miRTarBase - #MIRT000350


—
pre-miRNA Information
pre-miRNA hsa-mir-125b-1   
Genomic Coordinates chr11: 122099757 - 122099844
Synonyms MIRN125B1, MIR125B1
Description Homo sapiens miR-125b-1 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-125b-2   
Genomic Coordinates chr21: 16590237 - 16590325
Synonyms MIRN125B2, MIR125B2
Description Homo sapiens miR-125b-2 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-125b-5p
Sequence 15| UCCCUGAGACCCUAACUUGUGA |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 14 21 + 16590266 29233923 MiREDiBase
C-to-U 11 11 - 122099820 17604727 MiREDiBase
C-to-U 11 21 + 16590263 27229138 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1459840793 11 dbSNP
rs1178860098 12 dbSNP
rs1325186129 12 dbSNP
rs764155531 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BP42YE miR-125b Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Reverse transcription-polymerase chain reaction
BP42YE miR-125b Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression High Peripheral blood mononuclear cell Quantitative real-time PCR
BP42YE miR-125b Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression High Serum Quantitative reverse transcription PCR
B1BK2S miR-125b-5p Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Plasma Small RNA next-generation sequencing
Gene Information
Gene Symbol GLI1   
Synonyms GLI
Description GLI family zinc finger 1
Transcript NM_001160045   
Other Transcripts NM_001167609 , NM_005269   
Expression
Putative miRNA Targets on GLI1
3'UTR of GLI1
(miRNA target sites are highlighted)		 
>GLI1|NM_001160045|3'UTR
   1 AGAGTAGGGAATCTCATCCATCACAGATCGCATTTCCTAAGGGGTTTCTATCCTTCCAGAAAAATTGGGGGAGCTGCAGT
  81 CCCATGCACAAGATGCCCCAGGGATGGGAGGTATGGGCTGGGGGCTATGTATAGTCTGTATACGTTTTGAGGAGAAATTT
 161 GATAATGACACTGTTTCCTGATAATAAAGGAACTGCATCAGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agUGUUCAAUCCCAGAGUCCCu 5'
            ||||| |   | | ||||| 
Target 5' gcACAAGAT---GCCCCAGGGa 3'
 86 - 104 125.00 -15.90
2 
miRNA  3' aguGU-UCAAUCCCA---GAGUCCCu 5'
             || || | |  |   || |||| 
Target 5' catCACAGATCGCATTTCCTAAGGGg 3'
 19 - 44 111.00 -11.47
3 
miRNA  3' agugUUCAAUCCCAGAGUCCCU- 5'
              :|| || || || :|||  
Target 5' atggGAGGTATGGGCTGGGGGCT 3'
 104 - 126 106.00 -14.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30451743 9 COSMIC
COSN30186381 19 COSMIC
COSN31572872 25 COSMIC
COSN31543197 27 COSMIC
COSN13409283 31 COSMIC
COSN30470491 60 COSMIC
COSN30188191 88 COSMIC
COSN9564852 204 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs368262823 5 dbSNP
rs912295731 7 dbSNP
rs986317249 9 dbSNP
rs762773153 10 dbSNP
rs1353756846 12 dbSNP
rs1280364194 14 dbSNP
rs766133060 14 dbSNP
rs142801047 16 dbSNP
rs116063694 18 dbSNP
rs1316113626 24 dbSNP
rs781108666 27 dbSNP
rs1391367853 28 dbSNP
rs752715126 30 dbSNP
rs756206910 31 dbSNP
rs777932431 37 dbSNP
rs1040351455 39 dbSNP
rs749512706 46 dbSNP
rs1397839147 47 dbSNP
rs771305150 50 dbSNP
rs1425774581 57 dbSNP
rs929381868 60 dbSNP
rs1453768104 61 dbSNP
rs1291264561 65 dbSNP
rs1213100157 66 dbSNP
rs35711680 74 dbSNP
rs1463990037 82 dbSNP
rs1332836764 83 dbSNP
rs474058 85 dbSNP
rs887881680 87 dbSNP
rs1361541901 94 dbSNP
rs762606910 102 dbSNP
rs1449823008 111 dbSNP
rs565846806 112 dbSNP
rs1459385371 114 dbSNP
rs1401931465 118 dbSNP
rs1170934694 123 dbSNP
rs536501886 129 dbSNP
rs1416956836 130 dbSNP
rs907108358 135 dbSNP
rs1002814196 142 dbSNP
rs1377946102 144 dbSNP
rs1031327628 145 dbSNP
rs1214711148 157 dbSNP
rs1297077229 165 dbSNP
rs955662457 167 dbSNP
rs1199352836 169 dbSNP
rs1013580920 172 dbSNP
rs1011265856 182 dbSNP
rs1271172659 192 dbSNP
rs1220716721 196 dbSNP
rs1345501162 197 dbSNP
rs1218489935 206 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Daoy , D283 MB cell
Disease 2735.0;
Tools used in this research miRanda , TargetScan , miRBase Target Database
Original Description (Extracted from the article) ... "miR-125b ...

- Ferretti E; De Smaele E; Miele E; Laneve P; et al., 2008, The EMBO journal.

Article - Ferretti E; De Smaele E; Miele E; Laneve P; et al.
- The EMBO journal, 2008
MicroRNAs (miRNA) are crucial post-transcriptional regulators of gene expression and control cell differentiation and proliferation. However, little is known about their targeting of specific developmental pathways. Hedgehog (Hh) signalling controls cerebellar granule cell progenitor development and a subversion of this pathway leads to neoplastic transformation into medulloblastoma (MB). Using a miRNA high-throughput profile screening, we identify here a downregulated miRNA signature in human MBs with high Hh signalling. Specifically, we identify miR-125b and miR-326 as suppressors of the pathway activator Smoothened together with miR-324-5p, which also targets the downstream transcription factor Gli1. Downregulation of these miRNAs allows high levels of Hh-dependent gene expression leading to tumour cell proliferation. Interestingly, the downregulation of miR-324-5p is genetically determined by MB-associated deletion of chromosome 17p. We also report that whereas miRNA expression is downregulated in cerebellar neuronal progenitors, it increases alongside differentiation, thereby allowing cell maturation and growth inhibition. These findings identify a novel regulatory circuitry of the Hh signalling and suggest that misregulation of specific miRNAs, leading to its aberrant activation, sustain cancer development.
