>EZH2|NM_004456|3'UTR
   1 CATCTGCTACCTCCTCCCCCCTCCTCTGAAACAGCTGCCTTAGCTTCAGGAACCTCGAGTACTGTGGGCAATTTAGAAAA
  81 AGAACATGCAGTTTGAAATTCTGAATTTGCAAAGTACTGTAAGAATAATTTATAGTAATGAGTTTAAAAATCAACTTTTT
 161 ATTGCCTTCTCACCAGCTGCAAAGTGTTTTGTACCAGTGAATTTTTGCAATAATGCAGTATGGTACATTTTTCAACTTTG
 241 AATAAAGAATACTTGAACTTGTCCTTGTTGAATC

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aagUCAAUAGUGUCAUGACAu 5' | || || |||||||| Target 5' ctgAATTTGCAAAGTACTGTa 3'	101 - 121	158.00	-12.70
2	miRNA 3' aaGUCAAUAGUG-UCAUGACAu 5' ||| | | | |||||||| Target 5' ttCAGGAACCTCGAGTACTGTg 3'	45 - 66	155.00	-15.80
3	miRNA 3' aaGUCAAUAGUGUCAUGACAu 5' || | || :|||||: || Target 5' tgCAATAAT-GCAGTATGGTa 3'	206 - 225	114.00	-7.40

Mutant ID	Mutant Position	Mutant Source
259400	22	ClinVar
COSN20104935	16	COSMIC
COSN30513597	18	COSMIC
COSN31574611	123	COSMIC
COSN31564742	191	COSMIC
COSN7968002	208	COSMIC
COSN7656383	227	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1371919884	2	dbSNP
rs754610785	3	dbSNP
rs755736107	3	dbSNP
rs749969922	4	dbSNP
rs1413229782	5	dbSNP
rs770439804	6	dbSNP
rs745948888	7	dbSNP
rs1284594674	10	dbSNP
rs757722069	13	dbSNP
rs368565050	15	dbSNP
rs373732420	16	dbSNP
rs1387932593	17	dbSNP
rs752038271	19	dbSNP
rs763362563	20	dbSNP
rs201597962	21	dbSNP
rs3217095	22	dbSNP
rs753561759	22	dbSNP
rs1190956709	23	dbSNP
rs765595441	24	dbSNP
rs1190173361	25	dbSNP
rs760581114	25	dbSNP
rs759825516	26	dbSNP
rs1248823368	28	dbSNP
rs929618724	32	dbSNP
rs1449218793	34	dbSNP
rs1464179086	41	dbSNP
rs1265646766	42	dbSNP
rs1223606561	56	dbSNP
rs148678300	57	dbSNP
rs1171494357	64	dbSNP
rs144048372	74	dbSNP
rs11541108	84	dbSNP
rs988279632	84	dbSNP
rs1410024952	85	dbSNP
rs1354348266	89	dbSNP
rs1300558826	95	dbSNP
rs1367625706	102	dbSNP
rs956946414	111	dbSNP
rs1255519873	112	dbSNP
rs1467082608	115	dbSNP
rs972290649	116	dbSNP
rs1279934547	117	dbSNP
rs1359676356	117	dbSNP
rs560622782	119	dbSNP
rs8829	120	dbSNP
rs1464779480	131	dbSNP
rs1187069920	132	dbSNP
rs1250222404	133	dbSNP
rs1449717297	133	dbSNP
rs1158238278	138	dbSNP
rs776815138	138	dbSNP
rs1375471721	140	dbSNP
rs1467114972	141	dbSNP
rs537734267	142	dbSNP
rs1413876445	143	dbSNP
rs987910653	145	dbSNP
rs928168090	146	dbSNP
rs1473033750	147	dbSNP
rs746851379	148	dbSNP
rs981324605	161	dbSNP
rs777364681	162	dbSNP
rs1180193614	165	dbSNP
rs1300820364	166	dbSNP
rs570106117	184	dbSNP
rs1029517927	187	dbSNP
rs969507672	191	dbSNP
rs1366995364	192	dbSNP
rs1235507223	193	dbSNP
rs550195890	199	dbSNP
rs1484251932	207	dbSNP
rs565204867	210	dbSNP
rs1207326946	213	dbSNP
rs1238577794	213	dbSNP
rs533468838	218	dbSNP
rs570918453	223	dbSNP
rs1327581661	226	dbSNP
rs545323662	238	dbSNP
rs1010901792	239	dbSNP
rs1270413969	241	dbSNP
rs1434468447	241	dbSNP
rs956687476	260	dbSNP
rs372069007	262	dbSNP

