTTTGTTAT 2641 TGTTTTGTTAATTACACCATAATGCTAATTTAAAGAGACTCCAAATCTCAATGAAGCCAGCTCACAGTGCTGTGTGCCCC 2721 GGTCACCTAGCAAGCTGCCGAACCAAAAGAATTTGCACCCCGCTGCGGGCCCACGTGGTTGGGGCCCTGCCCTGGCAGGG 2801 TCATCCTGTGCTCGGAGGCCATCTCGGGCACAGGCCCACCCCGCCCCACCCCTCCAGAACACGGCTCACGCTTACCTCAA 2881 CCATCCTGGCTGCGGCGTCTGTCTGAACCACGCGGGGGCCTTGAGGGACGCTTTGTCTGTCGTGATGGGGCAAGGGCACA 2961 AGTCCTGGATGTTGTGTGTATCGAGAGGCCAAAGGCTGGTGGCAAGTGCACGGGGCACAGCGGAGTCTGTCCTGTGACGC 3041 GCAAGTCTGAGGGTCTGGGCGGCGGGCGGCTGGGTCTGTGCATTTCTGGTTGCACCGCGGCGCTTCCCAGCACCAACATG 3121 TAACCGGCATGTTTCCAGCAGAAGACAAAAAGACAAACATGAAAGTCTAGAAATAAAACTGGTAAAACCCCAAAAAAAAA 3201 AAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Liu Q; Fu H; Sun F; Zhang H; Tie Y; Zhu J; et al. - Nucleic acids research, 2008
MicroRNAs (miRNAs) are a class of small regulatory RNAs that are thought to be involved in diverse biological processes by regulating gene expression. Numerous miRNAs have been identified in various species, and many more miRNAs remain to be detected. Generally, hundreds of mRNAs have been predicted to be potential targets of one miRNA, so it is a great challenge to identify the genuine miRNA targets. Here, we generated the cell lines depleted of Drosha protein and screened dozens of transcripts (including Cyclin D1) regulated potentially by miRNA-mediated RNA silencing pathway. On the basis of miRNA expressing library, we established a miRNA targets reverse screening method by using luciferase reporter assay. By this method, we found that the expression of Cyclin D1 (CCND1) was regulated by miR-16 family directly, and miR-16 induced G1 arrest in A549 cells partially by CCND1. Furthermore, several other cell cycle genes were revealed to be regulated by miR-16 family, including Cyclin D3 (CCND3), Cyclin E1 (CCNE1) and CDK6. Taken together, our data suggests that miR-16 family triggers an accumulation of cells in G0/G1 by silencing multiple cell cycle genes simultaneously, rather than the individual target.
LinkOut: [PMID: 18701644]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Article |
- Xu T; Zhu Y; Xiong Y; Ge YY; Yun JP; Zhuang SM - Hepatology (Baltimore, Md.), 2009
UNLABELLED: Growing evidence indicates that deregulation of microRNAs (miRNAs) contributes to tumorigenesis. Down-regulation of miR-195 has been observed in various types of cancers. However, the biological function of miR-195 is still largely unknown. In this study we aimed to elucidate the pathophysiologic role of miR-195. Our results showed that miR-195 expression was significantly reduced in as high as 85.7% of hepatocellular carcinoma (HCC) tissues and in all of the five HCC cell lines examined. Moreover, introduction of miR-195 dramatically suppressed the ability of HCC and colorectal carcinoma cells to form colonies in vitro and to develop tumors in nude mice. Furthermore, ectopic expression of miR-195 blocked G(1)/S transition, whereas inhibition of miR-195 promoted cell cycle progression. Subsequent investigation characterized multiple G(1)/S transition-related molecules, including cyclin D1, CDK6, and E2F3, as direct targets of miR-195. Silencing of cyclin D1, CDK6, or E2F3 phenocopied the effect of miR-195, whereas overexpression of these proteins attenuated miR-195-induced G(1) arrest. In addition, miR-195 significantly repressed the phosphorylation of Rb as well as the transactivation of downstream target genes of E2F. These results imply that miR-195 may block the G(1)/S transition by repressing Rb-E2F signaling through targeting multiple molecules, including cyclin D1, CDK6, and E2F3. CONCLUSION: Our data highlight an important role of miR-195 in cell cycle control and in the molecular etiology of HCC, and implicate the potential application of miR-195 in cancer therapy.
LinkOut: [PMID: 19441017]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | 293T , LN-308 , LN-229 , A172 , T98G , U251 , LN-428 , U373 , U138 |
| Disease | 0.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan |
| Original Description (Extracted from the article) |
...
"We therefore performed luciferase reporter assays to de- termine whether CCND1
... - Zhang QQ; Xu H; Huang MB; Ma LM; Huang QJ; et al., 2012, Neuro-oncology. |
| Article |
- Zhang QQ; Xu H; Huang MB; Ma LM; Huang QJ; et al. - Neuro-oncology, 2012
Accumulating evidence has implicated the deregluation of miRNAs in tumorigenesis. Previous studies have reported that microRNA-195 (miR-195) is markedly down-regulated in human glioblastoma cells, compared with normal brain tissue, but the biological role of miR-195 in glioblastoma development is currently unknown. In this study, we define a tumor-suppressor role for miR-195 in human glioblastoma cells. Over-expression of miR-195 in glioblastoma cell lines robustly arrested cell cycle progression and significantly repressed cellular invasion. We identified E2F3 and CCND3 as functional downstream targets of miR-195 in glioblastoma cells. Through knockdown studies, we demonstrated that E2F3 was the dominant effector of miR-195-mediated cell cycle arrest and that CCND3 was a key mediator of miR-195-induced inhibition of glioblastoma cell invasion. Furthermore, we showed that p27(Kip1) was an important regulator downstream of CCND3 and that the accumulation of p27(Kip1) in the cytoplasm might be responsible for the miR-195-mediated cell invasion inhibition in glioblastoma cells. This work provides evidence for the initial mechanism by which miR-195 negatively regulates both the proliferation and invasion of glioblastoma cells, suggesting that the down-regulation of miR-195 might contribute to the malignant transformation of glioblastoma cells and could be a molecular signature associated with glioblastoma progression.
LinkOut: [PMID: 22217655]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | glioma cells |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan |
| Original Description (Extracted from the article) |
...
MicroRNA-195 Inhibits the Proliferation of Human Glioma Cells by Directly Targeting Cyclin D1 and Cyclin E1
... - Hui W; Yuntao L; Lun L; WenSheng L; et al., 2013, PloS one. |
| Article |
- Hui W; Yuntao L; Lun L; WenSheng L; et al. - PloS one, 2013
Glioma proliferation is a multistep process during which a sequence of genetic and epigenetic alterations randomly occur to affect the genes controlling cell proliferation, cell death and genetic stability. microRNAs are emerging as important epigenetic modulators of multiple target genes, leading to abnormal cellular signaling involving cellular proliferation in cancers.In the present study, we found that expression of miR-195 was markedly downregulated in glioma cell lines and human primary glioma tissues, compared to normal human astrocytes and matched non-tumor associated tissues. Upregulation of miR-195 dramatically reduced the proliferation of glioma cells. Flow cytometry analysis showed that ectopic expression of miR-195 significantly decreased the percentage of S phase cells and increased the percentage of G1/G0 phase cells. Overexpression of miR-195 dramatically reduced the anchorage-independent growth ability of glioma cells. Furthermore, overexpression of miR-195 downregulated the levels of phosphorylated retinoblastoma (pRb) and proliferating cell nuclear antigen (PCNA) in glioma cells. Conversely, inhibition of miR-195 promoted cell proliferation, increased the percentage of S phase cells, reduced the percentage of G1/G0 phase cells, enhanced anchorage-independent growth ability, upregulated the phosphorylation of pRb and PCNA in glioma cells. Moreover, we show that miR-195 inhibited glioma cell proliferation by downregulating expression of cyclin D1 and cyclin E1, via directly targeting the 3'-untranslated regions (3'-UTR) of cyclin D1 and cyclin E1 mRNA. Taken together, our results suggest that miR-195 plays an important role to inhibit the proliferation of glioma cells, and present a novel mechanism for direct miRNA-mediated suppression of cyclin D1 and cyclin E1 in glioma.
LinkOut: [PMID: 23383003]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | SCC-15 , CAL27 |
| Disease | MIMAT0000461 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan |
| Original Description (Extracted from the article) |
...
"Levels of miR-195 expression were inversely correlated with the expression of Cyclin D1 and Bcl-2. Overexpression of miR-195 inhibited cell cycle progression
... - Jia LF; Wei SB; Gong K; Gan YH; Yu GY, 2013, PloS one. |
| Article |
- Jia LF; Wei SB; Gong K; Gan YH; Yu GY - PloS one, 2013
BACKGROUND: miR-195 is aberrantly expressed in multiple types of disease. But little is known about the dysregulation of miR-195 in tongue squamous cell carcinoma (TSCC). In this study, we investigated the roles of miR-195 in the development and progression of TSCC. METHODS: Using quantitative reverse transcription-polymerase chain reaction (qRT-PCR), we evaluated miR-195 expression in TSCC samples from 81 patients. Overall survival of these patients was examined using Kaplan-Meier curves with log-rank tests and the Cox proportional hazards model. The expression of two known miR-195 target genes, Cyclin D1 and Bcl-2, was also examined in the TSCC samples by immunohistochemistry. The effects of miR-195 overexpression on cell cycle progression and apoptosis and its effects on the expression of Cyclin D1 and Bcl-2 were examined in transfected TSCC cell lines (SCC-15 and Cal27) using fluorescence-activated cell sorting assays, luciferase reporter assays, and Western blots. RESULTS: Reduced miR-195 expression was associated with tumor size and the clinical stage of TSCC tumors. Kaplan-Meier survival analysis indicated that the TSCC patients with reduced expression of miR-195 had poor overall survival and in multivariable analyses low levels of miR-195 emerged as an independent prognostic factor for this clinical outcome. Levels of miR-195 expression were inversely correlated with the expression of Cyclin D1 and Bcl-2. Overexpression of miR-195 inhibited cell cycle progression, promoted apoptosis, and reduced Cyclin D1 and Bcl-2 expression in two TSCC cell lines. CONCLUSIONS: miR-195 may have potential applications as a prognostic factor for TSCC patients.
