pre-miRNA Information
pre-miRNA hsa-mir-1-1   
Genomic Coordinates chr20: 62554306 - 62554376
Synonyms MIRN1-1, hsa-mir-1-1, miRNA1-1, MIR1-1
Description Homo sapiens miR-1-1 stem-loop
Comment Lagos-Quintana et al. .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-1-2   
Genomic Coordinates chr18: 21829004 - 21829088
Synonyms MIRN1-2, hsa-mir-1-2, miRNA1-2, MIR1-2
Description Homo sapiens miR-1-2 stem-loop
Comment Lagos-Quintana et al. .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1-3p
Sequence 53| UGGAAUGUAAAGAAGUAUGUAU |74
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 20 + 62554354 29233923 MiREDiBase
A-to-I 5 20 + 62554355 29233923 MiREDiBase
A-to-I 9 20 + 62554359 29233923 MiREDiBase
A-to-I 11 20 + 62554361 29233923 MiREDiBase
A-to-I 14 20 + 62554364 29233923 MiREDiBase
A-to-I 17 20 + 62554367 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1273198863 2 dbSNP
rs1395109253 3 dbSNP
rs776480338 14 dbSNP
rs1399433486 15 dbSNP
rs528661852 16 dbSNP
rs772171181 16 dbSNP
rs1433539698 18 dbSNP
rs377171105 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B9HSE2 miR-1 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma .
B9HSE2 miR-1 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Real-time reverse transcription PCR
Gene Information
Gene Symbol CDK9   
Synonyms C-2k, CDC2L4, CTK1, PITALRE, TAK
Description cyclin dependent kinase 9
Transcript NM_001261   
Expression
Putative miRNA Targets on CDK9
3'UTR of CDK9
(miRNA target sites are highlighted)
>CDK9|NM_001261|3'UTR
   1 GGGCCGGCGCTTGCCACTAGGGCTCTTGTGTTTTTTTTCTTCTGCTATGTGACTTGCATCGTGGAGACAGGGCATTTGAG
  81 TTTATATCTCTCATGCATATTTTATTTAATCCCCACCCTGGGCTCTGGGAGCAGCCCGCTGAGTGGACTGGAGTGGAGCA
 161 TTGGCTGAGAGACCAGGAGGGCACTGGAGCTGTCTTGTCCTTGCTGGTTTTCTGGATGGTTCCCAGAGGGTTTCCATGGG
 241 GTAGGAGGATGGGCTCGCCCACCAGTGACTTTTTCTAAGAGCTCCCGGCGTGGTGGAAGAGGGGACAGGTCCCTCACCCA
 321 CCCACAATCCTATTCTCGGGCTGAGAACCCTGCGTGGGGACAGGGCTCGCCTCAGGAATGGGCTGTTTTTGGCCTAACCC
 401 TCAGAAACACTGGGGCTGGCACAAACTCTTGGTTTCTTCAACAGGAGAATTTTACTGTGTTTCTTTTGGTTCCATTGTTT
 481 GGAGACATTCCTGGGCACAGTTTGGTCCGTTAGAATTAAAAGTTGAATTTTTTTTTTTTTTAAATTTTTTTTTTTCCTCC
 561 AGGACTTGTGTGTTTTGTTCTGCGCACACACCGCCAACTGTTCCCCCACAGTCAGCAGCAGGTTGGGCCTGACCATTGGG
 641 ACTTGATTGTCAAGTCACTGGAGGTCTTGACTTTTTTATCTCAGTTCATGTTCTCTTCCATAATTGGAAAGGACCTTTGT
 721 CTGTTTTTCCTCTTGGGTGCCTTCCAGAACGCATCTCATGTCCCTGGTGAGGGAATTGGTGAGGGCCTGCTGTGAGCTGC
 801 TGTGGCTGCGATGGTCACCCAGCTGGGCAAATCACTGGAGTGACAATTTGACCTGTCACCTGAGAAGGATGGTCCCTCAG
 881 ACTGCTGGGTAGAGGGCCTGGGGCAGGCTGGAGAGAGAAAGTGGGCAGAGGGTGAAGGGATCACAGGGGTCTTGGAAGGT
 961 GGCAGTAGTTTGGACGGGGGTGGGGAGTATGTGGGAGAAAAAAACAGACTGAAGGTAGAATCCTTGGGAACCTTTGAGGA
1041 GCGGCACATTCTGGCAGGCACGTTTTCTGTGAGCCTGAAGTTAGGAAGAGACATTCTGGAGGTCAATTTCCTACATCCTC
1121 TTACAGGCGGAGACCTTGAAGTGGGGCCAGGAAGGAAGGTTGGCAAAACCTTTGACCAGAACTGTCCTTCATTTACAGAA
1201 ACTGACCCAGACCACAACACAAAAGGCCAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uauguaugAAGAAA----UGUAAGGu 5'
                  || |||    ||||||| 