- Cell, 2003

MicroRNAs (miRNAs) can play important gene regulatory roles in nematodes, insects, and plants by basepairing to mRNAs to specify posttranscriptional repression of these messages. However, the mRNAs regulated by vertebrate miRNAs are all unknown. Here we predict more than 400 regulatory target genes for the conserved vertebrate miRNAs by identifying mRNAs with conserved pairing to the 5' region of the miRNA and evaluating the number and quality of these complementary sites. Rigorous tests using shuffled miRNA controls supported a majority of these predictions, with the fraction of false positives estimated at 31% for targets identified in human, mouse, and rat and 22% for targets identified in pufferfish as well as mammals. Eleven predicted targets (out of 15 tested) were supported experimentally using a HeLa cell reporter system. The predicted regulatory targets of mammalian miRNAs were enriched for genes involved in transcriptional regulation but also encompassed an unexpectedly broad range of other functions.

- Science (New York, N.Y.), 2008

Enhancer of zeste homolog 2 (EZH2) is a mammalian histone methyltransferase that contributes to the epigenetic silencing of target genes and regulates the survival and metastasis of cancer cells. EZH2 is overexpressed in aggressive solid tumors by mechanisms that remain unclear. Here we show that the expression and function of EZH2 in cancer cell lines are inhibited by microRNA-101 (miR-101). Analysis of human prostate tumors revealed that miR-101 expression decreases during cancer progression, paralleling an increase in EZH2 expression. One or both of the two genomic loci encoding miR-101 were somatically lost in 37.5% of clinically localized prostate cancer cells (6 of 16) and 66.7% of metastatic disease cells (22 of 33). We propose that the genomic loss of miR-101 in cancer leads to overexpression of EZH2 and concomitant dysregulation of epigenetic pathways, resulting in cancer progression.

- Translational oncology, 2008

The presence of cervical lymph node metastases in head and neck squamous cell carcinoma (HNSCC) is the strongest determinant of patient prognosis. Owing to the impact of nodal metastases on patient survival, a system for sensitive and accurate detection is required. Clinical staging of lymph nodes is far less accurate than pathological staging. Pathological staging also suffers limitations because it fails to detect micrometastasis in a subset of nodal specimens. To improve the sensitivity of existing means of diagnosing metastatic disease, many advocate the use of molecular markers specific for HNSCC cells. MicroRNA (miRNA) are short noncoding segments of RNA that posttranscriptionally regulate gene expression. Approximately one third of all miRNA will exhibit substantial tissue specificity. Using a quantitative reverse transcription-polymerase chain reaction-based assay, we examined the expression of microRNA-205 (mir-205) across tissues and demonstrated that its expression is highly specific for squamous epithelium. We applied this assay to tissue samples, and we could detect metastatic HNSCC in each positive lymph node specimen, whereas benign specimens did not express this marker. When compared to metastases from other primary tumors, HNSCC-positive lymph nodes were distinguishable by the high expression of this marker. Using an in vitro lymphoid tissue model, we were able to detect as little as one squamous cell in a background of 1 million lymphocytes. By combining the sensitivity of quantitative reverse transcription-polymerase chain reaction with the specificity of mir-205 for squamous epithelium, we demonstrate a novel molecular marker for the detection of metastatic HNSCC.