LinkOut: [PMID: 23451060]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MDA-MB-231 , HEK293T |
| Disease | MIMAT0000461 |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , TargetScan , miRBase |
| Original Description (Extracted from the article) |
...
"This construct was transfected into 293T cells together with either miR-195-5p or NC mimics
... - Luo Q; Wei C; Li X; Li J; Chen L; Huang Y; et al., 2014, Oncology reports. |
| Article |
- Luo Q; Wei C; Li X; Li J; Chen L; Huang Y; et al. - Oncology reports, 2014
MicroRNAs (miRNAs) are a class of highly conserved, small endogenous single-strand non-coding RNAs. They are aberrantly expressed in the circulation and tissue of patients with cancer. Therefore, it has been suggested that they may act as key regulators of carcinogenesis. The aim of the present study was to examine the expression level of miR-195-5p in human breast cancer and its potential role in carcinogenesis. The expression level of miR-195-5p was measured in 40 breast cancer specimens and adjacent normal breast tissues by quantitative polymerase chain reaction (qPCR). Next, to explore the potential function of miR-195-5p, we used MDA-MB-231 human breast cancer cells and carried out MTT, colony formation, Transwell chamber migration and cell cycle assays. The dual-luciferase reporter assay was also performed to determine putative targets of miR-195-5p, which were validated using qPCR and western blot assays. We found that miR-195-5p expression was significantly decreased in the 40 breast cancer specimens when compared with that in the adjacent normal breast tissues (P<0.05). Overexpression of miR-195-5p inhibited cell proliferation, reduced cell colony formation, suppressed cell migration and caused an accumulation of cells in the G1 phase of the cell cycle. In the 3'-untranslated region (3'-UTR) of cyclin E1 (CCNE1), we found two putative target sites which may bind miR-195-5p, suggesting that CCNE1 is a direct target of miR-195-5p. Furthermore, through qPCR and western blot assays we showed that overexpression of miR-195-5p reduced CCNE1 mRNA and protein levels, respectively. Our study suggests that miR-195-5p may act as a tumor suppressor in breast cancer. Therefore, targeting of this miRNA may provide a novel strategy for the diagnosis and treatment of patients with this lethal disease.
LinkOut: [PMID: 24402230]
|
| Experimental Support 8 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | SOSP-9607 |
| Location of target site | 3'UTR |
| Tools used in this research | miRanda , PicTar , TargetScan |
| Original Description (Extracted from the article) |
...
CCND1 is a potential target gene of miR-195. CCND1 was identified as the target gene of miR-195 and further studied.
... - Han K; Chen X; Bian N; Ma B; Yang T; Cai C; et al., 2015, Oncotarget. |
| Article |
- Han K; Chen X; Bian N; Ma B; Yang T; Cai C; et al. - Oncotarget, 2015
Metastasis is a leading cause of mortality for osteosarcoma patients. The molecular pathological mechanism remains to be elucidated. In the previously study, we established two osteosarcoma cell lines with different metastatic potentials. Differential expressed genes and proteins regarding metastatic ability have been identified. MicroRNAs are important regulators in tumorigenesis and tumor progression. In this study, microRNA microarray was used to assess the differential expressed miRNAs level between these two cell lines. One of the top ranked miRNAs-miR-195 was identified highly expressing in lowly metastatic cells. It was showed that over-expression of miR-195 substantially inhibits migration and invasion of osteosarcoma cells in vitro and pulmonary metastasis formation in vivo. Meanwhile, CCND1 was identified as the target gene of miR-195 and further studied. More importantly, using real-time PCR, we evaluated the expression of miR-195 and CCND1 in osteosarcoma samples from 107 frozen biopsy tissues and 99 formalin- or paraformalin-fixed, paraffin-embedded (FFPE) tissues. Results indicated lowly expressed miR-195 or highly CCND1 correlated with positive overall survival and their expression inversely related to each other. In summary, our study suggests miR-195 functions as a tumor metastasis suppressor gene by down-regulating CCND1 and can be used as a potential target in the treatment of osteosarcoma.
LinkOut: [PMID: 25823925]
|
| CLIP-seq Support 1 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000227507.2 | 3UTR | AUCGCUUCUGUGUAUCUCUUUCACAUUGUUUGCUGCUAUUGGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
618 hsa-miR-195-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000222 | WEE1 | WEE1 G2 checkpoint kinase |  |
|
|
13 | 8 | |||||
| MIRT000223 | E2F3 | E2F transcription factor 3 | |
|
|
|
|
5 | 3 | |||
| MIRT000224 | CDK6 | cyclin dependent kinase 6 | |
|
|
|
|
|
6 | 4 | ||
| MIRT000225 | CCND1 | cyclin D1 | |
|
|
|
|
|
6 | 8 | ||
| MIRT000785 | BCL2L11 | BCL2 like 11 | |
|
2 | 1 | ||||||
| MIRT000795 | MECP2 | methyl-CpG binding protein 2 | |
|
2 | 1 | ||||||
| MIRT004273 | VEGFA | vascular endothelial growth factor A | |
|
|
|
|
7 | 16 | |||
| MIRT004390 | SKI | SKI proto-oncogene | |
|
|
|
4 | 4 | ||||
| MIRT004669 | CCL4 | C-C motif chemokine ligand 4 | |
|
|
3 | 1 | |||||
| MIRT004937 | KRT7 | keratin 7 | |
|
2 | 1 | ||||||
| MIRT005362 | BCL2 | BCL2, apoptosis regulator | |
|
|
|
|
5 | 3 | |||
| MIRT006077 | RAF1 | Raf-1 proto-oncogene, serine/threonine kinase | |
|
|
3 | 2 | |||||
| MIRT006080 | RUNX2 | runt related transcription factor 2 | |
|
|
3 | 1 | |||||
| MIRT006235 | SLC2A3 | solute carrier family 2 member 3 | |
|
|
|
4 | 5 | ||||
| MIRT006245 | TBCCD1 | TBCC domain containing 1 | |
|
|
3 | 2 | |||||
| MIRT006246 | CCND3 | cyclin D3 | |
|
2 | 2 | ||||||
| MIRT006252 | CDK4 | cyclin dependent kinase 4 | |
|
2 | 2 | ||||||
| MIRT006995 | CDC42 | cell division cycle 42 | |
|
|
3 | 2 | |||||
| MIRT007054 | CAB39 | calcium binding protein 39 | |
|
2 | 1 | ||||||
| MIRT007169 | CHUK | conserved helix-loop-helix ubiquitous kinase | |
1 | 1 | |||||||
| MIRT007170 | TAB3 | TGF-beta activated kinase 1 and MAP3K7 binding protein 3 | |
1 | 1 | |||||||
| MIRT007219 | MBD1 | methyl-CpG binding domain protein 1 | |
1 | 1 | |||||||
| MIRT007237 | CCNE1 | cyclin E1 | |
|
|
|
|
5 | 7 | |||
| MIRT007370 | BCL2L2 | BCL2 like 2 | |
|
2 | 1 | ||||||
| MIRT044858 | JAK2 | Janus kinase 2 | |
1 | 1 | |||||||
| MIRT044859 | CAMKV | CaM kinase like vesicle associated | |
1 | 1 | |||||||
| MIRT044860 | AGER | advanced glycosylation end-product specific receptor | |
1 | 1 | |||||||
| MIRT044861 | LSM11 | LSM11, U7 small nuclear RNA associated | |
|
2 | 4 | ||||||
| MIRT044862 | ABCB7 | ATP binding cassette subfamily B member 7 | |
1 | 1 | |||||||
| MIRT044863 | ZNF280C | zinc finger protein 280C | |
1 | 1 | |||||||
| MIRT044864 | SPTBN1 | spectrin beta, non-erythrocytic 1 | |
1 | 1 | |||||||
| MIRT044865 | NOLC1 | nucleolar and coiled-body phosphoprotein 1 | |
1 | 1 | |||||||
| MIRT044866 | CAND1 | cullin associated and neddylation dissociated 1 | |
1 | 1 | |||||||
| MIRT044867 | COPB1 | coatomer protein complex subunit beta 1 | |
1 | 1 | |||||||
| MIRT044868 | RPL10 | ribosomal protein L10 | |
1 | 1 | |||||||
| MIRT044869 | TMC6 | transmembrane channel like 6 | |
1 | 1 | |||||||
| MIRT044870 | TPI1 | triosephosphate isomerase 1 | |
1 | 1 | |||||||
| MIRT044871 | SH3BGRL2 | SH3 domain binding glutamate rich protein like 2 | |
1 | 1 | |||||||