Target 5' tggttccaTTGTTTGGAGACATTCCt 3'
467 - 492 148.00 -11.10
2
miRNA  3' uauguAUGAAGAA---AUGUAAGGu 5'
               | | ||||   |:| |||| 
Target 5' tgtttTTCCTCTTGGGTGCCTTCCa 3'
722 - 746 109.00 -7.20
3
miRNA  3' uauGUAUGAAGAAAUGUAAGGU 5'
             || |:|||  ||||| |: 
Target 5' ggtCA-ATTTC-CTACATCCTC 3'
1101 - 1120 109.00 -6.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30189465 3 COSMIC
COSN30531780 5 COSMIC
COSN14372802 7 COSMIC
COSN14372804 10 COSMIC
COSN31498472 21 COSMIC
COSN26970168 39 COSMIC
COSN31485195 79 COSMIC
COSN31606041 158 COSMIC
COSN21771941 206 COSMIC
COSN25852318 252 COSMIC
COSN19656118 358 COSMIC
COSN6380454 370 COSMIC
COSN31546114 445 COSMIC
COSN26538047 460 COSMIC
COSN26599459 482 COSMIC
COSN26564738 506 COSMIC
COSN30540271 542 COSMIC
COSN31601258 542 COSMIC
COSN20364370 543 COSMIC
COSN23666447 545 COSMIC
COSN30541784 546 COSMIC
COSN23676949 734 COSMIC
COSN29933840 767 COSMIC
COSN25311110 844 COSMIC
COSN28941341 998 COSMIC
COSN19068839 1180 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1019575132 2 dbSNP
rs1262911960 4 dbSNP
rs1330402946 5 dbSNP
rs563333929 6 dbSNP
rs1241353159 7 dbSNP
rs201025809 8 dbSNP
rs766340319 9 dbSNP
rs377000414 10 dbSNP
rs1417598123 15 dbSNP
rs376812602 16 dbSNP
rs778878328 18 dbSNP
rs752742844 19 dbSNP
rs1174183299 20 dbSNP
rs1407576537 22 dbSNP
rs1452764944 23 dbSNP
rs758446860 25 dbSNP
rs1456104275 26 dbSNP
rs777977604 26 dbSNP
rs747301138 28 dbSNP
rs1362749022 29 dbSNP
rs1425207616 31 dbSNP
rs749282983 31 dbSNP
rs775747149 31 dbSNP
rs1309591690 33 dbSNP
rs771132092 36 dbSNP
rs1330332418 38 dbSNP
rs1223360546 39 dbSNP
rs781588545 40 dbSNP
rs746216061 42 dbSNP
rs770239486 43 dbSNP
rs776011945 48 dbSNP
rs756038382 54 dbSNP
rs1386854237 57 dbSNP
rs1323739527 59 dbSNP
rs868306816 61 dbSNP
rs1452179756 62 dbSNP
rs1337733475 66 dbSNP
rs1399385428 69 dbSNP
rs548699255 70 dbSNP
rs543012142 77 dbSNP
rs1322938102 87 dbSNP
rs998083499 88 dbSNP
rs1046387553 89 dbSNP
rs907777862 90 dbSNP
rs568509308 91 dbSNP
rs1162609888 92 dbSNP
rs1037351998 93 dbSNP
rs898928426 94 dbSNP
rs995853083 95 dbSNP
rs1464410591 98 dbSNP
rs1267889140 113 dbSNP
rs1210521886 114 dbSNP
rs1242252193 117 dbSNP
rs951157657 118 dbSNP
rs530938305 119 dbSNP
rs780133261 134 dbSNP
rs550907477 135 dbSNP
rs1343115851 136 dbSNP
rs1211744706 138 dbSNP
rs569874524 140 dbSNP
rs1324720575 141 dbSNP
rs1389021496 149 dbSNP
rs962463813 156 dbSNP
rs973542359 159 dbSNP
rs867201497 163 dbSNP
rs1391586426 167 dbSNP
rs1195101979 174 dbSNP
rs3217750 176 dbSNP
rs982804889 178 dbSNP
rs1474924982 181 dbSNP
rs1032317267 182 dbSNP
rs1200990467 185 dbSNP
rs755131596 187 dbSNP
rs927983811 191 dbSNP
rs1474431358 192 dbSNP
rs1164444292 197 dbSNP
rs958373618 199 dbSNP
rs1276957482 200 dbSNP
rs1367568255 201 dbSNP
rs1203472626 204 dbSNP
rs1339203436 204 dbSNP
rs527601379 210 dbSNP
rs34234402 214 dbSNP
rs1164617710 223 dbSNP
rs1236132263 223 dbSNP
rs1056472 227 dbSNP
rs990865004 229 dbSNP
rs1052454627 232 dbSNP
rs1298739075 236 dbSNP
rs1372034950 238 dbSNP