LinkOut: [PMID: 18756266]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer 0.508 8.8e-7 0.560 4.0e-8 79 Click to see details
GSE19536 Breast cancer 0.441 2.2e-6 0.534 5.3e-9 100 Click to see details
GSE42095 Differentiated embryonic stem cells -0.636 5.5e-4 -0.668 2.5e-4 23 Click to see details
GSE28260 Renal cortex and medulla -0.747 1.7e-3 -0.648 8.3e-3 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.552 2.1e-3 0.545 2.4e-3 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.514 1.0e-2 -0.568 4.5e-3 20 Click to see details
GSE17498 Multiple myeloma 0.345 1.5e-2 0.312 2.5e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.433 1.5e-2 0.228 1.4e-1 25 Click to see details
GSE28544 Breast cancer 0.432 1.8e-2 0.349 4.7e-2 24 Click to see details
GSE21849 B cell lymphoma -0.358 2.8e-2 0.256 9.0e-2 29 Click to see details
GSE14794 Lymphoblastoid cells 0.171 5.4e-2 0.144 8.8e-2 90 Click to see details
GSE38226 Liver fibrosis 0.357 5.6e-2 0.137 2.8e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0.341 7.1e-2 0.502 1.2e-2 20 Click to see details
GSE32688 Pancreatic cancer 0.237 9.6e-2 0.205 1.3e-1 32 Click to see details
GSE21687 Ependynoma primary tumors 0.109 2.0e-1 0.037 3.9e-1 64 Click to see details
GSE17306 Multiple myeloma -0.123 2.0e-1 -0.151 1.5e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.134 2.7e-1 0.068 3.8e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.186 2.8e-1 -0.098 3.8e-1 12 Click to see details
GSE27834 Pluripotent stem cells -0.147 2.9e-1 -0.282 1.4e-1 16 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.145 3.5e-1 -0.150 3.5e-1 9 Click to see details
GSE21032 Prostate cancer -0.025 4.1e-1 -0.001 5.0e-1 83 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.987 0.01 1.000 0.5 4 Click to see details
HNSC -0.362 0.01 -0.403 0 42 Click to see details
LIHC -0.22 0.06 -0.202 0.08 49 Click to see details
COAD 0.562 0.07 0.286 0.25 8 Click to see details
KIRP 0.233 0.1 0.283 0.06 32 Click to see details
ESCA 0.39 0.12 0.445 0.09 11 Click to see details
STAD 0.211 0.12 0.053 0.39 32 Click to see details
KICH 0.236 0.13 0.262 0.1 25 Click to see details
LUAD -0.268 0.2 -0.189 0.28 12 Click to see details
BLCA 0.198 0.22 0.193 0.22 18 Click to see details
THCA -0.094 0.24 -0.127 0.17 59 Click to see details
PRAD -0.075 0.3 0.023 0.44 50 Click to see details
LUSC 0.076 0.33 0.101 0.27 38 Click to see details
CESC -0.487 0.34 -0.500 0.33 3 Click to see details
PCPG -0.482 0.34 -0.500 0.33 3 Click to see details
KIRC 0.032 0.4 0.054 0.33 68 Click to see details
UCEC -0.053 0.41 -0.133 0.29 19 Click to see details
BRCA -0.018 0.44 -0.020 0.43 84 Click to see details
CHOL -0.03 0.47 0.233 0.27 9 Click to see details
CHOL -0.03 0.47 0.233 0.27 9 Click to see details
CHOL -0.03 0.47 0.233 0.27 9 Click to see details
465 hsa-miR-125b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000346 BMPR1B bone morphogenetic protein receptor type 1B 2 1
MIRT000347 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 4 2
MIRT000348 HMGA2 high mobility group AT-hook 2 2 1
MIRT000349 HMGA1 high mobility group AT-hook 1 2 1
MIRT000350 GLI1 GLI family zinc finger 1 2 1
MIRT000351 CDK6 cyclin dependent kinase 6 1 2
MIRT000462 NKIRAS2 NFKB inhibitor interacting Ras like 2 4 1
MIRT000525 SMO smoothened, frizzled class receptor 3 2
MIRT000535 TP53 tumor protein p53 5 8
MIRT001037 LIF LIF, interleukin 6 family cytokine 3 2
MIRT001197 VDR vitamin D receptor 4 2
MIRT002358 FAM19A1 family with sequence similarity 19 member A1, C-C motif chemokine like 1 1
MIRT002359 ID1 inhibitor of DNA binding 1, HLH protein 1 1
MIRT002360 ID3 inhibitor of DNA binding 3, HLH protein 1 1
MIRT002362 TENM2 teneurin transmembrane protein 2 1 1
MIRT002363 MAN1A1 mannosidase alpha class 1A member 1 1 1
MIRT002364 TSPAN8 tetraspanin 8 1 2
MIRT002365 UGT2B17 UDP glucuronosyltransferase family 2 member B17 1 1
MIRT002366 PIGR polymeric immunoglobulin receptor 1 1
MIRT002369 CYP1A1 cytochrome P450 family 1 subfamily A member 1 1 1
MIRT002370 SGPL1 sphingosine-1-phosphate lyase 1 4 4
MIRT002371 PCDHB10 protocadherin beta 10 1 1
MIRT002372 ID2 inhibitor of DNA binding 2, HLH protein 1 1
MIRT002373 DIO3 iodothyronine deiodinase 3 1 2
MIRT002374 H3F3B H3 histone family member 3B 1 1
MIRT002375 CASP6 caspase 6 1 1
MIRT002376 UGT2B28 UDP glucuronosyltransferase family 2 member B28 1 1
MIRT002377 IL1RN interleukin 1 receptor antagonist 1 1
MIRT002379 RBM8A RNA binding motif protein 8A 1 1
MIRT002380 UBE2I ubiquitin conjugating enzyme E2 I 1 1
MIRT002381 UGT2B15 UDP glucuronosyltransferase family 2 member B15 1 1
MIRT002382 ANAPC16 anaphase promoting complex subunit 16 3 3
MIRT002383 CBX7 chromobox 7 1 1
MIRT002385 HIST1H4A histone cluster 1 H4 family member a 1 1
MIRT002386 CBLN2 cerebellin 2 precursor 1 1
MIRT002387 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT002388 CASP7 caspase 7 1 1
MIRT002389 GPR160 G protein-coupled receptor 160 1 1
MIRT002390 HOMER2 homer scaffolding protein 2 1 1
MIRT002391 B3GALT4 beta-1,3-galactosyltransferase 4 1 1
MIRT002392 PERP PERP, TP53 apoptosis effector 1 1
MIRT002393 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif 1 1 1
MIRT002394 BAK1 BCL2 antagonist/killer 1 4 6
MIRT002938 ERBB3 erb-b2 receptor tyrosine kinase 3 4 6
MIRT002939 ERBB2 erb-b2 receptor tyrosine kinase 2 5 6
MIRT003394 BMF Bcl2 modifying factor 3 2
MIRT003421 KLF13 Kruppel like factor 13 5 2
MIRT003754 NTRK3 neurotrophic receptor tyrosine kinase 3 3 1
MIRT003845 LIN28A lin-28 homolog A 4 6
MIRT003970 CBFB core-binding factor beta subunit 5 3
MIRT003997 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 1
MIRT004363 AKT1 AKT serine/threonine kinase 1 3 1
MIRT004408 CYP24A1 cytochrome P450 family 24 subfamily A member 1 4 2
MIRT004418 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 1
MIRT004533 PRDM1 PR/SET domain 1 5 3
MIRT004534 IRF4 interferon regulatory factor 4 5 8
MIRT004578 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 3 1
MIRT004709 CDKN2A cyclin dependent kinase inhibitor 2A 3 2
MIRT004936 KRT7 keratin 7 2 1
MIRT004985 SAMD10 sterile alpha motif domain containing 10 2 1
MIRT004986 QSOX2 quiescin sulfhydryl oxidase 2 2 1
MIRT004987 SLC7A6 solute carrier family 7 member 6 2 1
MIRT004988 RNF144A ring finger protein 144A 2 1
MIRT004989 ABCC4 ATP binding cassette subfamily C member 4 2 1
MIRT004990 LYPLA2 lysophospholipase II 2 1
MIRT004991 CASC3 cancer susceptibility 3 3 2
MIRT004992 ULK3 unc-51 like kinase 3 2 1
MIRT004993 PABPC1 poly(A) binding protein cytoplasmic 1 2 1
MIRT004994 CGN cingulin 2 1
MIRT004995 PLEKHA8 pleckstrin homology domain containing A8 2 1
MIRT004996 TP53INP1 tumor protein p53 inducible nuclear protein 1 7 6