| MIRT044872 | AGO1 | argonaute 1, RISC catalytic component | |
1 | 1 | |||||||
| MIRT053194 | DICER1 | dicer 1, ribonuclease III | |
|
|
3 | 2 | |||||
| MIRT053228 | FASN | fatty acid synthase | |
|
|
|
|
5 | 5 | |||
| MIRT053467 | ARL2 | ADP ribosylation factor like GTPase 2 | |
|
|
|
4 | 1 | ||||
| MIRT054417 | BIRC5 | baculoviral IAP repeat containing 5 | |
|
2 | 1 | ||||||
| MIRT054418 | WNT7A | Wnt family member 7A | |
|
2 | 1 | ||||||
| MIRT054890 | MYB | MYB proto-oncogene, transcription factor | |
|
|
3 | 1 | |||||
| MIRT054904 | ATG14 | autophagy related 14 | |
|
|
|
4 | 3 | ||||
| MIRT055424 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | |
|
2 | 11 | ||||||
| MIRT055817 | PLEKHA1 | pleckstrin homology domain containing A1 | |
|
2 | 2 | ||||||
| MIRT057517 | CEP55 | centrosomal protein 55 | |
|
2 | 8 | ||||||
| MIRT057735 | ZDHHC16 | zinc finger DHHC-type containing 16 | |
|
2 | 2 | ||||||
| MIRT057909 | STXBP3 | syntaxin binding protein 3 | |
1 | 1 | |||||||
| MIRT061007 | C1ORF21 | chromosome 1 open reading frame 21 | |
|
2 | 6 | ||||||
| MIRT061249 | AMOTL1 | angiomotin like 1 | |
|
2 | 12 | ||||||
| MIRT061531 | BTG2 | BTG anti-proliferation factor 2 | |
1 | 1 | |||||||
| MIRT063399 | ETNK1 | ethanolamine kinase 1 | |
1 | 1 | |||||||
| MIRT064688 | CCND2 | cyclin D2 | |
|
2 | 4 | ||||||
| MIRT065716 | TARBP2 | TARBP2, RISC loading complex RNA binding subunit | |
|
2 | 4 | ||||||
| MIRT066296 | MTFR1L | mitochondrial fission regulator 1 like | |
|
2 | 2 | ||||||
| MIRT066314 | USP15 | ubiquitin specific peptidase 15 | |
|
2 | 2 | ||||||
| MIRT068658 | AKAP11 | A-kinase anchoring protein 11 | |
1 | 1 | |||||||
| MIRT071211 | FCF1 | FCF1, rRNA-processing protein | |
|
2 | 2 | ||||||
| MIRT072825 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | |
|
2 | 5 | ||||||
| MIRT074533 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | |
|
2 | 4 | ||||||
| MIRT075254 | SNTB2 | syntrophin beta 2 | |
|
2 | 4 | ||||||
| MIRT075277 | VPS4A | vacuolar protein sorting 4 homolog A | |
|
2 | 8 | ||||||
| MIRT075896 | C16ORF72 | chromosome 16 open reading frame 72 | |
|
2 | 7 | ||||||
| MIRT076795 | GOSR1 | golgi SNAP receptor complex member 1 | |
|
2 | 2 | ||||||
| MIRT077785 | MINK1 | misshapen like kinase 1 | |
1 | 1 | |||||||
| MIRT078285 | RPS6KB1 | ribosomal protein S6 kinase B1 | |
|
|
|
|
5 | 3 | |||
| MIRT079658 | NAPG | NSF attachment protein gamma | |
|
2 | 12 | ||||||
| MIRT080014 | GALNT1 | polypeptide N-acetylgalactosaminyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT082988 | PNPLA6 | patatin like phospholipase domain containing 6 | |
|
2 | 2 | ||||||
| MIRT083269 | ZCCHC3 | zinc finger CCHC-type containing 3 | |
|
2 | 6 | ||||||
| MIRT084465 | SOWAHC | sosondowah ankyrin repeat domain family member C | |
|
2 | 4 | ||||||
| MIRT085217 | CCNT2 | cyclin T2 | |
1 | 1 | |||||||
| MIRT086012 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | |
|
2 | 2 | ||||||
| MIRT087426 | ZNRF3 | zinc and ring finger 3 | |
|
2 | 2 | ||||||
| MIRT087557 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | |
|
2 | 2 | ||||||
| MIRT088106 | SEPT2 | septin 2 | |
1 | 1 | |||||||
| MIRT089111 | B3GNT2 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 | |
|
2 | 4 | ||||||
| MIRT089211 | ACTR2 | ARP2 actin related protein 2 homolog | |
|
2 | 3 | ||||||
| MIRT090450 | CDV3 | CDV3 homolog | |
1 | 1 | |||||||
| MIRT090691 | U2SURP | U2 snRNP associated SURP domain containing | |
1 | 1 | |||||||
| MIRT091673 | RARB | retinoic acid receptor beta | |
|
2 | 6 | ||||||
| MIRT092195 | ITPR1 | inositol 1,4,5-trisphosphate receptor type 1 | |
1 | 1 | |||||||
| MIRT092213 | BHLHE40 | basic helix-loop-helix family member e40 | |
1 | 1 | |||||||
| MIRT093687 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | |
|
2 | 6 | ||||||
| MIRT095434 | PURA | purine rich element binding protein A | |
1 | 1 | |||||||
| MIRT096238 | CANX | calnexin | |
|
2 | 2 | ||||||
| MIRT098830 | PCMT1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase | |
1 | 1 | |||||||
| MIRT100210 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | |
|
2 | 2 | ||||||
| MIRT100368 | HSPA1B | heat shock protein family A (Hsp70) member 1B | |
|
2 | 7 | ||||||
| MIRT100571 | PIM1 | Pim-1 proto-oncogene, serine/threonine kinase | |
|
2 | 2 | ||||||
| MIRT100899 | CD2AP | CD2 associated protein | |
|
2 | 2 | ||||||
| MIRT102439 | CALU | calumenin | |
|
2 | 3 | ||||||
| MIRT102635 | UBN2 | ubinuclein 2 | |
|
2 | 11 | ||||||
| MIRT102973 | EN2 | engrailed homeobox 2 | |
|
2 | 6 | ||||||
| MIRT103096 | MAFK | MAF bZIP transcription factor K | |
|
2 | 5 | ||||||
| MIRT103858 | FOXK1 | forkhead box K1 | |
|
2 | 3 | ||||||
| MIRT104019 | USP42 | ubiquitin specific peptidase 42 | |
|
2 | 6 | ||||||
| MIRT104235 | DMTF1 | cyclin D binding myb like transcription factor 1 | |
|
2 | 3 | ||||||
| MIRT106297 | ZFHX4 | zinc finger homeobox 4 | |
|
2 | 6 | ||||||
| MIRT106736 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | |
|
2 | 3 | ||||||
| MIRT107220 | ZBTB34 | zinc finger and BTB domain containing 34 | |
|
2 | 2 | ||||||
| MIRT107688 | RECK | reversion inducing cysteine rich protein with kazal motifs | |
|
2 | 2 | ||||||
| MIRT108985 | SLC9A6 | solute carrier family 9 member A6 | |
1 | 1 | |||||||
| MIRT109244 | ZNF275 | zinc finger protein 275 | |
|
2 | 2 | ||||||
| MIRT110056 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | |
|
2 | 7 | ||||||
| MIRT112974 | LUZP1 | leucine zipper protein 1 | |
|
2 | 6 | ||||||
| MIRT114927 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
|
2 | 2 | ||||||
| MIRT117659 | SCAMP4 | secretory carrier membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT120683 | PAK2 | p21 (RAC1) activated kinase 2 | |
|
2 | 2 | ||||||
| MIRT125925 | PDCD4 | programmed cell death 4 | |
1 | 1 | |||||||
| MIRT127735 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
|
2 | 3 | ||||||
| MIRT128805 | UBE4A | ubiquitination factor E4A | |
1 | 1 | |||||||
| MIRT129059 | ARCN1 | archain 1 | |
1 | 1 | |||||||
| MIRT130383 | PTPRJ | protein tyrosine phosphatase, receptor type J | |
1 | 1 | |||||||
| MIRT131102 | TMEM138 | transmembrane protein 138 | |
1 | 1 | |||||||
| MIRT132746 | RASSF5 | Ras association domain family member 5 | |
1 | 1 | |||||||
| MIRT132836 | MAPKAPK2 | mitogen-activated protein kinase-activated protein kinase 2 | |
1 | 1 | |||||||
| MIRT133339 | BCL7A | BCL tumor suppressor 7A | |
1 | 1 | |||||||
| MIRT137521 | RCOR1 | REST corepressor 1 | |
1 | 1 | |||||||
| MIRT140151 | SPRED1 | sprouty related EVH1 domain containing 1 | |
|
2 | 3 | ||||||
| MIRT140827 | SMAD3 | SMAD family member 3 | |
1 | 1 | |||||||
| MIRT141246 | SCAMP5 | secretory carrier membrane protein 5 | |
1 | 1 | |||||||
| MIRT141285 | UBE2Q2 | ubiquitin conjugating enzyme E2 Q2 | |
1 | 1 | |||||||
| MIRT142244 | DCTN5 | dynactin subunit 5 | |
|
2 | 9 | ||||||
| MIRT144030 | PSKH1 | protein serine kinase H1 | |
1 | 1 | |||||||
| MIRT145386 | ANKRD13B | ankyrin repeat domain 13B | |
1 | 1 | |||||||
| MIRT146023 | EZH1 | enhancer of zeste 1 polycomb repressive complex 2 subunit | |
1 | 1 | |||||||
| MIRT146359 | PNPO | pyridoxamine 5'-phosphate oxidase | |
1 | 1 | |||||||
| MIRT146502 | SNX11 | sorting nexin 11 | |
1 | 1 | |||||||
| MIRT148310 | RNF138 | ring finger protein 138 | |
1 | 1 | |||||||
| MIRT150358 | IER2 | immediate early response 2 | |
1 | 1 | |||||||
| MIRT152285 | TNFSF9 | TNF superfamily member 9 | |
|
2 | 3 | ||||||