rs1305854805 257 dbSNP
rs970583935 258 dbSNP
rs1174089921 265 dbSNP
rs893864443 268 dbSNP
rs1428469410 270 dbSNP
rs558508103 270 dbSNP
rs946820925 273 dbSNP
rs981929293 275 dbSNP
rs1056473 276 dbSNP
rs1039495073 281 dbSNP
rs1437439433 286 dbSNP
rs907806905 287 dbSNP
rs1340812809 288 dbSNP
rs899707056 290 dbSNP
rs375572085 291 dbSNP
rs1353158322 294 dbSNP
rs3197084 300 dbSNP
rs1288794253 313 dbSNP
rs111384955 314 dbSNP
rs1351867961 319 dbSNP
rs1285869824 326 dbSNP
rs547262511 331 dbSNP
rs879137250 333 dbSNP
rs995595809 338 dbSNP
rs973491120 339 dbSNP
rs1199663203 354 dbSNP
rs557627689 355 dbSNP
rs8083 358 dbSNP
rs867070276 359 dbSNP
rs1175506780 361 dbSNP
rs1189272231 362 dbSNP
rs1238198570 366 dbSNP
rs556880977 367 dbSNP
rs577501513 369 dbSNP
rs962433964 370 dbSNP
rs1362410668 383 dbSNP
rs775005875 384 dbSNP
rs1331816493 389 dbSNP
rs1281556055 390 dbSNP
rs373870194 400 dbSNP
rs944236827 401 dbSNP
rs1356622195 402 dbSNP
rs1285533552 403 dbSNP
rs991264291 408 dbSNP
rs376907710 410 dbSNP
rs749260845 411 dbSNP
rs1445340109 414 dbSNP
rs1381852709 420 dbSNP
rs1023800530 427 dbSNP
rs1041197079 429 dbSNP
rs1437216790 429 dbSNP
rs1302168835 430 dbSNP
rs1157018245 432 dbSNP
rs969582888 437 dbSNP
rs113604114 442 dbSNP
rs1442970371 443 dbSNP
rs748811107 443 dbSNP
rs1385054222 444 dbSNP
rs117478783 448 dbSNP
rs1376356734 450 dbSNP
rs1032761226 456 dbSNP
rs368336604 458 dbSNP
rs1451735735 459 dbSNP
rs1291399096 460 dbSNP
rs988570910 466 dbSNP
rs1243368460 469 dbSNP
rs1358258594 486 dbSNP
rs1298102163 488 dbSNP
rs915218411 491 dbSNP
rs1288272458 492 dbSNP
rs1437100058 496 dbSNP
rs573466515 498 dbSNP
rs946814174 500 dbSNP
rs1325579970 501 dbSNP
rs1423004120 502 dbSNP
rs1384804780 503 dbSNP
rs1381183893 506 dbSNP
rs1039727914 509 dbSNP
rs921096866 510 dbSNP
rs1186516375 512 dbSNP
rs1478625759 524 dbSNP
rs1310498954 526 dbSNP
rs1248001906 527 dbSNP
rs549625098 528 dbSNP
rs796908444 528 dbSNP
rs1491188488 541 dbSNP
rs1491277799 542 dbSNP
rs201996083 542 dbSNP
rs577024997 542 dbSNP
rs10739697 543 dbSNP
rs981960233 544 dbSNP
rs1365203946 545 dbSNP
rs1431857394 545 dbSNP
rs866486004 545 dbSNP
rs1014731749 546 dbSNP
rs1197080020 547 dbSNP
rs933856049 549 dbSNP
rs1050937826 553 dbSNP
rs1183946984 556 dbSNP
rs973304436 556 dbSNP
rs1178831831 557 dbSNP
rs1381677873 558 dbSNP
rs1430934434 559 dbSNP
rs1175356387 560 dbSNP
rs1210515490 561 dbSNP
rs1378062950 568 dbSNP
rs887051323 569 dbSNP
rs1313890301 570 dbSNP
rs1467401718 573 dbSNP
rs1222813283 578 dbSNP
rs1345038171 580 dbSNP
rs1328980282 581 dbSNP
rs1004111784 582 dbSNP
rs753128002 584 dbSNP
rs898130287 585 dbSNP
rs774202865 590 dbSNP
rs1022760647 592 dbSNP
rs372276530 593 dbSNP
rs1004148674 594 dbSNP
rs1174987105 598 dbSNP
rs1218654515 601 dbSNP
rs1406017476 605 dbSNP
rs1412127412 609 dbSNP
rs1035176534 610 dbSNP
rs761671180 620 dbSNP
rs957195071 634 dbSNP
rs1302604792 635 dbSNP
rs1416968942 636 dbSNP
rs1249305894 641 dbSNP
rs375388761 646 dbSNP
rs1241038161 659 dbSNP
rs773966617 659 dbSNP
rs985744858 662 dbSNP