MIRT004997 SLC35A4 solute carrier family 35 member A4 2 1
MIRT004998 LACTB lactamase beta 3 2
MIRT004999 SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 2 1
MIRT005000 SLC7A1 solute carrier family 7 member 1 2 1
MIRT005006 STAT3 signal transducer and activator of transcription 3 5 2
MIRT005007 ATXN1 ataxin 1 2 1
MIRT005008 SEL1L SEL1L ERAD E3 ligase adaptor subunit 2 1
MIRT005009 KCNS3 potassium voltage-gated channel modifier subfamily S member 3 2 1
MIRT005010 PPAT phosphoribosyl pyrophosphate amidotransferase 2 1
MIRT005011 RPL29 ribosomal protein L29 2 1
MIRT005503 E2F3 E2F transcription factor 3 4 2
MIRT005738 IGF2 insulin like growth factor 2 2 1
MIRT005804 LIN28B lin-28 homolog B 3 1
MIRT005914 Bak1 BCL2-antagonist/killer 1 3 1
MIRT005915 BBC3 BCL2 binding component 3 3 1
MIRT006081 Tef thyrotroph embryonic factor 2 1
MIRT006127 PPP1CA protein phosphatase 1 catalytic subunit alpha 4 3
MIRT006128 PRKRA protein activator of interferon induced protein kinase EIF2AK2 3 1
MIRT006253 BCL2 BCL2, apoptosis regulator 2 1
MIRT006387 ETS1 ETS proto-oncogene 1, transcription factor 1 2
MIRT006430 RPS6KA1 ribosomal protein S6 kinase A1 3 2
MIRT006472 TNFAIP3 TNF alpha induced protein 3 3 2
MIRT006495 PIGF phosphatidylinositol glycan anchor biosynthesis class F 3 1
MIRT006500 BCL3 B-cell CLL/lymphoma 3 1 1
MIRT006523 TBC1D1 TBC1 domain family member 1 1 1
MIRT006524 DGAT1 diacylglycerol O-acyltransferase 1 1 1
MIRT006678 FGFR2 fibroblast growth factor receptor 2 3 1
MIRT006719 ARID3B AT-rich interaction domain 3B 1 1
MIRT006740 TRIM71 tripartite motif containing 71 0 1
MIRT006810 SMAD4 SMAD family member 4 2 1
MIRT006843 MCL1 MCL1, BCL2 family apoptosis regulator 3 3
MIRT006844 IL6R interleukin 6 receptor 3 2
MIRT006849 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT006910 ABTB1 ankyrin repeat and BTB domain containing 1 3 1
MIRT006945 HK2 hexokinase 2 3 1
MIRT006974 E2F2 E2F transcription factor 2 3 1
MIRT006990 MMP13 matrix metallopeptidase 13 1 1
MIRT007066 MAPK14 mitogen-activated protein kinase 14 4 1
MIRT022104 PF4 platelet factor 4 1 1
MIRT022105 IL6 interleukin 6 2 1
MIRT022106 GP9 glycoprotein IX platelet 1 1
MIRT022107 ITGB3 integrin subunit beta 3 1 1
MIRT022108 Lin28a lin-28 homolog A (C. elegans) 1 1
MIRT022109 SHMT2 serine hydroxymethyltransferase 2 1 1
MIRT022110 TBXAS1 thromboxane A synthase 1 1 1
MIRT022111 KLF1 Kruppel like factor 1 1 1
MIRT022112 EPO erythropoietin 2 2
MIRT022114 MUC1 mucin 1, cell surface associated 2 1
MIRT035540 NES nestin 1 1
MIRT035583 ATP6AP1L ATPase H+ transporting accessory protein 1 like 1 1
MIRT035584 DICER1 dicer 1, ribonuclease III 1 3
MIRT035585 ST18 ST18, C2H2C-type zinc finger 1 1
MIRT035586 CDC25A cell division cycle 25A 1 1
MIRT035587 KRT19 keratin 19 1 1
MIRT045889 SLC16A4 solute carrier family 16 member 4 1 1
MIRT045890 KIF24 kinesin family member 24 1 1
MIRT045891 UBA6 ubiquitin like modifier activating enzyme 6 1 1
MIRT045892 RGS19 regulator of G protein signaling 19 1 1
MIRT045893 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT045894 ADM adrenomedullin 1 1
MIRT045895 THUMPD3 THUMP domain containing 3 1 1
MIRT045896 RHOV ras homolog family member V 1 1
MIRT045897 R3HDM2 R3H domain containing 2 1 1
MIRT045898 C2orf88 chromosome 2 open reading frame 88 1 1
MIRT045899 SHMT1 serine hydroxymethyltransferase 1 1 1
MIRT045900 CRTC1 CREB regulated transcription coactivator 1 1 1
MIRT045901 XIAP X-linked inhibitor of apoptosis 1 1
MIRT045902 CNGB1 cyclic nucleotide gated channel beta 1 1 1
MIRT045903 THAP3 THAP domain containing 3 1 1
MIRT045904 WDR11 WD repeat domain 11 1 1
MIRT045905 CD320 CD320 molecule 1 1
MIRT045906 ACLY ATP citrate lyase 1 1
MIRT045907 HOXA13 homeobox A13 1 1
MIRT045908 SMYD5 SMYD family member 5 1 1
MIRT045909 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT045910 DHX57 DExH-box helicase 57 1 1
MIRT045911 HKR1 HKR1, GLI-Kruppel zinc finger family member 1 1
MIRT045912 SSR3 signal sequence receptor subunit 3 1 1
MIRT045913 HIST2H2BF histone cluster 2 H2B family member f 1 1
MIRT045914 BCOR BCL6 corepressor 1 1
MIRT045915 SORT1 sortilin 1 1 1
MIRT045916 MYEF2 myelin expression factor 2 1 1
MIRT045917 E2F7 E2F transcription factor 7 1 1
MIRT045918 S100A8 S100 calcium binding protein A8 1 1
MIRT045919 CCNE1 cyclin E1 1 1
MIRT045920 MTMR3 myotubularin related protein 3 1 1
MIRT045921 KIAA0141 KIAA0141 1 1
MIRT045922 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT045923 NPM1 nucleophosmin 1 1 1
MIRT045924 SMIM8 small integral membrane protein 8 1 1
MIRT045925 CEP170 centrosomal protein 170 1 1
MIRT045926 SIK2 salt inducible kinase 2 1 1
MIRT045927 HMGN1 high mobility group nucleosome binding domain 1 1 1
MIRT045928 ILVBL ilvB acetolactate synthase like 1 1
MIRT045929 LTV1 LTV1 ribosome biogenesis factor 1 1
MIRT045930 MYO19 myosin XIX 1 1
MIRT045931 CHMP3 charged multivesicular body protein 3 1 1
MIRT045932 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT045933 ADRM1 adhesion regulating molecule 1 1 1
MIRT045934 ZNF592 zinc finger protein 592 1 1
MIRT045935 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT045936 PCDHGB2 protocadherin gamma subfamily B, 2 1 1
MIRT045937 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT045938 ARF3 ADP ribosylation factor 3 1 1
MIRT045939 PDS5A PDS5 cohesin associated factor A 1 1
MIRT045940 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT045941 ZMYND11 zinc finger MYND-type containing 11 1 1
MIRT045942 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT045943 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT045944 VCL vinculin 1 1
MIRT045945 MRTO4 MRT4 homolog, ribosome maturation factor 1 1
MIRT045946 ZNF483 zinc finger protein 483 1 1
MIRT045947 VDAC1 voltage dependent anion channel 1 1 1
MIRT045948 SMC6 structural maintenance of chromosomes 6 1 1
MIRT045949 PTOV1 prostate tumor overexpressed 1 1 1
MIRT045950 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT045951 COX7C cytochrome c oxidase subunit 7C 1 1
MIRT045952 NSUN2 NOP2/Sun RNA methyltransferase family member 2 1 1
MIRT045953 RASGRP1 RAS guanyl releasing protein 1 1 1
MIRT045954 DYNC2H1 dynein cytoplasmic 2 heavy chain 1 1 1
MIRT045955 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT045956 CCDC124 coiled-coil domain containing 124 1 1
MIRT045957 RPS7 ribosomal protein S7 1 1
MIRT045958 BACH1 BTB domain and CNC homolog 1 1 1
MIRT045959 GPRIN1 G protein regulated inducer of neurite outgrowth 1 1 1
MIRT045960 UNKL unkempt family like zinc finger 1 1
MIRT045961 CREBBP CREB binding protein 1 1
MIRT045962 NDOR1 NADPH dependent diflavin oxidoreductase 1 1 1
MIRT045963 KHSRP KH-type splicing regulatory protein 1 1