| MIRT152512 | ENTPD6 | ectonucleoside triphosphate diphosphohydrolase 6 (putative) | |
1 | 1 | |||||||
| MIRT152753 | KIF3B | kinesin family member 3B | |
1 | 1 | |||||||
| MIRT152932 | NOL4L | nucleolar protein 4 like | |
|
2 | 3 | ||||||
| MIRT154051 | RASSF2 | Ras association domain family member 2 | |
|
2 | 2 | ||||||
| MIRT154403 | CDS2 | CDP-diacylglycerol synthase 2 | |
1 | 1 | |||||||
| MIRT156463 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | |
|
2 | 2 | ||||||
| MIRT158529 | TNRC6B | trinucleotide repeat containing 6B | |
|
2 | 5 | ||||||
| MIRT159005 | EPT1 | selenoprotein I | |
1 | 1 | |||||||
| MIRT159592 | PEX13 | peroxisomal biogenesis factor 13 | |
1 | 1 | |||||||
| MIRT160173 | TET3 | tet methylcytosine dioxygenase 3 | |
1 | 1 | |||||||
| MIRT163261 | PRKCD | protein kinase C delta | |
1 | 1 | |||||||
| MIRT164271 | CPEB2 | cytoplasmic polyadenylation element binding protein 2 | |
1 | 1 | |||||||
| MIRT164961 | TADA2B | transcriptional adaptor 2B | |
1 | 1 | |||||||
| MIRT165180 | GRAMD3 | GRAM domain containing 2B | |
|
2 | 3 | ||||||
| MIRT165896 | CREBRF | CREB3 regulatory factor | |
|
2 | 3 | ||||||
| MIRT168591 | HMGA1 | high mobility group AT-hook 1 | |
|
|
3 | 2 | |||||
| MIRT168685 | CDKN1A | cyclin dependent kinase inhibitor 1A | |
1 | 1 | |||||||
| MIRT169070 | IRF4 | interferon regulatory factor 4 | |
1 | 1 | |||||||
| MIRT170158 | KLHDC10 | kelch domain containing 10 | |
1 | 1 | |||||||
| MIRT170740 | UBE3C | ubiquitin protein ligase E3C | |
1 | 1 | |||||||
| MIRT171604 | SUN1 | Sad1 and UNC84 domain containing 1 | |
1 | 1 | |||||||
| MIRT172819 | HMBOX1 | homeobox containing 1 | |
1 | 1 | |||||||
| MIRT174792 | RNF38 | ring finger protein 38 | |
1 | 1 | |||||||
| MIRT175236 | PSAT1 | phosphoserine aminotransferase 1 | |
|
2 | 7 | ||||||
| MIRT175527 | ZBTB33 | zinc finger and BTB domain containing 33 | |
1 | 1 | |||||||
| MIRT179012 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT180911 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 8 | ||||||
| MIRT186374 | PNRC2 | proline rich nuclear receptor coactivator 2 | |
|
2 | 2 | ||||||
| MIRT189763 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT189964 | AGO4 | argonaute 4, RISC catalytic component | |
|
|
3 | 2 | |||||
| MIRT190187 | GPR180 | G protein-coupled receptor 180 | |
|
2 | 6 | ||||||
| MIRT191457 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | |
|
2 | 2 | ||||||
| MIRT191628 | SLC39A9 | solute carrier family 39 member 9 | |
|
2 | 6 | ||||||
| MIRT194241 | FAM103A1 | family with sequence similarity 103 member A1 | |
|
2 | 6 | ||||||
| MIRT194907 | RBBP6 | RB binding protein 6, ubiquitin ligase | |
|
2 | 8 | ||||||
| MIRT196278 | PAFAH1B1 | platelet activating factor acetylhydrolase 1b regulatory subunit 1 | |
1 | 1 | |||||||
| MIRT196455 | TAOK1 | TAO kinase 1 | |
|
2 | 2 | ||||||
| MIRT201458 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | |
|
2 | 8 | ||||||
| MIRT204596 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | |
|
2 | 8 | ||||||
| MIRT204627 | MOB4 | MOB family member 4, phocein | |
|
2 | 8 | ||||||
| MIRT204743 | BZW1 | basic leucine zipper and W2 domains 1 | |
|
2 | 12 | ||||||
| MIRT206022 | NUP50 | nucleoporin 50 | |
|
2 | 7 | ||||||
| MIRT211200 | FGF2 | fibroblast growth factor 2 | |
|
|
|
|
5 | 4 | |||
| MIRT211316 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | |
|
2 | 4 | ||||||
| MIRT212610 | RBPJ | recombination signal binding protein for immunoglobulin kappa J region | |
|
2 | 8 | ||||||
| MIRT217747 | TBPL1 | TATA-box binding protein like 1 | |
|
2 | 3 | ||||||
| MIRT223692 | FZD6 | frizzled class receptor 6 | |
|
2 | 6 | ||||||
| MIRT224968 | BAG4 | BCL2 associated athanogene 4 | |
|
2 | 2 | ||||||
| MIRT229349 | ZNF449 | zinc finger protein 449 | |
|
2 | 2 | ||||||
| MIRT229863 | YIPF6 | Yip1 domain family member 6 | |
|
2 | 2 | ||||||
| MIRT230122 | DDX3Y | DEAD-box helicase 3, Y-linked | |
1 | 1 | |||||||
| MIRT234345 | MSL1 | male specific lethal 1 homolog | |
|
2 | 8 | ||||||
| MIRT245006 | ENTPD7 | ectonucleoside triphosphate diphosphohydrolase 7 | |
1 | 1 | |||||||
| MIRT246940 | PRRC2C | proline rich coiled-coil 2C | |
1 | 1 | |||||||
| MIRT247239 | ELK4 | ELK4, ETS transcription factor | |
|
2 | 4 | ||||||
| MIRT247370 | GABARAPL1 | GABA type A receptor associated protein like 1 | |
|
2 | 6 | ||||||
| MIRT248555 | PDIK1L | PDLIM1 interacting kinase 1 like | |
1 | 1 | |||||||
| MIRT248768 | ATXN7L3B | ataxin 7 like 3B | |
|
2 | 4 | ||||||
| MIRT249452 | ZNF691 | zinc finger protein 691 | |
|
2 | 4 | ||||||
| MIRT251494 | DYNLL2 | dynein light chain LC8-type 2 | |
|
2 | 4 | ||||||
| MIRT255337 | SRPRB | SRP receptor beta subunit | |
|
2 | 5 | ||||||
| MIRT256310 | CDC42SE2 | CDC42 small effector 2 | |
|
2 | 2 | ||||||
| MIRT258413 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | |
|
2 | 3 | ||||||
| MIRT265058 | TBRG1 | transforming growth factor beta regulator 1 | |
|
2 | 2 | ||||||
| MIRT265078 | CHEK1 | checkpoint kinase 1 | |
|
|
|
|
5 | 4 | |||
| MIRT267256 | TMEM109 | transmembrane protein 109 | |
1 | 1 | |||||||
| MIRT267531 | C1ORF226 | chromosome 1 open reading frame 226 | |
|
2 | 2 | ||||||
| MIRT270456 | SIRT4 | sirtuin 4 | |
1 | 1 | |||||||
| MIRT270555 | SETD1B | SET domain containing 1B | |
|
2 | 2 | ||||||
| MIRT273668 | HOXC8 | homeobox C8 | |
|
2 | 2 | ||||||
| MIRT274744 | RAB3IP | RAB3A interacting protein | |
|
2 | 2 | ||||||
| MIRT277508 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | |
|
2 | 4 | ||||||
| MIRT282537 | SLCO3A1 | solute carrier organic anion transporter family member 3A1 | |
|
2 | 2 | ||||||
| MIRT286970 | MLLT6 | MLLT6, PHD finger containing | |
1 | 1 | |||||||
| MIRT289633 | CBX2 | chromobox 2 | |
|
2 | 2 | ||||||
| MIRT294286 | ZFP28 | ZFP28 zinc finger protein | |
|
2 | 2 | ||||||
| MIRT295814 | CHMP4B | charged multivesicular body protein 4B | |
|
2 | 2 | ||||||
| MIRT297781 | GABPA | GA binding protein transcription factor alpha subunit | |
|
2 | 4 | ||||||
| MIRT300108 | STRADB | STE20-related kinase adaptor beta | |
|
|
|
4 | 3 | ||||
| MIRT300997 | MTMR3 | myotubularin related protein 3 | |
|
2 | 2 | ||||||
| MIRT302617 | CRIM1 | cysteine rich transmembrane BMP regulator 1 | |
|
2 | 6 | ||||||
| MIRT302828 | SOCS5 | suppressor of cytokine signaling 5 | |
|
2 | 2 | ||||||
| MIRT307144 | CTDSPL | CTD small phosphatase like | |
|
2 | 4 | ||||||
| MIRT313678 | ITGA2 | integrin subunit alpha 2 | |
|
2 | 2 | ||||||
| MIRT314054 | PIK3R1 | phosphoinositide-3-kinase regulatory subunit 1 | |
|
2 | 8 | ||||||
| MIRT317724 | PPIL1 | peptidylprolyl isomerase like 1 | |
|
2 | 7 | ||||||
| MIRT319334 | CAPZA2 | capping actin protein of muscle Z-line alpha subunit 2 | |
|
2 | 2 | ||||||
| MIRT320630 | ZNRF2 | zinc and ring finger 2 | |
|
2 | 2 | ||||||
| MIRT324841 | IFT74 | intraflagellar transport 74 | |
1 | 1 | |||||||
| MIRT326305 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | |
|
2 | 2 | ||||||
| MIRT327966 | CHIC1 | cysteine rich hydrophobic domain 1 | |
|
2 | 6 | ||||||
| MIRT367267 | CRKL | CRK like proto-oncogene, adaptor protein | |
|
2 | 2 | ||||||
| MIRT437657 | ALOX12 | arachidonate 12-lipoxygenase, 12S type | |
|
2 | 1 | ||||||
| MIRT437658 | PHACTR2 | phosphatase and actin regulator 2 | |
|
2 | 1 | ||||||
| MIRT437659 | CGNL1 | cingulin like 1 | |
|
2 | 1 | ||||||
| MIRT437660 | KIF21A | kinesin family member 21A | |
|
2 | 1 | ||||||
| MIRT437661 | RASGEF1B | RasGEF domain family member 1B | |