rs1329753589 664 dbSNP
rs1268874143 666 dbSNP
rs1217220110 672 dbSNP
rs1315365064 672 dbSNP
rs1306631772 676 dbSNP
rs1396821457 679 dbSNP
rs1385487087 680 dbSNP
rs543310966 688 dbSNP
rs1335112849 689 dbSNP
rs911663370 690 dbSNP
rs1389964500 691 dbSNP
rs1257865296 696 dbSNP
rs915249471 703 dbSNP
rs550716049 705 dbSNP
rs1165128646 715 dbSNP
rs967980873 716 dbSNP
rs1425156311 717 dbSNP
rs902642377 718 dbSNP
rs935496645 722 dbSNP
rs975380087 723 dbSNP
rs549941007 727 dbSNP
rs1012277880 730 dbSNP
rs1045064009 731 dbSNP
rs1260186676 732 dbSNP
rs934074669 734 dbSNP
rs564493865 737 dbSNP
rs1245612141 738 dbSNP
rs908344865 741 dbSNP
rs1015173569 749 dbSNP
rs532334862 751 dbSNP
rs939942848 752 dbSNP
rs1038255974 753 dbSNP
rs1381023625 756 dbSNP
rs1425807164 759 dbSNP
rs1293583115 761 dbSNP
rs905974512 765 dbSNP
rs186886518 768 dbSNP
rs79715566 779 dbSNP
rs1162702012 787 dbSNP
rs565594788 788 dbSNP
rs898414584 793 dbSNP
rs1012622849 797 dbSNP
rs1190983473 809 dbSNP
rs534510748 810 dbSNP
rs906970842 811 dbSNP
rs1210464335 816 dbSNP
rs758750495 823 dbSNP
rs1490902435 829 dbSNP
rs145381917 831 dbSNP
rs772904990 838 dbSNP
rs985775748 841 dbSNP
rs1435877179 852 dbSNP
rs956860389 853 dbSNP
rs1009776295 854 dbSNP
rs1294150233 856 dbSNP
rs911527512 859 dbSNP
rs1429962613 876 dbSNP
rs1369781548 889 dbSNP
rs1022539854 893 dbSNP
rs968262039 894 dbSNP
rs1398747686 908 dbSNP
rs1461444748 911 dbSNP
rs1278107529 919 dbSNP
rs965771816 920 dbSNP
rs1319117149 929 dbSNP
rs567829669 930 dbSNP
rs975411083 933 dbSNP
rs372696713 935 dbSNP
rs955658444 945 dbSNP
rs986871628 946 dbSNP
rs1275578984 947 dbSNP
rs908375644 948 dbSNP
rs915516094 949 dbSNP
rs760603154 950 dbSNP
rs1282065052 955 dbSNP
rs1410077058 957 dbSNP
rs1337117860 960 dbSNP
rs973895176 962 dbSNP
rs1390543229 964 dbSNP
rs919870909 976 dbSNP
rs556710309 977 dbSNP
rs1044102904 981 dbSNP
rs906838943 989 dbSNP
rs545948727 990 dbSNP
rs766235537 991 dbSNP
rs897888538 994 dbSNP
rs1244093547 998 dbSNP
rs1321970486 998 dbSNP
rs541022601 998 dbSNP
rs1027418890 999 dbSNP
rs953305609 1022 dbSNP
rs539785975 1025 dbSNP
rs1405032262 1031 dbSNP
rs891534616 1033 dbSNP
rs750121899 1039 dbSNP
rs1018816778 1043 dbSNP
rs1351745251 1044 dbSNP
rs1450390501 1049 dbSNP
rs965774313 1062 dbSNP
rs977479042 1063 dbSNP
rs569774313 1067 dbSNP
rs1022404297 1072 dbSNP
rs1469796438 1076 dbSNP
rs924409283 1079 dbSNP
rs1185768987 1086 dbSNP
rs904133962 1093 dbSNP
rs3217751 1094 dbSNP
rs1028751630 1107 dbSNP
rs1282744711 1108 dbSNP
rs948287120 1111 dbSNP
rs3217752 1112 dbSNP
rs987204304 1115 dbSNP
rs371097580 1118 dbSNP
rs1316938070 1121 dbSNP
rs939393435 1121 dbSNP
rs1243414579 1123 dbSNP
rs961441569 1125 dbSNP
rs368872709 1129 dbSNP
rs542466634 1130 dbSNP
rs1316251885 1132 dbSNP
rs1285250452 1136 dbSNP
rs1400375312 1142 dbSNP
rs1366351749 1147 dbSNP
rs1488553460 1155 dbSNP
rs761676087 1165 dbSNP
rs1165874653 1171 dbSNP
rs1443228720 1176 dbSNP
rs1195202972 1180 dbSNP
rs562230474 1183 dbSNP
rs919734956 1187 dbSNP
rs1239886354 1188 dbSNP