- Cancer research, 2009

The Polycomb Repressive Complex 2 (PRC2) mediates epigenetic gene silencing by trimethylating histone H3 lysine 27 (H3K27me3) and is known to aberrantly silence tumor suppressor genes in cancer. EZH2, the catalytic subunit of PRC2, enhances tumorigenesis and is commonly overexpressed in several types of cancer. Our microRNA profiling of bladder transitional cell carcinoma (TCC) patient samples revealed that microRNA-101 (miR-101) is down-regulated in TCC, and we showed that miR-101 inhibits cell proliferation and colony formation in TCC cell lines. Furthermore, our results confirm that miR-101 directly represses EZH2 and stable EZH2 knockdowns in TCC cell lines create a similar growth suppressive phenotype. This suggests that abnormal down-regulation of miR-101 could lead to the overexpression of EZH2 frequently seen in cancer. We conclude that miR-101 may be a potent tumor suppressor by altering global chromatin structure through repression of EZH2.

- Cell cycle (Georgetown, Tex.), 2009

- Molecular cell, 2009

Polycomb group (PcG) proteins exert essential functions in the most disparate biological processes. The contribution of PcG proteins to cell commitment and differentiation relates to their ability to repress transcription of developmental regulators in embryonic stem (ES) cells and in committed cell lineages, including skeletal muscle cells (SMC). PcG proteins are preferentially removed from transcribed regions, but the underlying mechanisms remain unclear. Here, PcG proteins are found to occupy and repress transcription from an intronic region containing the microRNA miR-214 in undifferentiated SMC. Differentiation coincides with PcG disengagement, recruitment of the developmental regulators MyoD and myogenin, and activation of miR-214 transcription. Once transcribed, miR-214 negatively feeds back on PcG by targeting the Ezh2 3'UTR, the catalytic subunit of the PRC2 complex. miR-214-mediated Ezh2 protein reduction accelerates SMC differentiation and promotes unscheduled transcription of developmental regulators in ES cells. Thus, miR-214 and Ezh2 establish a regulatory loop controlling PcG-dependent gene expression during differentiation.

- Molecular cancer, 2010

BACKGROUND: In prostate cancer (PCa), the common treatment involving androgen ablation alleviates the disease temporarily, but results in the recurrence of highly aggressive and androgen-independent metastatic cancer. Therefore, more effective therapeutic approaches are needed. It is known that aberrant epigenetics contributes to prostate malignancy. Unlike genetic changes, these epigenetic alterations are reversible, which makes them attractive targets in PCa therapy to impede cancer progression. As a histone methyltransferase, Ezh2 plays an essential role in epigenetic regulation. Since Ezh2 is overexpressed and acts as an oncogene in PCa, it has been proposed as a bona fide target of PCa therapy. MicroRNAs (miRNAs) regulate gene expression through modulating protein translation. Recently, the contribution of miRNAs in cancer development is increasingly appreciated. In this report, we present our study showing that microRNA-101 (miR-101) inhibits Ezh2 expression and differentially regulates prostate cancer cells. In addition, the expression of miR-101 alters upon androgen treatment and HIF-1alpha/HIF-1beta induction. RESULT: In our reporter assays, both miR-101 and miR-26a inhibit the expression of a reporter construct containing the 3'-UTR of Ezh2. When ectopically expressed in PC-3, DU145 and LNCaP cells, miR-101 inhibits endogenous Ezh2 expression in all three cell lines, while miR-26a only decreases Ezh2 in DU145. Ectopic miR-101 reduces the invasion ability of PC-3 cells, while restored Ezh2 expression rescues the invasiveness of PC-3 cells. Similarly, miR-101 also inhibits cell invasion and migration of DU145 and LNCaP cells, respectively. Interestingly, ectopic miR-101 exhibits differential effects on the proliferation of PC-3, DU-145 and LNCaP cells and also causes morphological changes of LNCaP cells. In addition, the expression of miR-101 is regulated by androgen receptor and HIF-1alpha/HIF-1beta. While HIF-1alpha/HIF-1beta induced by deferoxamine mesylate (DFO) decreases miR-101 levels, the overall effects of R-1881 on miR-101 expression are stimulatory. CONCLUSIONS: This study indicates that miR-101 targets Ezh2 and decreases the invasiveness of PCa cells, suggesting that miR-101 introduction is a potential therapeutic strategy to combat PCa. MiR-101 differentially regulates prostate cell proliferation. Meanwhile, the expression of miR-101 is also modulated at different physiological conditions, such as androgen stimulation and HIF-1alpha/HIF-1beta induction.