|
2 | 1 | ||||||
| MIRT437662 | TUFT1 | tuftelin 1 | |
|
2 | 1 | ||||||
| MIRT437663 | PDIA6 | protein disulfide isomerase family A member 6 | |
|
|
|
4 | 5 | ||||
| MIRT437664 | SNX16 | sorting nexin 16 | |
|
|
|
4 | 7 | ||||
| MIRT437665 | TRIP10 | thyroid hormone receptor interactor 10 | |
|
2 | 1 | ||||||
| MIRT437792 | CDC25A | cell division cycle 25A | |
|
|
|
4 | 4 | ||||
| MIRT437793 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | |
|
|
3 | 2 | |||||
| MIRT438296 | INSR | insulin receptor | |
|
|
3 | 1 | |||||
| MIRT438377 | ELN | elastin | |
|
|
3 | 1 | |||||
| MIRT438609 | RET | ret proto-oncogene | |
1 | 1 | |||||||
| MIRT438896 | Bace1 | beta-secretase 1 | |
1 | 1 | |||||||
| MIRT443814 | SIDT2 | SID1 transmembrane family member 2 | |
|
2 | 2 | ||||||
| MIRT446505 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | |
|
2 | 2 | ||||||
| MIRT447775 | DMRT2 | doublesex and mab-3 related transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT448444 | TLL1 | tolloid like 1 | |
|
2 | 2 | ||||||
| MIRT449187 | LUC7L3 | LUC7 like 3 pre-mRNA splicing factor | |
|
2 | 2 | ||||||
| MIRT451836 | ALDH3B1 | aldehyde dehydrogenase 3 family member B1 | |
|
2 | 2 | ||||||
| MIRT453285 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | |
|
2 | 2 | ||||||
| MIRT453751 | CSNK1E | casein kinase 1 epsilon | |
|
2 | 2 | ||||||
| MIRT454967 | TPM2 | tropomyosin 2 | |
|
2 | 2 | ||||||
| MIRT456864 | ZNF460 | zinc finger protein 460 | |
|
2 | 10 | ||||||
| MIRT460221 | FGFR4 | fibroblast growth factor receptor 4 | |
|
2 | 2 | ||||||
| MIRT460435 | DOCK11 | dedicator of cytokinesis 11 | |
|
2 | 2 | ||||||
| MIRT461561 | ACTR3B | ARP3 actin related protein 3 homolog B | |
|
2 | 2 | ||||||
| MIRT463166 | ZNF367 | zinc finger protein 367 | |
|
2 | 10 | ||||||
| MIRT464664 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | |
|
2 | 8 | ||||||
| MIRT464747 | UBE2Q1 | ubiquitin conjugating enzyme E2 Q1 | |
|
2 | 3 | ||||||
| MIRT465164 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT465567 | TOB2 | transducer of ERBB2, 2 | |
|
2 | 2 | ||||||
| MIRT465928 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
|
2 | 8 | ||||||
| MIRT466011 | TMEM189 | transmembrane protein 189 | |
|
2 | 8 | ||||||
| MIRT466295 | TM4SF1 | transmembrane 4 L six family member 1 | |
|
2 | 2 | ||||||
| MIRT466434 | TFAP2A | transcription factor AP-2 alpha | |
|
2 | 8 | ||||||
| MIRT466919 | STK38 | serine/threonine kinase 38 | |
|
2 | 10 | ||||||
| MIRT466999 | SSRP1 | structure specific recognition protein 1 | |
|
2 | 5 | ||||||
| MIRT468056 | SIK1 | salt inducible kinase 1 | |
|
2 | 3 | ||||||
| MIRT468148 | SH3BP4 | SH3 domain binding protein 4 | |
|
2 | 2 | ||||||
| MIRT468678 | SEC24A | SEC24 homolog A, COPII coat complex component | |
|
2 | 4 | ||||||
| MIRT469087 | RNF168 | ring finger protein 168 | |
|
2 | 2 | ||||||
| MIRT469412 | REL | REL proto-oncogene, NF-kB subunit | |
|
2 | 6 | ||||||
| MIRT471036 | PISD | phosphatidylserine decarboxylase | |
|
2 | 10 | ||||||
| MIRT471493 | PDE4D | phosphodiesterase 4D | |
|
2 | 4 | ||||||
| MIRT471953 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | |
|
2 | 2 | ||||||
| MIRT472264 | NFIC | nuclear factor I C | |
|
2 | 2 | ||||||
| MIRT472666 | NAA25 | N(alpha)-acetyltransferase 25, NatB auxiliary subunit | |
|
2 | 4 | ||||||
| MIRT474317 | LAMC1 | laminin subunit gamma 1 | |
|
2 | 2 | ||||||
| MIRT474832 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | |
|
2 | 2 | ||||||
| MIRT475066 | IVNS1ABP | influenza virus NS1A binding protein | |
|
2 | 6 | ||||||
| MIRT475120 | IPPK | inositol-pentakisphosphate 2-kinase | |
|
2 | 2 | ||||||
| MIRT475536 | HOXA3 | homeobox A3 | |
|
2 | 8 | ||||||
| MIRT475717 | HEYL | hes related family bHLH transcription factor with YRPW motif-like | |
|
2 | 2 | ||||||
| MIRT475840 | HDGF | heparin binding growth factor | |
|
2 | 4 | ||||||
| MIRT476257 | GNB1 | G protein subunit beta 1 | |
|
2 | 7 | ||||||
| MIRT476274 | GNAL | G protein subunit alpha L | |
|
2 | 6 | ||||||
| MIRT476697 | FURIN | furin, paired basic amino acid cleaving enzyme | |
|
2 | 2 | ||||||
| MIRT477562 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | |
|
2 | 8 | ||||||
| MIRT477846 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | |
|
2 | 2 | ||||||
| MIRT478909 | CPSF7 | cleavage and polyadenylation specific factor 7 | |
|
2 | 6 | ||||||
| MIRT479985 | CARD10 | caspase recruitment domain family member 10 | |
|
2 | 2 | ||||||
| MIRT481180 | AVL9 | AVL9 cell migration associated | |
|
2 | 6 | ||||||
| MIRT482115 | AKT3 | AKT serine/threonine kinase 3 | |
|
2 | 4 | ||||||
| MIRT482372 | AGO2 | argonaute 2, RISC catalytic component | |
|
2 | 2 | ||||||
| MIRT482552 | ABL2 | ABL proto-oncogene 2, non-receptor tyrosine kinase | |
|
2 | 10 | ||||||
| MIRT482579 | ABHD2 | abhydrolase domain containing 2 | |
|
2 | 2 | ||||||
| MIRT484775 | ABCC6 | ATP binding cassette subfamily C member 6 | |
|
2 | 4 | ||||||
| MIRT485217 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | |
|
2 | 8 | ||||||
| MIRT487391 | C10orf54 | V-set immunoregulatory receptor | |
|
2 | 2 | ||||||
| MIRT492712 | PHYHIP | phytanoyl-CoA 2-hydroxylase interacting protein | |
|
2 | 2 | ||||||
| MIRT494349 | CASKIN1 | CASK interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT495144 | ZNRF1 | zinc and ring finger 1 | |
|
2 | 2 | ||||||
| MIRT496016 | CD180 | CD180 molecule | |
|
2 | 2 | ||||||
| MIRT497773 | KIAA0895 | KIAA0895 | |
|
2 | 2 | ||||||
| MIRT498981 | ORC4 | origin recognition complex subunit 4 | |
|
2 | 8 | ||||||
| MIRT499453 | ODF2L | outer dense fiber of sperm tails 2 like | |
|
2 | 8 | ||||||
| MIRT499617 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | |
|
2 | 8 | ||||||
| MIRT500094 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | |
|
2 | 8 | ||||||
| MIRT500323 | ZNF622 | zinc finger protein 622 | |
|
2 | 9 | ||||||
| MIRT500421 | ZMAT3 | zinc finger matrin-type 3 | |
|
2 | 4 | ||||||
| MIRT500577 | USP53 | ubiquitin specific peptidase 53 | |
|
2 | 2 | ||||||
| MIRT500862 | SYPL1 | synaptophysin like 1 | |
|
2 | 8 | ||||||
| MIRT500939 | SRPR | SRP receptor alpha subunit | |
|
2 | 7 | ||||||
| MIRT500950 | SREK1 | splicing regulatory glutamic acid and lysine rich protein 1 | |
|
2 | 8 | ||||||
| MIRT501086 | SMAD7 | SMAD family member 7 | |
|
|
3 | 9 | |||||
| MIRT501503 | PRICKLE2 | prickle planar cell polarity protein 2 | |
|
2 | 2 | ||||||
| MIRT502037 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | |
|
2 | 2 | ||||||
| MIRT502149 | KIF5B | kinesin family member 5B | |
|
2 | 9 | ||||||
| MIRT502499 | FAM122B | family with sequence similarity 122B | |
|
2 | 8 | ||||||
| MIRT502569 | E2F7 | E2F transcription factor 7 | |
|
2 | 11 | ||||||
| MIRT502647 | DDX3X | DEAD-box helicase 3, X-linked | |
|
2 | 8 | ||||||
| MIRT502917 | CDCA4 | cell division cycle associated 4 | |
|
2 | 9 | ||||||
| MIRT502949 | CDC37L1 | cell division cycle 37 like 1 | |
|
2 | 9 | ||||||
| MIRT503145 | ATG9A | autophagy related 9A | |
|
2 | 7 | ||||||
| MIRT504335 | ASGR2 | asialoglycoprotein receptor 2 | |
|
2 | 6 | ||||||
| MIRT504537 | ZNF620 | zinc finger protein 620 | |
|
2 | 6 | ||||||
| MIRT504853 | HAUS3 | HAUS augmin like complex subunit 3 | |
|
2 | 6 | ||||||
| MIRT505117 | YTHDC1 | YTH domain containing 1 | |
|
2 | 6 | ||||||
| MIRT505347 | TMEM245 | transmembrane protein 245 | |
|
2 | 6 | ||||||
| MIRT505397 | TMEM100 | transmembrane protein 100 | |
|
2 | 2 | ||||||