rs1214413608 1196 dbSNP
rs1490412831 1198 dbSNP
rs559040124 1208 dbSNP
rs78857012 1209 dbSNP
rs10987728 1219 dbSNP
rs1007342348 1233 dbSNP
rs1273417208 1239 dbSNP
rs1387242881 1240 dbSNP
rs1018847538 1241 dbSNP
rs1216277306 1241 dbSNP
rs1437918270 1241 dbSNP
rs1399413931 1244 dbSNP
rs1491096240 1249 dbSNP
rs928291383 1249 dbSNP
rs1412165402 1250 dbSNP
rs1417911922 1250 dbSNP
rs564361553 1250 dbSNP
rs771102394 1250 dbSNP
rs957150221 1250 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Callis TE; Chen JF; Wang DZ
- DNA and cell biology, 2007
MicroRNAs (miRNAs) are a recently discovered class of small non-coding RNAs, which are approximately 22 nucleotides in length. miRNAs negatively regulate gene expression by translational repression and target mRNA degradation. It has become clear that miRNAs are involved in many biological processes, including development, differentiation, proliferation, and apoptosis. Interestingly, many miRNAs are expressed in a tissue-specific manner and several miRNAs are specifically expressed in cardiac and skeletal muscles. In this review, we focus on those miRNAs that have been shown to be involved in muscle development. Compelling evidences have demonstrated that muscle miRNAs play an important role in the regulation of muscle proliferation and differentiation processes. However, it appears that miRNAs are not essential for early myogenesis and muscle specification. Importantly, dysregulation of miRNAs has been linked to muscle-related diseases, such as cardiac hypertrophy. A mutation resulting in a gain-of-function miRNA target site in the myostatin gene leads to down regulation of the targeted protein in Texel sheep. miRNAs therefore are a new class of regulators of muscle biology and they might become novel therapeutic targets in muscle-related human diseases.
LinkOut: [PMID: 17465888]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Selbach M; Schwanhausser B; Thierfelder N; et al.
- Nature, 2008
Animal microRNAs (miRNAs) regulate gene expression by inhibiting translation and/or by inducing degradation of target messenger RNAs. It is unknown how much translational control is exerted by miRNAs on a genome-wide scale. We used a new proteomic approach to measure changes in synthesis of several thousand proteins in response to miRNA transfection or endogenous miRNA knockdown. In parallel, we quantified mRNA levels using microarrays. Here we show that a single miRNA can repress the production of hundreds of proteins, but that this repression is typically relatively mild. A number of known features of the miRNA-binding site such as the seed sequence also govern repression of human protein synthesis, and we report additional target sequence characteristics. We demonstrate that, in addition to downregulating mRNA levels, miRNAs also directly repress translation of hundreds of genes. Finally, our data suggest that a miRNA can, by direct or indirect effects, tune protein synthesis from thousands of genes.