MIRT045964 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 1 1
MIRT045965 CDRT4 CMT1A duplicated region transcript 4 1 1
MIRT045966 RPLP0 ribosomal protein lateral stalk subunit P0 1 1
MIRT045967 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT045968 EXOC7 exocyst complex component 7 1 1
MIRT045969 RASAL2 RAS protein activator like 2 1 1
MIRT045970 RPS3A ribosomal protein S3A 1 1
MIRT045971 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 1 1
MIRT045972 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 1 1
MIRT045973 LBX2 ladybird homeobox 2 1 1
MIRT045974 SLC9A3R2 SLC9A3 regulator 2 1 1
MIRT045975 SPRTN SprT-like N-terminal domain 1 1
MIRT045976 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT045977 STRN3 striatin 3 1 1
MIRT045978 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT045979 KMT2D lysine methyltransferase 2D 1 1
MIRT045980 SLC25A1 solute carrier family 25 member 1 1 1
MIRT045981 ZNF212 zinc finger protein 212 1 1
MIRT045982 SLC19A1 solute carrier family 19 member 1 1 1
MIRT045983 LTA4H leukotriene A4 hydrolase 1 1
MIRT045984 B4GALT3 beta-1,4-galactosyltransferase 3 1 1
MIRT045985 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 1 1
MIRT045986 FXR1 FMR1 autosomal homolog 1 1 1
MIRT045987 UNG uracil DNA glycosylase 1 1
MIRT045988 HSPD1 heat shock protein family D (Hsp60) member 1 1 1
MIRT045989 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT045990 EPHA7 EPH receptor A7 1 1
MIRT045991 LSS lanosterol synthase 1 1
MIRT045992 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT045993 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT045994 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT045995 ZNF395 zinc finger protein 395 1 1
MIRT045996 UBAP2L ubiquitin associated protein 2 like 1 1
MIRT045997 PLXND1 plexin D1 1 1
MIRT045998 CTDSP1 CTD small phosphatase 1 1 1
MIRT045999 RRP7A ribosomal RNA processing 7 homolog A 1 1
MIRT046000 RPS12 ribosomal protein S12 1 1
MIRT046001 PDZD11 PDZ domain containing 11 1 1
MIRT046002 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 1 1
MIRT046003 RNASEH2A ribonuclease H2 subunit A 1 1
MIRT046004 MTMR4 myotubularin related protein 4 1 1
MIRT046005 ABCC1 ATP binding cassette subfamily C member 1 1 1
MIRT046006 NDC1 NDC1 transmembrane nucleoporin 1 1
MIRT046007 TDG thymine DNA glycosylase 1 1
MIRT046008 SMC2 structural maintenance of chromosomes 2 2 3
MIRT046009 MATR3 matrin 3 1 1
MIRT046010 TARDBP TAR DNA binding protein 1 1
MIRT046011 FBN1 fibrillin 1 1 1
MIRT046012 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT046013 STARD8 StAR related lipid transfer domain containing 8 1 1
MIRT046014 DDX50 DExD-box helicase 50 1 1
MIRT046015 GANAB glucosidase II alpha subunit 1 1
MIRT046016 NUP93 nucleoporin 93 1 1
MIRT046017 NUP205 nucleoporin 205 1 1
MIRT046018 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT046019 HSPBP1 HSPA (Hsp70) binding protein 1 1 1
MIRT046020 PLA2G4F phospholipase A2 group IVF 1 1
MIRT046021 FAM60A SIN3-HDAC complex associated factor 1 1
MIRT046022 DHX38 DEAH-box helicase 38 1 1
MIRT046023 PRDX2 peroxiredoxin 2 1 1
MIRT046024 FAM208A family with sequence similarity 208 member A 1 1
MIRT046025 ZDHHC5 zinc finger DHHC-type containing 5 1 1
MIRT046026 FAT1 FAT atypical cadherin 1 1 1
MIRT046027 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT046028 EHMT1 euchromatic histone lysine methyltransferase 1 1 1
MIRT046029 SUGP2 SURP and G-patch domain containing 2 1 1
MIRT046030 GALNT18 polypeptide N-acetylgalactosaminyltransferase 18 1 1
MIRT046031 SPEN spen family transcriptional repressor 1 1
MIRT046032 FBXO38 F-box protein 38 1 1
MIRT046033 FAM91A1 family with sequence similarity 91 member A1 1 1
MIRT046034 EMD emerin 1 1
MIRT046035 AKAP2 A-kinase anchoring protein 2 1 1
MIRT046036 PCBP2 poly(rC) binding protein 2 1 1
MIRT046037 SDHB succinate dehydrogenase complex iron sulfur subunit B 1 1
MIRT046038 PSMB1 proteasome subunit beta 1 1 1
MIRT046039 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT046040 CSRNP2 cysteine and serine rich nuclear protein 2 1 1
MIRT046041 RANBP2 RAN binding protein 2 1 1
MIRT046042 SEC24A SEC24 homolog A, COPII coat complex component 1 1
MIRT046043 TNKS1BP1 tankyrase 1 binding protein 1 1 1
MIRT046044 ESRP2 epithelial splicing regulatory protein 2 1 1
MIRT046045 RPL35A ribosomal protein L35a 1 1
MIRT046046 TMEM2 transmembrane protein 2 1 1
MIRT046047 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT046048 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT046049 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT046050 FMNL3 formin like 3 1 1
MIRT046051 PABPC4 poly(A) binding protein cytoplasmic 4 1 1
MIRT046052 RPL3 ribosomal protein L3 1 1
MIRT046053 AURKB aurora kinase B 1 1
MIRT046054 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 1 1
MIRT046055 TIMM23 translocase of inner mitochondrial membrane 23 1 1
MIRT046056 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT046057 TEF TEF, PAR bZIP transcription factor 1 1
MIRT046058 MED1 mediator complex subunit 1 1 1
MIRT046059 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT046060 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT046061 BTBD3 BTB domain containing 3 1 1
MIRT046062 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 1 1
MIRT046063 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT046064 PTGES prostaglandin E synthase 1 1
MIRT046065 MEPCE methylphosphate capping enzyme 1 1
MIRT046066 MTF1 metal regulatory transcription factor 1 1 1
MIRT046067 PKM pyruvate kinase, muscle 1 1
MIRT046068 BCL2L13 BCL2 like 13 1 1
MIRT046069 IRS4 insulin receptor substrate 4 1 1
MIRT046070 NRD1 nardilysin convertase 1 1
MIRT046071 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT046072 FZD4 frizzled class receptor 4 1 1
MIRT046073 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT046074 NRARP NOTCH regulated ankyrin repeat protein 1 1
MIRT046075 THUMPD1 THUMP domain containing 1 1 1
MIRT046076 HDGF heparin binding growth factor 1 1
MIRT046077 ZFYVE1 zinc finger FYVE-type containing 1 1 1
MIRT046078 HBS1L HBS1 like translational GTPase 1 1
MIRT046079 C19orf54 chromosome 19 open reading frame 54 1 1
MIRT046080 RIMS4 regulating synaptic membrane exocytosis 4 1 1
MIRT046081 MTMR12 myotubularin related protein 12 1 1
MIRT046082 NME2 NME/NM23 nucleoside diphosphate kinase 2 1 1
MIRT046083 TMEM9 transmembrane protein 9 1 1
MIRT046084 ACSS1 acyl-CoA synthetase short chain family member 1 1 1
MIRT046085 USP8 ubiquitin specific peptidase 8 1 1
MIRT046086 FUS FUS RNA binding protein 1 1
MIRT046087 PAM peptidylglycine alpha-amidating monooxygenase 1 1
MIRT046088 NPTN neuroplastin 1 1
MIRT046089 FRAT2 FRAT2, WNT signaling pathway regulator 1 1
MIRT046090 NEBL nebulette 1 1