- European journal of cancer (Oxford, England : 1990), 2010

MicroRNAs (miRNAs) are short non-coding RNA molecules playing regulatory roles by repressing translation or cleaving RNA transcripts. Dysregulated expression of miRNAs is associated with several diseases, including cancer. In this study, we report that the expression of microRNA-101 (miR-101) is down-regulated in gastric cancer tissues and cells, and ectopic expression of miR-101 significantly inhibits cellular proliferation, migration and invasion of gastric cancer cells by targeting EZH2, Cox-2, Mcl-1 and Fos. Our animal study also indicates that miR-101 could potentially suppress tumour growth in vivo. Collectively, these results suggest that miR-101 may function as a tumour suppressor in gastric cancer, as it has an inhibitory role not only in cellular proliferation, migration and invasion in vitro, but also in tumour growth in vivo.

- Cell death & disease, 2010

There is increasing evidence supporting the role of members of the polycomb group (PcG) gene family in tumor development and progression. However, their precise role in tumorigenesis and mechanisms of their regulation remain to be elucidated. Using nasopharyngeal carcinoma (NPC) as a disease model, a comprehensive analysis was undertaken on the clinical significance of EZH2 expression, identification of the cellular processes regulated by EZH2, and the mechanisms of its deregulated expression. Herein, we report EZH2 as being associated with a higher risk of relapse in NPC patients (P = 0.002). Genome-wide microarray and bioinformatics identified several vital cellular processes (such as differentiation, development, and apoptosis) to be regulated by EZH2, corroborated by in vitro lethality, and delayed tumor formation in vivo upon EZH2 depletion. The combination of global microRNA (miR) profiling in primary NPC specimens, and in silico analyses provided several candidate miRs that could regulate EZH2. Using a luciferase-based assay, miR-26a, miR-101, and miR-98 were validated as bona fide regulators of EZH2 expression. In particular, miR-98 was underexpressed in relapsed patient samples, strongly suggesting an important role for the miR-98 and EZH2 axis in NPC biology.

- Annals of surgical oncology, 2012

BACKGROUND: The mechanisms of IPMN carcinogenesis are as yet unclear. This study aimed to determine whether expression of EZH2 promotes neoplastic progression of IPMN and PDCA, and to elucidate regulation of EZH2 expression by miR-101. METHODS: EZH2 mRNA and protein expression were investigated in 8 human pancreatic cancer cell lines by PCR and western blotting. Pre-miR-101 and anti-miR-101 were transfected into pancreatic cancer cells to elucidate EZH2 regulation by miR-101. To evaluate whether EZH2 modulates malignant progression of IPMN, EZH2 expression in IPMN was examined by immunohistochemistry. Next, we collected malignant and benign cells from FFPE samples of IPMNs using laser capture microdissection and extracted the RNA. miR-101 expression in IPMN was assessed using real-time PCR. RESULTS: All pancreatic cancer cell lines expressed EZH2 mRNA and protein. The induction of miR-101 by transfection of pre-miR-101 in MIA PaCa-2 was closely related to a reduction in EZH2 protein production compared with control, whereas there was little difference in the expression of EZH2 mRNA. Anti-miR-101 transfected pancreatic cancer cells showed an increase in EZH2 protein, while the level of EZH2 mRNA was not elevated. Immunohistochemistry revealed that the expression of EZH2 was significantly higher in malignant than benign IPMN. Expression of miR-101 was significantly lower in malignant IPMN than benign IPMN. CONCLUSIONS: MiR-101 targets EZH2 at the posttranscriptional level, and loss of miR-101 could be a trigger for the adenomacarcinoma sequence of IPMN by upregulation of EZH2. This study suggests miR-101-EZH2 blockade as a potential therapeutic target in IPMN carcinogenesis.