LinkOut: [PMID: 18668040]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.47 0 -0.451 0 50 Click to see details
KICH 0.5 0.01 0.475 0.01 25 Click to see details
BRCA -0.279 0.01 -0.163 0.07 82 Click to see details
CESC 0.991 0.04 1.000 0.5 3 Click to see details
STAD 0.268 0.07 0.228 0.1 32 Click to see details
HNSC -0.2 0.1 -0.224 0.08 42 Click to see details
LUAD -0.367 0.12 -0.392 0.1 12 Click to see details
PCPG -0.913 0.13 -0.500 0.33 3 Click to see details
ESCA -0.357 0.14 -0.300 0.19 11 Click to see details
KIRC 0.125 0.15 0.093 0.23 68 Click to see details
KIRP 0.183 0.16 0.234 0.1 31 Click to see details
LUSC 0.168 0.16 0.287 0.04 36 Click to see details
UCEC -0.211 0.19 -0.163 0.25 19 Click to see details
PAAD 0.572 0.21 0.400 0.3 4 Click to see details
COAD -0.336 0.29 0.200 0.37 5 Click to see details
LIHC -0.065 0.33 -0.081 0.29 48 Click to see details
CHOL -0.125 0.37 0.100 0.4 9 Click to see details
THCA -0.04 0.38 -0.023 0.43 59 Click to see details
BLCA -0.059 0.41 -0.053 0.42 18 Click to see details
BLCA -0.059 0.41 -0.053 0.42 18 Click to see details
BLCA -0.059 0.41 -0.053 0.42 18 Click to see details
923 hsa-miR-1-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000384 CHRNA4 cholinergic receptor nicotinic alpha 4 subunit 1 1
MIRT000385 MYEF2 myelin expression factor 2 3 3
MIRT000386 RHEB Ras homolog, mTORC1 binding 1 1
MIRT000387 RASA1 RAS p21 protein activator 1 1 1
MIRT000389 CDK9 cyclin dependent kinase 9 1 2
MIRT000390 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT000391 MEF2A myocyte enhancer factor 2A 3 4
MIRT000392 BCL2 BCL2, apoptosis regulator 1 2
MIRT000393 GATA4 GATA binding protein 4 2 2
MIRT000933 HCN4 hyperpolarization activated cyclic nucleotide gated potassium channel 4 5 2
MIRT001053 HDAC4 histone deacetylase 4 4 5
MIRT001054 FOXP1 forkhead box P1 4 2
MIRT001205 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 4 2
MIRT001321 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 1
MIRT001322 WDFY1 WD repeat and FYVE domain containing 1 3 2
MIRT001323 UNC93B1 unc-93 homolog B1, TLR signaling regulator 2 1
MIRT001324 UHRF1 ubiquitin like with PHD and ring finger domains 1 2 1
MIRT001325 TPM3 tropomyosin 3 3 2
MIRT001326 TPM2 tropomyosin 2 3 2
MIRT001327 TPM1 tropomyosin 1 3 2
MIRT001328 THBS1 thrombospondin 1 2 1
MIRT001329 SYNE1 spectrin repeat containing nuclear envelope protein 1 2 1
MIRT001330 SSNA1 SS nuclear autoantigen 1 2 1
MIRT001331 SNX6 sorting nexin 6 2 1
MIRT001332 SLC25A22 solute carrier family 25 member 22 2 1
MIRT001333 SLC25A1 solute carrier family 25 member 1 3 2
MIRT001334 SH3BGRL3 SH3 domain binding glutamate rich protein like 3 2 1
MIRT001335 SFXN1 sideroflexin 1 3 2
MIRT001336 SEC23IP SEC23 interacting protein 2 1
MIRT001337 SAC3D1 SAC3 domain containing 1 2 1
MIRT001338 RFT1 RFT1 homolog 2 1
MIRT001339 PWP1 PWP1 homolog, endonuclein 2 1
MIRT001340 PTPRF protein tyrosine phosphatase, receptor type F 2 1
MIRT001341 PTPLB 3-hydroxyacyl-CoA dehydratase 2 2 1
MIRT001342 PTPLAD1 3-hydroxyacyl-CoA dehydratase 3 2 1
MIRT001343 PTMA prothymosin, alpha 8 11
MIRT001344 PTBP2 polypyrimidine tract binding protein 2 2 1
MIRT001345 PTBP1 polypyrimidine tract binding protein 1 2 1
MIRT001346 PRSS21 protease, serine 21 2 1