| MIRT505503 | SRSF1 | serine and arginine rich splicing factor 1 | |
|
2 | 6 | ||||||
| MIRT505685 | SESTD1 | SEC14 and spectrin domain containing 1 | |
|
2 | 6 | ||||||
| MIRT505909 | RIMS3 | regulating synaptic membrane exocytosis 3 | |
|
2 | 6 | ||||||
| MIRT505927 | RCAN3 | RCAN family member 3 | |
|
2 | 4 | ||||||
| MIRT506109 | PPIG | peptidylprolyl isomerase G | |
|
2 | 6 | ||||||
| MIRT506134 | PLRG1 | pleiotropic regulator 1 | |
|
2 | 4 | ||||||
| MIRT506167 | PLAG1 | PLAG1 zinc finger | |
|
2 | 9 | ||||||
| MIRT506193 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | |
|
2 | 6 | ||||||
| MIRT506489 | MYO5A | myosin VA | |
|
2 | 7 | ||||||
| MIRT506855 | KIF23 | kinesin family member 23 | |
|
2 | 7 | ||||||
| MIRT507000 | HNRNPDL | heterogeneous nuclear ribonucleoprotein D like | |
|
2 | 6 | ||||||
| MIRT507821 | CDK1 | cyclin dependent kinase 1 | |
|
2 | 6 | ||||||
| MIRT507851 | CCNE2 | cyclin E2 | |
|
2 | 6 | ||||||
| MIRT507880 | CBX6 | chromobox 6 | |
|
2 | 2 | ||||||
| MIRT508038 | AXIN2 | axin 2 | |
|
2 | 6 | ||||||
| MIRT508642 | CASK | calcium/calmodulin dependent serine protein kinase | |
|
2 | 5 | ||||||
| MIRT509365 | DMPK | DM1 protein kinase | |
|
2 | 11 | ||||||
| MIRT509691 | ATAD5 | ATPase family, AAA domain containing 5 | |
|
2 | 4 | ||||||
| MIRT510044 | AKR1B10 | aldo-keto reductase family 1 member B10 | |
|
2 | 4 | ||||||
| MIRT511844 | GPATCH8 | G-patch domain containing 8 | |
|
2 | 5 | ||||||
| MIRT512284 | ARHGDIA | Rho GDP dissociation inhibitor alpha | |
|
2 | 7 | ||||||
| MIRT512643 | CPEB3 | cytoplasmic polyadenylation element binding protein 3 | |
|
2 | 5 | ||||||
| MIRT513859 | JARID2 | jumonji and AT-rich interaction domain containing 2 | |
|
2 | 8 | ||||||
| MIRT514023 | CAMSAP1 | calmodulin regulated spectrin associated protein 1 | |
|
2 | 5 | ||||||
| MIRT518092 | TRIM35 | tripartite motif containing 35 | |
|
2 | 2 | ||||||
| MIRT518531 | FLCN | folliculin | |
|
2 | 6 | ||||||
| MIRT518995 | NNT | nicotinamide nucleotide transhydrogenase | |
|
2 | 4 | ||||||
| MIRT521204 | SBNO1 | strawberry notch homolog 1 | |
|
2 | 6 | ||||||
| MIRT521813 | POM121C | POM121 transmembrane nucleoporin C | |
|
2 | 2 | ||||||
| MIRT522101 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 5 | ||||||
| MIRT522776 | LAMP2 | lysosomal associated membrane protein 2 | |
|
2 | 6 | ||||||
| MIRT537816 | EFNB2 | ephrin B2 | |
|
2 | 4 | ||||||
| MIRT539900 | RPL14 | ribosomal protein L14 | |
|
2 | 4 | ||||||
| MIRT540844 | GNAT1 | G protein subunit alpha transducin 1 | |
|
2 | 4 | ||||||
| MIRT541220 | HOXA10 | homeobox A10 | |
|
2 | 2 | ||||||
| MIRT541431 | CBX4 | chromobox 4 | |
|
|
|
|
5 | 4 | |||
| MIRT542807 | PHC3 | polyhomeotic homolog 3 | |
|
2 | 3 | ||||||
| MIRT542834 | PDCD1 | programmed cell death 1 | |
|
2 | 7 | ||||||
| MIRT543060 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | |
|
2 | 2 | ||||||
| MIRT543080 | APP | amyloid beta precursor protein | |
|
2 | 2 | ||||||
| MIRT543307 | ZNF585B | zinc finger protein 585B | |
|
2 | 2 | ||||||
| MIRT543409 | ANAPC13 | anaphase promoting complex subunit 13 | |
|
2 | 2 | ||||||
| MIRT543526 | PRSS21 | protease, serine 21 | |
|
2 | 2 | ||||||
| MIRT543798 | RALGAPB | Ral GTPase activating protein non-catalytic beta subunit | |
|
2 | 4 | ||||||
| MIRT543836 | GSG1 | germ cell associated 1 | |
|
2 | 2 | ||||||
| MIRT544572 | POLDIP3 | DNA polymerase delta interacting protein 3 | |
|
2 | 2 | ||||||
| MIRT544590 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | |
|
2 | 4 | ||||||
| MIRT544913 | CLSPN | claspin | |
|
2 | 2 | ||||||
| MIRT544966 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | |
|
2 | 2 | ||||||
| MIRT545187 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | |
|
2 | 4 | ||||||
| MIRT545348 | CCDC83 | coiled-coil domain containing 83 | |
|
2 | 2 | ||||||
| MIRT545683 | DECR1 | 2,4-dienoyl-CoA reductase 1 | |
|
2 | 2 | ||||||
| MIRT545956 | ZBTB10 | zinc finger and BTB domain containing 10 | |
|
2 | 2 | ||||||
| MIRT545976 | YWHAQ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta | |
|
2 | 2 | ||||||
| MIRT546115 | USP48 | ubiquitin specific peptidase 48 | |
|
2 | 4 | ||||||
| MIRT546606 | SALL1 | spalt like transcription factor 1 | |
|
2 | 4 | ||||||
| MIRT546618 | RUNX1T1 | RUNX1 translocation partner 1 | |
|
2 | 2 | ||||||
| MIRT546637 | RTN4 | reticulon 4 | |
|
2 | 2 | ||||||
| MIRT547064 | PNISR | PNN interacting serine and arginine rich protein | |
|
2 | 3 | ||||||
| MIRT547129 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | |
|
2 | 2 | ||||||
| MIRT547232 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | |
|
2 | 4 | ||||||
| MIRT547301 | NUCKS1 | nuclear casein kinase and cyclin dependent kinase substrate 1 | |
|
2 | 3 | ||||||
| MIRT547410 | MKX | mohawk homeobox | |
|
2 | 2 | ||||||
| MIRT547461 | MBD4 | methyl-CpG binding domain 4, DNA glycosylase | |
|
2 | 2 | ||||||
| MIRT547550 | LRRFIP2 | LRR binding FLII interacting protein 2 | |
|
2 | 4 | ||||||
| MIRT547665 | KPNA3 | karyopherin subunit alpha 3 | |
|
2 | 2 | ||||||
| MIRT547701 | KPNA1 | karyopherin subunit alpha 1 | |
|
2 | 4 | ||||||
| MIRT547971 | HIGD1A | HIG1 hypoxia inducible domain family member 1A | |
|
2 | 4 | ||||||
| MIRT547997 | HCFC2 | host cell factor C2 | |
|
2 | 4 | ||||||
| MIRT548016 | GRB2 | growth factor receptor bound protein 2 | |
|
2 | 4 | ||||||
| MIRT548221 | FKBP1A | FK506 binding protein 1A | |
|
2 | 2 | ||||||
| MIRT548277 | FBXL20 | F-box and leucine rich repeat protein 20 | |
|
2 | 2 | ||||||
| MIRT548728 | CRK | CRK proto-oncogene, adaptor protein | |
|
2 | 2 | ||||||
| MIRT548805 | CLIP4 | CAP-Gly domain containing linker protein family member 4 | |
|
2 | 4 | ||||||
| MIRT548948 | CDK17 | cyclin dependent kinase 17 | |
|
2 | 3 | ||||||
| MIRT549079 | CACUL1 | CDK2 associated cullin domain 1 | |
|
2 | 2 | ||||||
| MIRT549126 | C11orf24 | chromosome 11 open reading frame 24 | |
|
2 | 4 | ||||||
| MIRT549277 | ASH1L | ASH1 like histone lysine methyltransferase | |
|
2 | 3 | ||||||
| MIRT549387 | AMOT | angiomotin | |
|
2 | 2 | ||||||
| MIRT550403 | SLC29A1 | solute carrier family 29 member 1 (Augustine blood group) | |
|
2 | 4 | ||||||
| MIRT550467 | OSCAR | osteoclast associated, immunoglobulin-like receptor | |
|
2 | 4 | ||||||
| MIRT550616 | MTHFR | methylenetetrahydrofolate reductase | |
|
2 | 2 | ||||||
| MIRT550824 | FAM229B | family with sequence similarity 229 member B | |
|
2 | 2 | ||||||
| MIRT551380 | EPM2AIP1 | EPM2A interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT551618 | ZNF267 | zinc finger protein 267 | |
|
2 | 2 | ||||||
| MIRT551738 | SSU72 | SSU72 homolog, RNA polymerase II CTD phosphatase | |
|
2 | 2 | ||||||
| MIRT552036 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | |
|
2 | 2 | ||||||
| MIRT552345 | ZNF704 | zinc finger protein 704 | |
|
2 | 2 | ||||||
| MIRT552750 | YRDC | yrdC N6-threonylcarbamoyltransferase domain containing | |
|
2 | 2 | ||||||
| MIRT553440 | TPM3 | tropomyosin 3 | |
|
2 | 2 | ||||||
| MIRT553563 | TMEM161B | transmembrane protein 161B | |
|
2 | 2 | ||||||
| MIRT553617 | TM7SF3 | transmembrane 7 superfamily member 3 | |
|
2 | 2 | ||||||
| MIRT553773 | TAF13 | TATA-box binding protein associated factor 13 | |
|
2 | 4 | ||||||
| MIRT553810 | SZRD1 | SUZ RNA binding domain containing 1 | |
|
2 | 4 | ||||||
| MIRT554701 | RNF149 | ring finger protein 149 | |
|
2 | 2 | ||||||