MIRT046091 PARP1 poly(ADP-ribose) polymerase 1 1 1
MIRT046092 RPS28 ribosomal protein S28 1 1
MIRT046093 STC2 stanniocalcin 2 1 1
MIRT046094 LSM14B LSM family member 14B 1 1
MIRT046095 C1orf109 chromosome 1 open reading frame 109 1 1
MIRT046096 KPNB1 karyopherin subunit beta 1 1 1
MIRT046097 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT046098 C17orf80 chromosome 17 open reading frame 80 1 1
MIRT046099 EMC1 ER membrane protein complex subunit 1 1 1
MIRT046100 ETF1 eukaryotic translation termination factor 1 1 1
MIRT046101 TIMM10 translocase of inner mitochondrial membrane 10 1 1
MIRT046102 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT046103 RYBP RING1 and YY1 binding protein 1 1
MIRT046104 ABL1 ABL proto-oncogene 1, non-receptor tyrosine kinase 1 1
MIRT046105 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT052977 CDH5 cadherin 5 2 1
MIRT052991 ARID3A AT-rich interaction domain 3A 3 1
MIRT053019 BCL2L2 BCL2 like 2 3 2
MIRT053093 NCOR2 nuclear receptor corepressor 2 2 1
MIRT053114 Prtg protogenin 1 1
MIRT053126 EIF5A2 eukaryotic translation initiation factor 5A2 3 1
MIRT053210 MXD1 MAX dimerization protein 1 3 1
MIRT053294 PIAS3 protein inhibitor of activated STAT 3 2 1
MIRT053622 PIK3CD phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta 3 2
MIRT054197 PCTP phosphatidylcholine transfer protein 6 3
MIRT054198 LIPA lipase A, lysosomal acid type 4 1
MIRT054199 GSS glutathione synthetase 6 3
MIRT054200 IKZF2 IKAROS family zinc finger 2 4 1
MIRT054201 IKZF3 IKAROS family zinc finger 3 4 1
MIRT054202 IKZF4 IKAROS family zinc finger 4 4 1
MIRT054251 ICAM2 intercellular adhesion molecule 2 2 1
MIRT054863 VPS4B vacuolar protein sorting 4 homolog B 1 1
MIRT061544 BTG2 BTG anti-proliferation factor 2 5 5
MIRT082471 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT096812 ZSWIM6 zinc finger SWIM-type containing 6 2 4
MIRT114798 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 2 2
MIRT213247 REST RE1 silencing transcription factor 2 6
MIRT256243 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT259021 SET SET nuclear proto-oncogene 3 1
MIRT263904 CCNJ cyclin J 2 1
MIRT264962 TMEM136 transmembrane protein 136 2 2
MIRT437377 ENPEP glutamyl aminopeptidase 2 1
MIRT437426 CSNK2A1 casein kinase 2 alpha 1 4 3
MIRT437427 MEGF9 multiple EGF like domains 9 2 1
MIRT438070 MAN1B1 mannosidase alpha class 1B member 1 3 1
MIRT438152 EPOR erythropoietin receptor 1 1
MIRT438200 AHRR aryl-hydrocarbon receptor repressor 1 1
MIRT438382 SCNN1A sodium channel epithelial 1 alpha subunit 3 1
MIRT438383 VPS51 VPS51, GARP complex subunit 1 1
MIRT438446 SIRT7 sirtuin 7 4 1
MIRT438607 DUSP6 dual specificity phosphatase 6 3 1
MIRT438630 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT443833 SH3BP5L SH3 binding domain protein 5 like 2 2
MIRT445606 SEC14L3 SEC14 like lipid binding 3 2 2
MIRT465488 TOR2A torsin family 2 member A 2 4
MIRT476184 GOLGA8A golgin A8 family member A 2 10
MIRT493997 EHD1 EH domain containing 1 2 2
MIRT495844 PLXDC1 plexin domain containing 1 2 2
MIRT499274 NBPF11 NBPF member 11 2 2
MIRT500382 ZNF385A zinc finger protein 385A 2 2
MIRT501239 SEMA4C semaphorin 4C 2 6
MIRT501289 SCARB2 scavenger receptor class B member 2 2 4
MIRT507112 GOLGA8B golgin A8 family member B 2 6
MIRT516592 SPHAR S-phase response (cyclin related) 2 2
MIRT520026 YOD1 YOD1 deubiquitinase 2 2
MIRT521491 RAB4A RAB4A, member RAS oncogene family 2 2
MIRT529736 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT535158 PLEKHG5 pleckstrin homology and RhoGEF domain containing G5 2 2
MIRT536272 LONRF2 LON peptidase N-terminal domain and ring finger 2 2 2
MIRT536762 HOXD1 homeobox D1 2 2
MIRT543000 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT546392 STOX2 storkhead box 2 2 4
MIRT549615 TMEM101 transmembrane protein 101 2 2
MIRT549719 NUP37 nucleoporin 37 2 4
MIRT554041 SPATA5 spermatogenesis associated 5 2 4
MIRT556137 MFSD9 major facilitator superfamily domain containing 9 2 4
MIRT558392 DHX33 DEAH-box helicase 33 2 2
MIRT563112 IFRD2 interferon related developmental regulator 2 2 2
MIRT565608 SLC35G1 solute carrier family 35 member G1 2 2
MIRT568045 CLDN12 claudin 12 2 2
MIRT570734 ARIH2 ariadne RBR E3 ubiquitin protein ligase 2 2 2
MIRT571035 CENPP centromere protein P 2 2
MIRT571789 PPP2CA protein phosphatase 2 catalytic subunit alpha 2 2
MIRT572312 LSM4 LSM4 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT575784 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 3
MIRT576291 Cd59a CD59a antigen 1 1
MIRT576741 Wars tryptophanyl-tRNA synthetase 2 2
MIRT607245 LINS lines homolog 1 2 4
MIRT609420 GJB7 gap junction protein beta 7 2 4
MIRT612153 SIX1 SIX homeobox 1 2 4
MIRT613297 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT615703 NEGR1 neuronal growth regulator 1 2 2
MIRT624129 HID1 HID1 domain containing 2 2
MIRT630470 FAM174B family with sequence similarity 174 member B 2 2
MIRT630954 PANK1 pantothenate kinase 1 2 2
MIRT632958 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT637229 TMEM59 transmembrane protein 59 2 2
MIRT642939 KRTAP5-9 keratin associated protein 5-9 2 2
MIRT655221 PFKM phosphofructokinase, muscle 2 2
MIRT661614 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT681983 HRH4 histamine receptor H4 2 2
MIRT695579 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT698175 TNFRSF10B TNF receptor superfamily member 10b 2 3
MIRT700565 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT703233 GOLGA1 golgin A1 2 2
MIRT708536 ZNF177 zinc finger protein 177 2 2
MIRT713724 CD244 CD244 molecule 2 2
MIRT717701 PTGS1 prostaglandin-endoperoxide synthase 1 2 2
MIRT719848 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT720224 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT720282 EIF1AD eukaryotic translation initiation factor 1A domain containing 2 2
MIRT721456 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT724277 HMGCLL1 3-hydroxymethyl-3-methylglutaryl-CoA lyase like 1 2 2
MIRT724800 C1D C1D nuclear receptor corepressor 2 2
MIRT731325 SPHK1 sphingosine kinase 1 1 1
MIRT731453 MMP2 matrix metallopeptidase 2 1 1
MIRT731486 MMP26 matrix metallopeptidase 26 1 1
MIRT731595 MAP3K11 mitogen-activated protein kinase kinase kinase 11 3 1
MIRT731695 SFRP5 secreted frizzled related protein 5 1 1
MIRT732755 CDK1 cyclin dependent kinase 1 2 0
MIRT732757 CCNB1 cyclin B1 2 0
MIRT732758 BAX BCL2 associated X, apoptosis regulator 2 0
MIRT734369 MX1 MX dynamin like GTPase 1 3 0
MIRT734394 KCNA1 potassium voltage-gated channel subfamily A member 1 2 0
MIRT734395 GPC1 glypican 1 2 0
MIRT734665 ACE2 angiotensin I converting enzyme 2 1 0
MIRT734747 MAP2K7 mitogen-activated protein kinase kinase 7 2 0