MIRT001347 PPIB peptidylprolyl isomerase B 2 1
MIRT001348 POLA2 DNA polymerase alpha 2, accessory subunit 2 1
MIRT001350 PICALM phosphatidylinositol binding clathrin assembly protein 3 2
MIRT001351 PDLIM7 PDZ and LIM domain 7 3 2
MIRT001352 NRP1 neuropilin 1 2 1
MIRT001353 NOTCH2 notch 2 3 2
MIRT001354 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 1
MIRT001355 MRC2 mannose receptor C type 2 2 1
MIRT001356 MOV10 Mov10 RISC complex RNA helicase 3 2
MIRT001357 MET MET proto-oncogene, receptor tyrosine kinase 6 7
MIRT001358 LRRC8A leucine rich repeat containing 8 VRAC subunit A 3 3
MIRT001359 LRP1 LDL receptor related protein 1 2 1
MIRT001360 F2 coagulation factor II, thrombin 1 1
MIRT001362 ITGB4 integrin subunit beta 4 2 1
MIRT001363 IQGAP3 IQ motif containing GTPase activating protein 3 2 1
MIRT001364 GPD2 glycerol-3-phosphate dehydrogenase 2 6 2
MIRT001365 GOLGA7 golgin A7 2 1
MIRT001366 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 1
MIRT001367 GAK cyclin G associated kinase 2 1
MIRT001368 EHMT2 euchromatic histone lysine methyltransferase 2 2 1
MIRT001369 EHMT1 euchromatic histone lysine methyltransferase 1 2 1
MIRT001370 EGFR epidermal growth factor receptor 2 1
MIRT001371 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 2 1
MIRT001372 CTSC cathepsin C 2 1
MIRT001373 CSRP1 cysteine and glycine rich protein 1 3 2
MIRT001374 CPOX coproporphyrinogen oxidase 2 1
MIRT001375 CORO1C coronin 1C 5 1
MIRT001376 COIL coilin 2 1
MIRT001377 CDCP1 CUB domain containing protein 1 3 2
MIRT001378 CAND1 cullin associated and neddylation dissociated 1 4 3
MIRT001380 BRI3BP BRI3 binding protein 3 2
MIRT001381 BCKDHB branched chain keto acid dehydrogenase E1 subunit beta 2 1
MIRT001382 ATP6V0A1 ATPase H+ transporting V0 subunit a1 2 1
MIRT001383 ASH2L ASH2 like histone lysine methyltransferase complex subunit 2 1
MIRT001384 ARID2 AT-rich interaction domain 2 2 1
MIRT001385 ARID1A AT-rich interaction domain 1A 2 1
MIRT001386 AP3D1 adaptor related protein complex 3 delta 1 subunit 2 1
MIRT001387 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 1
MIRT001388 ANXA2 annexin A2 5 3
MIRT001389 ANPEP alanyl aminopeptidase, membrane 2 1
MIRT001390 ANP32B acidic nuclear phosphoprotein 32 family member B 4 3
MIRT001391 AGRN agrin 2 1
MIRT001392 AGMAT agmatinase 2 1
MIRT001393 ADPGK ADP dependent glucokinase 2 1
MIRT001394 ABHD11 abhydrolase domain containing 11 2 1
MIRT001843 HAND2 heart and neural crest derivatives expressed 2 3 2
MIRT001844 IGF1 insulin like growth factor 1 6 3
MIRT001845 TMSB4X thymosin beta 4, X-linked 2 1
MIRT001847 SH3PXD2B SH3 and PX domains 2B 1 2
MIRT001983 KCNJ2 potassium voltage-gated channel subfamily J member 2 5 5
MIRT001984 GJA1 gap junction protein alpha 1 4 5
MIRT002733 ZNF264 zinc finger protein 264 2 2
MIRT002735 GCFC2 GC-rich sequence DNA-binding factor 2 2 1
MIRT002736 OAT ornithine aminotransferase 3 2
MIRT002737 CLCN3 chloride voltage-gated channel 3 2 1
MIRT002738 POLR2K RNA polymerase II subunit K 2 1
MIRT002739 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT002740 DHX15 DEAH-box helicase 15 3 2
MIRT002741 LZTFL1 leucine zipper transcription factor like 1 2 1
MIRT002742 ARF3 ADP ribosylation factor 3 2 1
MIRT002743 OSBPL7 oxysterol binding protein like 7 2 1