| MIRT554963 | RACGAP1 | Rac GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT555033 | RAB23 | RAB23, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT555148 | PTPRD | protein tyrosine phosphatase, receptor type D | |
|
2 | 2 | ||||||
| MIRT555226 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | |
|
2 | 4 | ||||||
| MIRT555277 | PRDM4 | PR/SET domain 4 | |
|
2 | 2 | ||||||
| MIRT555437 | PPAP2B | phospholipid phosphatase 3 | |
|
2 | 2 | ||||||
| MIRT556384 | LURAP1L | leucine rich adaptor protein 1 like | |
|
2 | 2 | ||||||
| MIRT556854 | KANK1 | KN motif and ankyrin repeat domains 1 | |
|
2 | 4 | ||||||
| MIRT557282 | HIST2H2BE | histone cluster 2 H2B family member e | |
|
2 | 2 | ||||||
| MIRT557481 | GPR27 | G protein-coupled receptor 27 | |
|
2 | 4 | ||||||
| MIRT558038 | EXT1 | exostosin glycosyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT558508 | CYP26B1 | cytochrome P450 family 26 subfamily B member 1 | |
|
2 | 4 | ||||||
| MIRT558590 | CREBL2 | cAMP responsive element binding protein like 2 | |
|
2 | 4 | ||||||
| MIRT558663 | CNKSR3 | CNKSR family member 3 | |
|
2 | 2 | ||||||
| MIRT559012 | CA8 | carbonic anhydrase 8 | |
|
2 | 2 | ||||||
| MIRT559157 | BTN3A3 | butyrophilin subfamily 3 member A3 | |
|
2 | 2 | ||||||
| MIRT559532 | ARHGAP12 | Rho GTPase activating protein 12 | |
|
2 | 5 | ||||||
| MIRT560853 | OSBPL3 | oxysterol binding protein like 3 | |
|
2 | 2 | ||||||
| MIRT561151 | KRT33B | keratin 33B | |
|
2 | 2 | ||||||
| MIRT561401 | TUBB2A | tubulin beta 2A class IIa | |
|
2 | 2 | ||||||
| MIRT561875 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | |
|
2 | 2 | ||||||
| MIRT562028 | LANCL1 | LanC like 1 | |
|
2 | 2 | ||||||
| MIRT562202 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | |
|
2 | 2 | ||||||
| MIRT562878 | KIAA1456 | KIAA1456 | |
|
2 | 2 | ||||||
| MIRT563087 | SLC25A12 | solute carrier family 25 member 12 | |
|
2 | 3 | ||||||
| MIRT563504 | DLGAP3 | DLG associated protein 3 | |
|
2 | 2 | ||||||
| MIRT563702 | THRAP3 | thyroid hormone receptor associated protein 3 | |
|
2 | 2 | ||||||
| MIRT563846 | SMDT1 | single-pass membrane protein with aspartate rich tail 1 | |
|
2 | 2 | ||||||
| MIRT563897 | RAPH1 | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 | |
|
2 | 2 | ||||||
| MIRT564333 | CCNT1 | cyclin T1 | |
|
2 | 2 | ||||||
| MIRT564479 | ZNF391 | zinc finger protein 391 | |
|
2 | 2 | ||||||
| MIRT564553 | CCDC80 | coiled-coil domain containing 80 | |
|
2 | 2 | ||||||
| MIRT564841 | ZBTB16 | zinc finger and BTB domain containing 16 | |
|
2 | 2 | ||||||
| MIRT564951 | XKR7 | XK related 7 | |
|
2 | 2 | ||||||
| MIRT564988 | WNK3 | WNK lysine deficient protein kinase 3 | |
|
2 | 2 | ||||||
| MIRT565043 | VAV2 | vav guanine nucleotide exchange factor 2 | |
|
2 | 2 | ||||||
| MIRT565396 | TGFBR3 | transforming growth factor beta receptor 3 | |
|
2 | 2 | ||||||
| MIRT566121 | RASEF | RAS and EF-hand domain containing | |
|
2 | 2 | ||||||
| MIRT566651 | NCKAP1 | NCK associated protein 1 | |
|
2 | 2 | ||||||
| MIRT566832 | MAP3K7 | mitogen-activated protein kinase kinase kinase 7 | |
|
2 | 2 | ||||||
| MIRT567020 | KLHL15 | kelch like family member 15 | |
|
2 | 2 | ||||||
| MIRT567447 | GNG12 | G protein subunit gamma 12 | |
|
2 | 2 | ||||||
| MIRT567478 | FZD9 | frizzled class receptor 9 | |
|
2 | 2 | ||||||
| MIRT568022 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | |
|
2 | 2 | ||||||
| MIRT568144 | CCDC88C | coiled-coil domain containing 88C | |
|
2 | 2 | ||||||
| MIRT568471 | ARMC12 | armadillo repeat containing 12 | |
|
2 | 2 | ||||||
| MIRT568573 | AHNAK2 | AHNAK nucleoprotein 2 | |
|
2 | 2 | ||||||
| MIRT568623 | ACVR2A | activin A receptor type 2A | |
|
2 | 2 | ||||||
| MIRT570465 | TLK1 | tousled like kinase 1 | |
|
2 | 3 | ||||||
| MIRT571120 | UBE2H | ubiquitin conjugating enzyme E2 H | |
|
2 | 2 | ||||||
| MIRT571284 | TTLL5 | tubulin tyrosine ligase like 5 | |
|
2 | 2 | ||||||
| MIRT571429 | RIF1 | replication timing regulatory factor 1 | |
|
2 | 2 | ||||||
| MIRT571661 | SERBP1 | SERPINE1 mRNA binding protein 1 | |
|
2 | 2 | ||||||
| MIRT571829 | PHF19 | PHD finger protein 19 | |
|
2 | 2 | ||||||
| MIRT574058 | PROSC | pyridoxal phosphate binding protein | |
|
2 | 2 | ||||||
| MIRT574204 | CLEC2D | C-type lectin domain family 2 member D | |
|
2 | 2 | ||||||
| MIRT574596 | N4BP1 | NEDD4 binding protein 1 | |
|
2 | 3 | ||||||
| MIRT575883 | Cask | calcium/calmodulin-dependent serine protein kinase (MAGUK family) | |
|
2 | 4 | ||||||
| MIRT575925 | Dmpk | dystrophia myotonica-protein kinase | |
|
2 | 7 | ||||||
| MIRT576097 | Pdcd1 | programmed cell death 1 | |
|
2 | 5 | ||||||
| MIRT576597 | Npepps | aminopeptidase puromycin sensitive | |
|
2 | 2 | ||||||
| MIRT614701 | TRAK1 | trafficking kinesin protein 1 | |
|
2 | 2 | ||||||
| MIRT616468 | ADRA2B | adrenoceptor alpha 2B | |
|
2 | 2 | ||||||
| MIRT618897 | ANKMY1 | ankyrin repeat and MYND domain containing 1 | |
|
2 | 2 | ||||||
| MIRT619615 | RNF41 | ring finger protein 41 | |
|
2 | 2 | ||||||
| MIRT621499 | GPRC5A | G protein-coupled receptor class C group 5 member A | |
|
2 | 4 | ||||||
| MIRT640539 | C3orf36 | chromosome 3 open reading frame 36 | |
|
2 | 2 | ||||||
| MIRT645511 | BSPRY | B-box and SPRY domain containing | |
|
2 | 2 | ||||||
| MIRT646596 | ANKRD36 | ankyrin repeat domain 36 | |
|
2 | 2 | ||||||
| MIRT648785 | KLHL40 | kelch like family member 40 | |
|
2 | 2 | ||||||
| MIRT655813 | NOTCH2 | notch 2 | |
|
2 | 3 | ||||||
| MIRT658794 | EIF2B2 | eukaryotic translation initiation factor 2B subunit beta | |
|
2 | 2 | ||||||
| MIRT659257 | CUL3 | cullin 3 | |
|
2 | 2 | ||||||
| MIRT680983 | DCAF17 | DDB1 and CUL4 associated factor 17 | |
|
2 | 2 | ||||||
| MIRT682282 | RS1 | retinoschisin 1 | |
|
2 | 2 | ||||||
| MIRT682515 | GLP2R | glucagon like peptide 2 receptor | |
|
2 | 2 | ||||||
| MIRT691710 | FLOT2 | flotillin 2 | |
|
2 | 3 | ||||||
| MIRT693931 | HNRNPA1L2 | heterogeneous nuclear ribonucleoprotein A1-like 2 | |
|
2 | 2 | ||||||
| MIRT701507 | NEGR1 | neuronal growth regulator 1 | |
|
2 | 2 | ||||||
| MIRT702093 | MCFD2 | multiple coagulation factor deficiency 2 | |
|
2 | 2 | ||||||
| MIRT702874 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | |
|
2 | 2 | ||||||
| MIRT713420 | SLC35E2B | solute carrier family 35 member E2B | |
|
2 | 2 | ||||||
| MIRT714439 | ARHGAP32 | Rho GTPase activating protein 32 | |
|
2 | 2 | ||||||
| MIRT716433 | RAB15 | RAB15, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT717462 | ADORA3 | adenosine A3 receptor | |
|
2 | 2 | ||||||
| MIRT720148 | PPIP5K2 | diphosphoinositol pentakisphosphate kinase 2 | |
|
2 | 2 | ||||||
| MIRT725128 | SYNRG | synergin gamma | |
|
2 | 2 | ||||||
| MIRT726004 | ZNF91 | zinc finger protein 91 | |
1 | 1 | |||||||
| MIRT726082 | ZBTB5 | zinc finger and BTB domain containing 5 | |
1 | 1 | |||||||
| MIRT726125 | VPS33B | VPS33B, late endosome and lysosome associated | |
1 | 1 | |||||||
| MIRT726130 | CHMP3 | charged multivesicular body protein 3 | |
1 | 1 | |||||||
| MIRT726141 | VCL | vinculin | |
1 | 1 | |||||||
| MIRT726155 | USP3 | ubiquitin specific peptidase 3 | |
1 | 1 | |||||||
| MIRT726163 | USP31 | ubiquitin specific peptidase 31 | |
1 | 1 | |||||||
| MIRT726219 | TUBB | tubulin beta class I | |
1 | 1 | |||||||
| MIRT726235 | TRAM1 | translocation associated membrane protein 1 | |
1 | 1 | |||||||
| MIRT726277 | TMEM69 | transmembrane protein 69 | |
1 | 1 | |||||||
| MIRT726285 | TMEM55B | phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 | |