MIRT735377 DRAM2 DNA damage regulated autophagy modulator 2 3 0
MIRT735423 TRAF6 TNF receptor associated factor 6 1 0
MIRT735594 CPSF6 cleavage and polyadenylation specific factor 6 3 0
MIRT735703 ACADS acyl-CoA dehydrogenase, C-2 to C-3 short chain 3 0
MIRT736025 CD4 CD4 molecule 2 0
MIRT737080 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT737379 FOXA1 forkhead box A1 4 0
MIRT737439 SMYD2 SET and MYND domain containing 2 2 0
MIRT737440 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 0
MIRT755338 TPD52 tumor protein D52 3 1
MIRT756025 DDB2 damage specific DNA binding protein 2 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-125b Quercetin NULL 5280343 Quantitative real-time PCR liver 22402395 2012 up-regulated
miR-125b Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-125b Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice lung 20145010 2010 up-regulated
miR-125b Cyclophosphamide approved 2907 Quantitative real-time PCR p53+/+ pregnant mice 20170545 2010 down-regulated
miR-125b Emodin NULL 3220 Microarray K562 cells 23744534 2013 down-regualted
miR-125b Methamphetamine approved 10836 Quantitative real-time PCR CD4+ T cells 24434277 2014 up-regulated
miR-125b Benzo(a)pyrene NULL 2336 Microarray MM plasma cells 24798859 2014 up-regulated
miR-125b Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 up-regulated
miR-125b Iron-sulfates and Aluminum-sulfates NULL NULL Northern blot human neural cells 17629564 2007 up-regulated
miR-125b Capecitabine approved 60953 Quantitative real-time PCR rectal cancer 18695884 2008 up-regulated
miR-125b Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 down-regulated
miR-125b Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-125b Morphine approved 5288826 Quantitative real-time PCR HIV 21224041 2011 down-regulated
miR-125b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-125b Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-125b Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 up-regulated
miR-125b Aidi injection NULL NULL Quantitative real-time PCR human breast cancer cells 21563499 2011 up-regulated
miR-125b Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-125b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-125b 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-125b 1alpha,25-Dihydroxyvitamin D3 + 5-Aza + trichostatin A(TSA) NULL NULL Quantitative real-time PCR melanoma 22213330 2012 down-regulated
miR-125b 5-azacytidine (5-AzaC) approved 9444 Quantitative real-time PCR melanoma cell 22213330 2012 up-regulated
miR-125b 5-azacytidine (5-AzaC) approved 9444 Quantitative real-time PCR melanoma 22213330 2012 down-regulated
miR-125b Camptothecin NULL 24360 Quantitative real-time PCR K562 and HeLa cells 22252650 2012 down-regulated
miR-125b Cisplatin approved 84093 Quantitative real-time PCR HeLa cells 22475935 2012 down-regulated
miR-125b 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-125b Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-125b Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-125b Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-125b Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miR-125b Cocaine NULL 446220 Quantitative real-time PCR CD4+ T cells 23251514 2012 down-regulated
miR-125b All-trans-retinoic acid (ATRA) approved 444795 Northern blot spina bifida rat fetus 17962954 2007 down-regulated
miR-125b Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 up-regulated
miR-125b Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-125b 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miR-125b Emodin NULL 3220 Quantitative real-time PCR K562 cells 23744534 2013 down-regualted
miR-125b Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miR-125b-5p Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-125b-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-125b-5p Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-125b-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-125b-5p Comfrey NULL 6440495 Quantitative real-time PCR rat liver 21370286 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-125b-5p (2R,6R,7R,12S)-9-tert-butyl-16-methoxy-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 371264 NSC645323 sensitive
hsa-miR-125b-5p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 sensitive
hsa-miR-125b-5p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 sensitive
hsa-miR-125b-5p (4Z)-4-[(4-chlorophenyl)methylidene]-2-[(2E)-2-(2,3,4,5,6-pentahydroxyhexylidene)hydrazinyl]-1H-imidazol-5-one 135484999 NSC685272 sensitive
hsa-miR-125b-5p (9,10-dioxoanthracen-2-yl)methyl 3-benzamido-2-hydroxy-3-phenylpropanoate 361915 NSC625350 sensitive
hsa-miR-125b-5p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 sensitive
hsa-miR-125b-5p (E)-3-(2-nitrophenyl)-1-(3,6,7-trimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)prop-2-en-1-one 5351352 NSC621486 sensitive
hsa-miR-125b-5p [(6aS,11aR)-2,3,8-trimethoxy-6-methyl-5,11-dioxo-6a,11a-dihydroindeno[1,2-c]isoquinolin-9-yl] methanesulfonate 341886 NSC376254 sensitive
hsa-miR-125b-5p [(z)-[4-(2,4-dichloroanilino)-2-oxo-1-naphthylidene]amino]thiourea 3000994 NSC657676 sensitive
hsa-miR-125b-5p [3,4,5-triacetyloxy-6-[(4Z)-4-[(4-chlorophenyl)methylidene]-5-oxo-1-prop-2-enylimidazol-2-yl]sulfanyloxan-2-yl]methyl acetate 5470570 NSC703037 sensitive
hsa-miR-125b-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-6-(4-methoxyphenyl)-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 383442 NSC671809 sensitive
hsa-miR-125b-5p [3,4,5-triacetyloxy-6-[5-[(2-methoxyphenyl)methyl]-3-phenyl-6-sulfanylidene-1,2,4-triazin-1-yl]oxan-2-yl]methyl acetate 362262 NSC625873 sensitive
hsa-miR-125b-5p [4-(4-aminophenyl)sulfonylphenyl]-[4-(4-aminophenyl)sulfonylphenyl]imino-oxidoazanium 380146 NSC665549 sensitive
hsa-miR-125b-5p [6-methoxy-3,4-bis-(4-methylphenyl)sulfonyloxyoxan-2-yl]methyl 4-methylbenzenesulfonate 359615 NSC620674 sensitive
hsa-miR-125b-5p [7-benzyl-6-bromo-2,4-bis(methylsulfanyl)pyrrolo[2,3-d]pyrimidin-5-yl]methanol 357482 NSC616511 sensitive
hsa-miR-125b-5p 1-(2-hydroxybenzoyl)-3-methyl-4-(4-methoxybenzylidene)-1h-pyrazole-5(4h)-one 5351408 NSC652174 sensitive
hsa-miR-125b-5p 1-[3-[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]-5-phenyl-3,4-dihydropyrazol-2-yl]ethanone 155815904 NSC763582 sensitive
hsa-miR-125b-5p 13-(4-methylphenyl)sulfonyl-1,4,7,10-tetrathia-13-azacyclopentadecane 373829 NSC650792 sensitive
hsa-miR-125b-5p 2-(1H-imidazol-2-ylmethyl)-5-(1H-imidazol-5-ylmethyl)-1H-imidazole 370230 NSC643000 resistant
hsa-miR-125b-5p 2-(2-(2-(2,4,5-tris(2-(2-(1,3-dioxolan-2-yl)phenoxy)ethoxy)phenoxy)ethoxy)phenyl)-1,3-dioxolane 374816 NSC653153 sensitive