- The Journal of pathology, 2012

E-cadherin expression disruption is commonly observed in metastatic epithelial cancers and is a crucial step in gastric cancer (GC) initiation and progression. As aberrant expression of microRNAs often perturb the normal expression/function of pivotal cancer-related genes, we characterized and dissected a pathway that causes E-cadherin dysfunction via loss of microRNA-101 and up-regulation of EZH2 expression in GC. MicroRNA microarray expression profiling and array-CGH were used to reinforce miR-101 involvement in GC. By using quantitative real-time PCR and quantitative SNaPshot genomic PCR, we confirmed that miR-101 was significantly down-regulated in GC (p < 0.0089) in comparison with normal gastric mucosas and, at least in 65% of the GC cases analysed, this down-regulation was caused by deletions and/or microdeletions at miR-101 genomic loci. Moreover, around 40% of cases showing miR-101 down-regulation displayed concomitant EZH2 over-expression (at the RNA and protein levels), which, in turn, was associated with loss/aberrant expression of E-cadherin. Interestingly, this occurred preferentially in intestinal-type GCs, retaining allele(s) untargeted by classical CDH1-inactivating mechanisms. We also demonstrated that miR-101 gain of function or direct inhibition of EZH2 in Kato III GC cells led to a strong depletion of endogenous EZH2 and consequent rescue of E-cadherin membranous localization, mimicking results obtained in clinical GC samples. In conclusion, we show that deletions and/or microdeletions at both miR-101 genomic loci cause mature miR-101 down-regulation, subsequent EZH2 over-expression and E-cadherin dysfunction, specifically in intestinal-type GC.

- BMC genomics, 2013

BACKGROUND: Cellular senescence can be induced by a variety of extrinsic stimuli, and sustained exposure to sunlight is a key factor in photoaging of the skin. Accordingly, irradiation of skin fibroblasts by UVB light triggers cellular senescence, which is thought to contribute to extrinsic skin aging, although molecular mechanisms are incompletely understood. Here, we addressed molecular mechanisms underlying UVB induced senescence of human diploid fibroblasts. RESULTS: We observed a parallel activation of the p53/p21(WAF1) and p16(INK4a)/pRb pathways. Using genome-wide transcriptome analysis, we identified a transcriptional signature of UVB-induced senescence that was conserved in three independent strains of human diploid fibroblasts (HDF) from skin. In parallel, a comprehensive screen for microRNAs regulated during UVB-induced senescence was performed which identified five microRNAs that are significantly regulated during the process. Bioinformatic analysis of miRNA-mRNA networks was performed to identify new functional mRNA targets with high confidence for miR-15a, miR-20a, miR-20b, miR-93, and miR-101. Already known targets of these miRNAs were identified in each case, validating the approach. Several new targets were identified for all of these miRNAs, with the potential to provide new insight in the process of UVB-induced senescence at a genome-wide level. Subsequent analysis was focused on miR-101 and its putative target gene Ezh2. We confirmed that Ezh2 is regulated by miR-101 in human fibroblasts, and found that both overexpression of miR-101 and downregulation of Ezh2 independently induce senescence in the absence of UVB irradiation. However, the downregulation of miR-101 was not sufficient to block the phenotype of UVB-induced senescence, suggesting that other UVB-induced processes induce the senescence response in a pathway redundant with upregulation of miR-101. CONCLUSION: We performed a comprehensive screen for UVB-regulated microRNAs in human diploid fibroblasts, and identified a network of miRNA-mRNA interactions mediating UVB-induced senescence. In addition, miR-101 and Ezh2 were identified as key players in UVB-induced senescence of HDF.