1 | 1 | |||||||
| MIRT726304 | TMEM135 | transmembrane protein 135 | |
1 | 1 | |||||||
| MIRT726316 | TLE4 | transducin like enhancer of split 4 | |
1 | 1 | |||||||
| MIRT726319 | TKTL1 | transketolase like 1 | |
1 | 1 | |||||||
| MIRT726323 | TIMM13 | translocase of inner mitochondrial membrane 13 | |
1 | 1 | |||||||
| MIRT726335 | TFB1M | transcription factor B1, mitochondrial | |
1 | 1 | |||||||
| MIRT726346 | TCF3 | transcription factor 3 | |
1 | 1 | |||||||
| MIRT726354 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | |
1 | 1 | |||||||
| MIRT726365 | TBC1D20 | TBC1 domain family member 20 | |
1 | 1 | |||||||
| MIRT726370 | TBC1D14 | TBC1 domain family member 14 | |
1 | 1 | |||||||
| MIRT726382 | TASP1 | taspase 1 | |
1 | 1 | |||||||
| MIRT726408 | SUPT16H | SPT16 homolog, facilitates chromatin remodeling subunit | |
1 | 1 | |||||||
| MIRT726419 | STX17 | syntaxin 17 | |
1 | 1 | |||||||
| MIRT726453 | SRPK1 | SRSF protein kinase 1 | |
1 | 1 | |||||||
| MIRT726460 | SPTLC1 | serine palmitoyltransferase long chain base subunit 1 | |
1 | 1 | |||||||
| MIRT726480 | SMURF1 | SMAD specific E3 ubiquitin protein ligase 1 | |
1 | 1 | |||||||
| MIRT726504 | SLC9A1 | solute carrier family 9 member A1 | |
1 | 1 | |||||||
| MIRT726508 | SLC7A5 | solute carrier family 7 member 5 | |
1 | 1 | |||||||
| MIRT726542 | SLC25A29 | solute carrier family 25 member 29 | |
1 | 1 | |||||||
| MIRT726546 | SLC25A22 | solute carrier family 25 member 22 | |
1 | 1 | |||||||
| MIRT726675 | RPS6KA3 | ribosomal protein S6 kinase A3 | |
1 | 1 | |||||||
| MIRT726678 | RPS5 | ribosomal protein S5 | |
1 | 1 | |||||||
| MIRT726682 | RPL36 | ribosomal protein L36 | |
1 | 1 | |||||||
| MIRT726710 | RNPS1 | RNA binding protein with serine rich domain 1 | |
1 | 1 | |||||||
| MIRT726714 | RNMT | RNA guanine-7 methyltransferase | |
1 | 1 | |||||||
| MIRT726717 | RNH1 | ribonuclease/angiogenin inhibitor 1 | |
1 | 1 | |||||||
| MIRT726754 | RFWD2 | ring finger and WD repeat domain 2 | |
1 | 1 | |||||||
| MIRT726760 | REXO1 | RNA exonuclease 1 homolog | |
1 | 1 | |||||||
| MIRT726770 | RELT | RELT, TNF receptor | |
1 | 1 | |||||||
| MIRT726786 | RAP2C | RAP2C, member of RAS oncogene family | |
|
|
|
4 | 1 | ||||
| MIRT726809 | RAB40B | RAB40B, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT726824 | RAB11FIP2 | RAB11 family interacting protein 2 | |
1 | 1 | |||||||
| MIRT726851 | PSMB5 | proteasome subunit beta 5 | |
1 | 1 | |||||||
| MIRT726872 | PPP6C | protein phosphatase 6 catalytic subunit | |
1 | 1 | |||||||
| MIRT726899 | POU2AF1 | POU class 2 associating factor 1 | |
1 | 1 | |||||||
| MIRT726908 | POLE4 | DNA polymerase epsilon 4, accessory subunit | |
1 | 1 | |||||||
| MIRT726965 | PGD | phosphogluconate dehydrogenase | |
1 | 1 | |||||||
| MIRT726972 | PEX12 | peroxisomal biogenesis factor 12 | |
1 | 1 | |||||||
| MIRT727019 | PANK1 | pantothenate kinase 1 | |
1 | 1 | |||||||
| MIRT727025 | TM9SF2 | transmembrane 9 superfamily member 2 | |
1 | 1 | |||||||
| MIRT727036 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | |
1 | 1 | |||||||
| MIRT727065 | NR2C2 | nuclear receptor subfamily 2 group C member 2 | |
1 | 1 | |||||||
| MIRT727094 | NCOR2 | nuclear receptor corepressor 2 | |
1 | 1 | |||||||
| MIRT727135 | MTMR4 | myotubularin related protein 4 | |
1 | 1 | |||||||
| MIRT727151 | MRPL40 | mitochondrial ribosomal protein L40 | |
1 | 1 | |||||||
| MIRT727174 | MLXIP | MLX interacting protein | |
1 | 1 | |||||||
| MIRT727196 | MIB1 | mindbomb E3 ubiquitin protein ligase 1 | |
1 | 1 | |||||||
| MIRT727220 | MED11 | mediator complex subunit 11 | |
1 | 1 | |||||||
| MIRT727226 | MCM3AP-AS1 | MCM3AP antisense RNA 1 | |
1 | 1 | |||||||
| MIRT727260 | LYRM5 | electron transfer flavoprotein regulatory factor 1 | |
1 | 1 | |||||||
| MIRT727265 | LRRC57 | leucine rich repeat containing 57 | |
1 | 1 | |||||||
| MIRT727269 | LRPPRC | leucine rich pentatricopeptide repeat containing | |
1 | 1 | |||||||
| MIRT727295 | LITAF | lipopolysaccharide induced TNF factor | |
1 | 1 | |||||||
| MIRT727346 | KLC2 | kinesin light chain 2 | |
1 | 1 | |||||||
| MIRT727375 | TECPR2 | tectonin beta-propeller repeat containing 2 | |
1 | 1 | |||||||
| MIRT727384 | KATNAL1 | katanin catalytic subunit A1 like 1 | |
1 | 1 | |||||||
| MIRT727423 | IRAK1BP1 | interleukin 1 receptor associated kinase 1 binding protein 1 | |
1 | 1 | |||||||
| MIRT727480 | HYOU1 | hypoxia up-regulated 1 | |
1 | 1 | |||||||
| MIRT727521 | GSK3B | glycogen synthase kinase 3 beta | |
1 | 1 | |||||||
| MIRT727582 | GGA3 | golgi associated, gamma adaptin ear containing, ARF binding protein 3 | |
1 | 1 | |||||||
| MIRT727603 | GANAB | glucosidase II alpha subunit | |
1 | 1 | |||||||
| MIRT727616 | GABARAP | GABA type A receptor-associated protein | |
1 | 1 | |||||||
| MIRT727645 | FRYL | FRY like transcription coactivator | |
1 | 1 | |||||||
| MIRT727698 | FAM73A | mitoguardin 1 | |
1 | 1 | |||||||
| MIRT727717 | AMER1 | APC membrane recruitment protein 1 | |
1 | 1 | |||||||
| MIRT727812 | EDC3 | enhancer of mRNA decapping 3 | |
1 | 1 | |||||||
| MIRT727854 | DSCR3 | DSCR3 arrestin fold containing | |
1 | 1 | |||||||
| MIRT727857 | DPP8 | dipeptidyl peptidase 8 | |
1 | 1 | |||||||
| MIRT727864 | DNAJC9 | DnaJ heat shock protein family (Hsp40) member C9 | |
1 | 1 | |||||||
| MIRT727907 | CYLD | CYLD lysine 63 deubiquitinase | |
1 | 1 | |||||||
| MIRT727911 | CYB561A3 | cytochrome b561 family member A3 | |
1 | 1 | |||||||
| MIRT727914 | CUL2 | cullin 2 | |
1 | 1 | |||||||
| MIRT727922 | CSDE1 | cold shock domain containing E1 | |
1 | 1 | |||||||
| MIRT727934 | CREG1 | cellular repressor of E1A stimulated genes 1 | |
1 | 1 | |||||||
| MIRT727950 | CPNE1 | copine 1 | |
1 | 1 | |||||||
| MIRT727997 | RHOV | ras homolog family member V | |
1 | 1 | |||||||
| MIRT728003 | CDKN2AIPNL | CDKN2A interacting protein N-terminal like | |
1 | 1 | |||||||
| MIRT728017 | CDC27 | cell division cycle 27 | |
1 | 1 | |||||||
| MIRT728044 | CBFA2T3 | CBFA2/RUNX1 translocation partner 3 | |
1 | 1 | |||||||
| MIRT728089 | C6orf106 | chromosome 6 open reading frame 106 | |
1 | 1 | |||||||
| MIRT728098 | C2orf42 | chromosome 2 open reading frame 42 | |
1 | 1 | |||||||
| MIRT728125 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | |
1 | 1 | |||||||
| MIRT728129 | C15orf39 | chromosome 15 open reading frame 39 | |
1 | 1 | |||||||
| MIRT728192 | BSG | basigin (Ok blood group) | |
1 | 1 | |||||||
| MIRT728236 | B4GALT1 | beta-1,4-galactosyltransferase 1 | |
1 | 1 | |||||||
| MIRT728263 | ATP13A3 | ATPase 13A3 | |
1 | 1 | |||||||
| MIRT728287 | ASXL1 | additional sex combs like 1, transcriptional regulator | |
1 | 1 | |||||||
| MIRT728327 | AP3M1 | adaptor related protein complex 3 mu 1 subunit | |
1 | 1 | |||||||
| MIRT728381 | AFF4 | AF4/FMR2 family member 4 | |
1 | 1 | |||||||
| MIRT728397 | ACOX1 | acyl-CoA oxidase 1 | |
1 | 1 | |||||||
| MIRT732257 | NKD1 | naked cuticle homolog 1 | |
|
|
3 | 1 | |||||
| MIRT734040 | CTBP1-AS | CTBP1 antisense RNA | |
|
|
3 | 0 | |||||
| MIRT735246 | SGK1 | serum/glucocorticoid regulated kinase 1 | |
|
|
|
|
5 | 0 | |||
| MIRT735431 | YAP1 | Yes associated protein 1 | 8 | 1 | ||||||||
| MIRT736810 | GPER1 | G protein-coupled estrogen receptor 1 | |
|
|
3 | 0 | |||||
| MIRT755496 | FOSL1 | FOS like 1, AP-1 transcription factor subunit | 3 | 1 | ||||||||
| MIRT755897 | SNHG1 | small nucleolar RNA host gene 1 | 3 | 1 | ||||||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|