hsa-miR-125b-5p 2-[(2e)-2-[(4-nitrophenyl)methylene]hydrazino]-3-phenyl-quinazolin-4-one 9571453 NSC666355 sensitive
hsa-miR-125b-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 sensitive
hsa-miR-125b-5p 2-bromo-6-(5-(4-methoxyphenyl)-3-isoxazolyl)-4-methylphenol 355054 NSC607993 sensitive
hsa-miR-125b-5p 3-[6-(2,5-dioxo-4,4-diphenylimidazolidin-1-yl)hexyl]-5,5-diphenylimidazolidine-2,4-dione 343242 NSC382386 sensitive
hsa-miR-125b-5p 4-(1-(4-aminophenyl)-3,4-diphenyl-1h-1.lambda.~4~-thien-1-yl)phenylamine 392992 NSC694234 sensitive
hsa-miR-125b-5p 4-(4-fluorophenyl)-2-[8-[[4-(4-fluorophenyl)-5-propyl-1h-imidazol-2-yl]sulfanyl]octylsulfanyl]-5-propyl-1h-imidazole;methanesulfonic acid 374589 NSC652562 sensitive
hsa-miR-125b-5p 4-[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]-2-oxo-6-phenyl-1H-pyridine-3-carbonitrile 155809889 NSC762934 sensitive
hsa-miR-125b-5p 4-[4-(4-chlorophenyl)piperazin-1-yl]-6-(4-methoxyphenyl)-2-oxo-2h-pyran-3-carbonitrile 360621 NSC622926 sensitive
hsa-miR-125b-5p 5-hydroxy-3,6,8-trimethoxy-2-(3,4,5-trimethoxyphenyl)chromen-4-one 355799 NSC610173 sensitive
hsa-miR-125b-5p 5,7-dihydroquinolino[3,2-d][1]benzazepine-6-thione 3005168 NSC679092 sensitive
hsa-miR-125b-5p 5h-naphtho[2,3-c][1]benzazepine-6,13-dione 386348 NSC678131 sensitive
hsa-miR-125b-5p 6-(3-morpholin-4-ylpropyl)indeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 45027959 NSC740275 sensitive
hsa-miR-125b-5p 6-(4-bromo-phenyl)-3-(4-chloro-phenoxymethyl)-7h-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 364168 NSC629868 sensitive
hsa-miR-125b-5p 6-(4-methoxyphenyl)-2-oxo-4-(4-phenylpiperazin-1-yl)-2h-pyran-3-carbonitrile 360619 NSC622924 sensitive
hsa-miR-125b-5p 9-(oxan-2-yl)-1,3-diphenyl-2-sulfanylidenepurin-6-one 387937 NSC682242 sensitive
hsa-miR-125b-5p Aspiculamycin hcl 5458423 NSC200692 sensitive
hsa-miR-125b-5p Atorvastatin calcium (usan) 60148418 NSC758617 sensitive
hsa-miR-125b-5p C18281 361185 NSC624114 sensitive
hsa-miR-125b-5p Crotoxin cd NSC636009 sensitive
hsa-miR-125b-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-125b-5p Fluvastatin 1548972 NSC758896 approved sensitive
hsa-miR-125b-5p Gardenin 261859 NSC94889 sensitive
hsa-miR-125b-5p Imidazole, 1-(4-chlorophenyl)-4-(4-nitrophenyl)- 355940 NSC610744 sensitive
hsa-miR-125b-5p Lovastatin 53232 NSC633781 approved sensitive
hsa-miR-125b-5p Ls-150387 365515 NSC633203 sensitive
hsa-miR-125b-5p Ls-154710 380361 NSC665883 resistant
hsa-miR-125b-5p Methyl 2-[(2e)-2-[(2,6-dichlorophenyl)methylidene]hydrazinyl]-5-(3,4,5-trimethoxyphenyl)-1h-pyrrole-3-carboxylate 45029264 NSC745940 sensitive
hsa-miR-125b-5p N'-(cyano(3-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375018 NSC653844 sensitive
hsa-miR-125b-5p N-(4-methoxyphenyl)-3-[4-[(4-methylphenyl)diazenyl]-3,5-diphenylpyrazol-1-yl]-3-oxopropanamide 367846 NSC637921 sensitive
hsa-miR-125b-5p N-[(e)-(2,4-dihydroxyphenyl)methylideneamino]-4-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968275 NSC747461 sensitive
hsa-miR-125b-5p N-[(e)-benzylideneamino]-2-(3-benzyl-6-iodo-4-oxoquinazolin-2-yl)sulfanylacetamide 9572422 NSC715740 sensitive
hsa-miR-125b-5p N-methyl-2,4-dinitro-N-[(E)-quinolin-8-ylmethylideneamino]aniline 9555808 NSC630684 sensitive
hsa-miR-125b-5p NSC618857 NSC618857 sensitive
hsa-miR-125b-5p NSC762756 NSC762756 sensitive
hsa-miR-125b-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-125b-5p Rhamnazin 5320945 NSC678106 sensitive
hsa-miR-125b-5p Tert-butyl N-[3-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)propyl]carbamate 11304253 NSC725047 sensitive
hsa-miR-125b-5p Zinc;2-(3,4-dimethoxyphenyl)-5-hydroxy-3,7-dimethoxychromen-4-one NSC408171 sensitive
hsa-miR-125b-5p Trail resistant High Non-Small Cell Lung Cancer cell line (CALU-1, A459, H460)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved resistant Low Breast Cancer cell line (MDA-435, BT-474)
hsa-miR-125b-5p Daunorubicin 30323 NSC82151 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-125b-5p Daunorubicin 30323 NSC82151 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-125b-5p Prednisolone 5755 NSC9120 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-125b-5p Vincristine 5978 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-125b-5p L-Asparaginase resistant High Lymphoblastic Leukemia tissue
hsa-miR-125b-5p Vincristine 5978 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-125b-5p L-Asparaginase sensitive High Lymphoblastic Leukemia tissue
hsa-miR-125b-5p Prednisolone 5755 NSC9120 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive High Germ Cell Tumor cell line (NTERA-2)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive High Germ Cell Tumor cell line (NTERA-2, NCCIT, 2102EP)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant Low Ovarian Cancer cell line (OV2008)
hsa-miR-125b-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma Glioblastoma Stem Cells
hsa-miR-125b-5p Tretinoin 5538 NSC122758 approved resistant Low Pediatric Acute Promyelocytic Leukemia cell line (NB4)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved resistant Low Pediatric Acute Promyelocytic Leukemia cell line (HL60, K562)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved sensitive High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-125b-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved resistant Low Breast Cancer tissue and cell line (MCF-7, T47D, BT20, MDA-MB-231)
hsa-miR-125b-5p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved resistant Low Breast Cancer cell line (HMLE)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved resistant Low Breast Cancer cell line (MDA-MB-435, SKBR3, HMLE)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Colon Cancer tissue and cell line (HT-29)
hsa-miR-125b-5p Etoposide 36462 NSC141540 approved resistant Low Ewing Sarcoma cell line (VH-64, WE-68)
hsa-miR-125b-5p Vincristine 5978 approved resistant Low Ewing Sarcoma cell line (VH-64, WE-68)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved resistant Low Ewing Sarcoma cell line (VH-64, WE-68)
hsa-miR-125b-5p Mafosfamide 76968809 resistant High Ewing Sarcoma/Primitive Neuroectodermal Tumor cell line (VH-64, WE-68)
hsa-miR-125b-5p Bortezomib 387447 NSC681239 approved resistant Low Cutaneous T-Cell Lymphoma cell line (SeAx, MyLa)
hsa-miR-125b-5p Chemotherapy resistant Low Breast Cancer tissue
hsa-miR-125b-5p Dexamethasone 5743 NSC34521 approved resistant Low Multiple Myeloma cell line (MM1S, MM1R)
hsa-miR-125b-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma Primary Glioblastoma Cell
hsa-miR-125b-5p Vincristine 5978 approved resistant Low Childhood Acute Lymphoblastic Leukemia Reh cells