- Cancer letters, 2013

The microRNA miR-101 has been reported to be a tumor suppressor. Here we show that low expression of miR-101 is associated with poor survival in stage IV melanoma patients. We identified microphthalmia-associated transcription factor (MITF) as a direct target of miR-101. In melanoma cells, overexpression of miR-101 downregulated protein levels of MITF and a previously reported target protein, enhancer of zeste homolog 2 (EZH2). Functional assays showed that miR-101 suppressed invasion and proliferation - an outcome that could be phenocopied by siRNA knockdown of MITF and EZH2. Our data suggest that miR-101 might have a beneficial role in melanoma.

- Methods (San Diego, Calif.), 2014

Associations between proteins and RNA-RNA duplexes are important in post-transcriptional regulation of gene expression. The CLASH (Cross-linking, Ligation and Sequencing of Hybrids) technique captures RNA-RNA interactions by physically joining two RNA molecules associated with a protein complex into a single chimeric RNA molecule. These events are relatively rare and considerable effort is needed to detect a small number of chimeric sequences amongst millions of non-chimeric cDNA reads resulting from a CLASH experiment. We present the "hyb" bioinformatics pipeline, which we developed to analyse high-throughput cDNA sequencing data from CLASH experiments. Although primarily designed for use with AGO CLASH data, hyb can also be used for the detection and annotation of chimeric reads in other high-throughput sequencing datasets. We examined the sensitivity and specificity of chimera detection in a test dataset using the BLAST, BLAST+, BLAT, pBLAT and Bowtie2 read alignment programs. We obtained the most reliable results in the shortest time using a combination of preprocessing with Flexbar and subsequent read-mapping using Bowtie2. The "hyb" software is distributed under the GNU GPL (General Public License) and can be downloaded from https://github.com/gkudla/hyb.

- Arteriosclerosis, thrombosis, and vascular biology, 2015

OBJECTIVE: Gestational diabetes mellitus (GDM) produces fetal hyperglycemia with increased lifelong risks for the exposed offspring of cardiovascular and other diseases. Epigenetic mechanisms induce long-term gene expression changes in response to in utero environmental perturbations. Moreover, microRNAs (miRs) control the function of endothelial cells (ECs) under physiological and pathological conditions and can target the epigenetic machinery. We investigated the functional and expressional effect of GDM on human fetal ECs of the umbilical cord vein (HUVECs). We focused on miR-101 and 1 of its targets, enhancer of zester homolog-2 (EZH2), which trimethylates the lysine 27 of histone 3, thus repressing gene transcription. EZH2 exists as isoforms alpha and beta. APPROACH AND RESULTS: HUVECs were prepared from GDM or healthy pregnancies and tested in apoptosis, migration, and Matrigel assays. GDM-HUVECs demonstrated decreased functional capacities, increased miR-101 expression, and reduced EZH2- beta and trimethylation of histone H3 on lysine 27 levels. MiR-101 inhibition increased EZH2 expression and improved GDM-HUVEC function. Healthy HUVECs were exposed to high or normal d-glucose concentration for 48 hours and then tested for miR-101 and EZH2 expression. Similar to GDM, high glucose increased miR-101 expression. Chromatin immunoprecipitation using an antibody for EZH2 followed by polymerase chain reaction analyses for miR-101 gene promoter regions showed that both GDM and high glucose concentration reduced EZH2 binding to the miR-101 locus in HUVECs. Moreover, EZH2-beta overexpression inhibited miR-101 promoter activity in HUVECs. CONCLUSIONS: GDM impairs HUVEC function via miR-101 upregulation. EZH2 is both a transcriptional inhibitor and a target gene of miR-101 in HUVECs, and it contributes to some of the miR-101-induced defects of GDM-HUVECs.