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-125b-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-125b-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-125b-5p Daunorubicin 30323 NSC82151 approved resistant Low Leukemia cell line (K562, THP1, Jurkat, REH, HEK293T)
hsa-miR-125b-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma tissue and glioblastoma stem cells
hsa-miR-125b-5p Rituximab sensitive Low Rheumatoid Arthritis tissue
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (BGC823)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (HepG3)
hsa-miR-125b-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, LN-18)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Ductal Adenocarcinoma cell line (BxPC-3)
hsa-miR-125b-5p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-125b-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant Low Nasopharyngeal Cancer cell line (TW03)
hsa-miR-125b-5p Temozolomide 5394 NSC362856 approved resistant Low Glioma Stem Cancer Primary Glioblastoma Stem Cell
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549-PR, H460)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H460)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-125b-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (PANC-1, MIA-PaCa-2)
hsa-miR-125b-5p Vincristine 5978 approved resistant High Colon Cancer cell line (HCT-8)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive High Small Cell Lung Cancer cell line (H446)
hsa-miR-125b-5p Vemurafenib 42611257 NSC761431 approved resistant Low Melanoma tissue and cell line (PLX4032, LM16)
hsa-miR-125b-5p Vemurafenib 42611257 NSC761431 approved resistant Low Melanoma cell line (PLX4032, LM16)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma cell line (U-2-OS, MG-63)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved sensitive Low Chondrosarcoma cell line (JJ012, CH-2879, SW1353)
hsa-miR-125b-5p Bortezomib 387447 NSC681239 approved sensitive High Multiple Myeloma tissue
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-125b-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116, SW620)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gallbladder Cancer cell line (NOZ, GBC-SD)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Nasopharyngeal Cancer cell line (CNE2)
hsa-miR-125b-5p Etoposide 36462 NSC141540 approved sensitive Low Nasopharyngeal Cancer cell line (CNE2)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved sensitive Low Nasopharyngeal Cancer cell line (CNE2)
hsa-miR-125b-5p Vincristine 5978 approved sensitive Low Nasopharyngeal Cancer cell line (CNE2)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (HGC-27, MGC-803)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7, MDA-MB-231, T-47D)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Thyroid Cancer cell line (WRO, FRO)
hsa-miR-125b-5p Sorafenib 216239 NSC747971 approved sensitive Low Thyroid Cancer cell line (WRO, FRO)
hsa-miR-125b-5p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab resistant High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (VCaP-R, DU-145-R)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved resistant Low Leukemia cell line (HL-60, K562)
hsa-miR-125b-5p Calcitriol 5280453 NSC749776 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Tacalcitol 5283734 sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-125b-5p Trail sensitive Low Glioma cell line (U87, U251)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1, PANC-1)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-125b-5p Bromocriptine 31101 NSC169774 approved sensitive High Prolactinoma tissue
hsa-miR-125b-5p Tamoxifen + Docetaxel sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-125b-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer cell line (HCT-116, HCT8, HT-29)
hsa-miR-125b-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colon Cancer cell line (HCT-116, HCT8, HT-29)
hsa-miR-125b-5p Doxorubicin 31703 NSC123127 approved resistant Low Renal Cell Cancer cell line (OSRC-2, 786-O)
hsa-miR-125b-5p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer cell line (OSRC-2, 786-O)
hsa-miR-125b-5p Rituximab resistant High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-125b-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer cell line (HT-29)
hsa-miR-125b-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colon Cancer cell line (HT-29)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-125b-5p Cisplatin + Decitabine resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-125b-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line
hsa-miR-125b-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line
hsa-miR-125b-5p Dabrafenib + Trametinib resistant High Melanoma cell line
hsa-miR-125b-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line
hsa-miR-125b-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant Low Ovarian Cancer cell line (SKOV3, COC1)
hsa-miR-125b-5p Rituximab resistant Low Diffuse Large B-Cell Lymphoma cell line (SUDHL-4, OCI-LY8, NU-DUL-1)
hsa-miR-125b-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, PC-9)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-125b-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant High Epithelial Ovarian Cancer cell line (SKOV3)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-125b-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-125b-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-125b-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-125b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-125b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-125b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-125b-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant tissue
hsa-miR-125b-5p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-125b-5p Testosterone+Anastrozole sensitive cell line (MCF-7)
hsa-miR-125b-5p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-125b-5p Testosterone+Letrozole sensitive cell line (MCF-7)
hsa-miR-125b-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-125b-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-125b-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-125b-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-125b-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-125b-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-125b-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-125b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-125b-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-125b-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-125b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MDAH-2774)

Error report submission