- Oncology reports, 2016

Although the tumor suppressive role of miR-101 is well documented in hepatocellular carcinoma (HCC), how the expression of miR-101 itself is regulated remains elusive. In the present study, we demonstrated that the miR-101 precursor pre-miR-101-1 could be regulated by an important epigenetic regulator, the enhancer of zeste homolog 2 (EZH2). Reporter gene assays revealed that ectopic expression of EZH2 inhibited the transcriptional activities of miR-101-1 promoter. Subsequent analyses revealed that miR-101-1 directly represses the expression of EZH2, and miR-101-1 and EZH2 form a reciprocal negative feedback loop as indicated by the fact that ectopic mature miR-101 could induce endogenous pre-miR-101-1 expression. This mature miR-101-induced pre-miR-101 expression was specific to pre-miR-101-1 and depended on EZH2 activities. Moreover, our results also demonstrated that similar antitumor effects can be achieved either by ectopic miR-101 or EZH2 silencing in HCC cells. These findings show that elevated EZH2 contributes to miR-101 deregulation in HCC and highlight the coordinated role of miR-101 and EZH2 in hepatocarcinogenesis.

- Journal of experimental & clinical cancer research : CR, 2016

BACKGROUND: Long non-coding RNAs (lncRNAs) have emerged as critical regulators of tumor progression. However, the role and molecular mechanism of lncRNA XIST in gastric cancer is still unknown. METHODS: Real-time PCR analysis was performed to measure the expression levels of lncRNA XIST in gastric cancer tissues and cell lines, the correlation between lncRNA XIST expression and clinicopathological characteristics and prognosis was analyzed in gastric cancer patients. The biological function of lncRNA XIST on gastric cancer cells were determined both in vitro and in vivo. The regulating relationship between lncRNA XIST and miR-101 was investigated in gastric cancer cells. RESULTS: lncRNA XIST was significantly up-regulated in gastric cancer tissues and cell lines. Overexpression of lncRNA XIST was markedly associated with larger tumor size, lymph node invasion, distant metastasis and TNM stage in gastric cancer patients. Functionally, knockdown of lncRNA XIST exerted tumor-suppressive effects by inhibiting cell proliferation, migration and invasion in vitro and tumor growth and metastasis in vivo. Furthermore, an inverse relationship between lncRNA XIST and miR-101 was found. Polycomb group protein enhancer of zeste homolog 2 (EZH2), a direct target of miR-101, could mediated the biological effects that lncRNA XIST exerted. CONCLUSIONS: lncRNA XIST is up-regulated and is associated with aggressive tumor phenotypes and patient survival in gastric cancer, and the newly identified lncRNA XIST/miR-101/EZH2 axis could be a potential biomarkers or therapeutic targets for gastric cancer patients.

- Journal of cellular biochemistry, 2016

The aim of this study was to investigate the effects of miR-101-3p on the viability, migration, invasion, and mitosis of lung squamous carcinoma cells by inhibiting EZH2. In this study, RT-qPCR was used to detect the expression of miR-101-3p and EZH2 in both tissues and cells at RNA level. The dual luciferase reporter gene system was used to determine whether there was targeting relationship between miR-101-3p and EZH2-3'UTR. Western Blot was used to detect the expression of EZH2 as well as the proliferation and invasion related proteins. The CCK-8 assay, Transwell invasion assay, wound healing assay and flow cytometry were conducted to test the cell viability, invasion, migration and apoptosis. The results of RT-qPCR and Western blot showed that miR-101-3p was low-expressed and EZH2 was overexpressed in lung squamous cell carcinoma tissues and cells. Meanwhile the Western blot confirmed the effects of EZH2 expression on the proliferation and invasion of carcinoma cells. The results of luciferase assay and RT-qPCR showed that miR-101-3p had a negative regulation effect on EZH2. The CCK-8 assay, Transwell invasion assay, wound healing assay and flow cytometry results showed that the inhibition of EZH2 or the up-regulation of miR-101-3p inhibited the viability, migration, invasion and cell cycle but promoted cell apoptosis of lung squamous cell carcinoma. MiR-101-3p could inhibit the viability, migration, invasion, and cell cycle of lung squamous carcinoma cells by inhibiting the EZH2. J. Cell. Biochem. 9999: 1-8, 2017. (c) 2017 Wiley Periodicals, Inc.