MIRT002746 HIST1H3B histone cluster 1 H3 family member b 2 1
MIRT002747 SH2D4A SH2 domain containing 4A 2 1
MIRT002748 TRIM2 tripartite motif containing 2 2 1
MIRT002749 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 1 1
MIRT002750 RABL2B RAB, member of RAS oncogene family like 2B 2 1
MIRT002751 XPO6 exportin 6 5 3
MIRT002752 ARCN1 archain 1 3 3
MIRT002753 FBLN2 fibulin 2 2 1
MIRT002754 CERS2 ceramide synthase 2 4 4
MIRT002755 PLEKHB2 pleckstrin homology domain containing B2 2 2
MIRT002756 POM121 POM121 transmembrane nucleoporin 3 2
MIRT002758 AXL AXL receptor tyrosine kinase 3 2
MIRT002759 POGK pogo transposable element derived with KRAB domain 3 1
MIRT002760 BLCAP bladder cancer associated protein 2 2
MIRT002761 MXD4 MAX dimerization protein 4 2 1
MIRT002762 KIAA1598 shootin 1 2 1
MIRT002765 EML4 echinoderm microtubule associated protein like 4 2 1
MIRT002766 PGM2 phosphoglucomutase 2 3 1
MIRT002767 TRAPPC3 trafficking protein particle complex 3 2 1
MIRT002768 CHSY1 chondroitin sulfate synthase 1 2 1
MIRT002769 MGC27345 uncharacterized protein MGC27345 1 1
MIRT002771 HIST1H3I histone cluster 1 H3 family member i 1 1
MIRT002772 GCH1 GTP cyclohydrolase 1 2 1
MIRT002776 SERPINB5 serpin family B member 5 2 2
MIRT002777 SLC25A30 solute carrier family 25 member 30 2 2
MIRT002779 ANKRD29 ankyrin repeat domain 29 2 1
MIRT002780 TDP1 tyrosyl-DNA phosphodiesterase 1 2 1
MIRT002782 TPM4 tropomyosin 4 3 3
MIRT002783 PREX1 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 1 2 1
MIRT002785 PDCD4 programmed cell death 4 2 2
MIRT002787 RNF138 ring finger protein 138 4 4
MIRT002788 TAGLN2 transgelin 2 6 7
MIRT002789 CHST11 carbohydrate sulfotransferase 11 2 1
MIRT002792 RABL2A RAB, member of RAS oncogene family like 2A 2 1
MIRT002793 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT002794 H3F3B H3 histone family member 3B 4 6
MIRT002795 SDC4 syndecan 4 2 2
MIRT002797 RABGAP1L RAB GTPase activating protein 1 like 2 1
MIRT002798 CAP1 cyclase associated actin cytoskeleton regulatory protein 1 3 2
MIRT002799 DDX5 DEAD-box helicase 5 3 2
MIRT002800 SLC16A9 solute carrier family 16 member 9 2 2
MIRT002801 ARHGEF18 Rho/Rac guanine nucleotide exchange factor 18 2 2
MIRT002802 INPP5F inositol polyphosphate-5-phosphatase F 2 2
MIRT002804 TH1L negative elongation factor complex member C/D 3 3
MIRT002805 ANKIB1 ankyrin repeat and IBR domain containing 1 2 2
MIRT002806 SERP1 stress associated endoplasmic reticulum protein 1 7 4
MIRT002807 TIMP3 TIMP metallopeptidase inhibitor 3 2 2
MIRT002808 LASP1 LIM and SH3 protein 1 5 3
MIRT002809 HPS4 HPS4, biogenesis of lysosomal organelles complex 3 subunit 2 2 2
MIRT002811 UST uronyl 2-sulfotransferase 2 2
MIRT002812 RAB11FIP2 RAB11 family interacting protein 2 2 1
MIRT002813 PTMAP7 prothymosin, alpha pseudogene 7 1 1
MIRT002814 MMD monocyte to macrophage differentiation associated 2 2
MIRT002815 NETO2 neuropilin and tolloid like 2 3 2
MIRT002816 GNPDA2 glucosamine-6-phosphate deaminase 2 2 2
MIRT002817 ACPL2 2-phosphoxylose phosphatase 1 2 2
MIRT002819 MTX1 metaxin 1 3 2
MIRT002820 ADAR adenosine deaminase, RNA specific 4 3
MIRT002823 ARF4 ADP ribosylation factor 4 3 2
MIRT002824 UHMK1 U2AF homology motif kinase 1 2 2
MIRT002924 KCNE1 potassium voltage-gated channel subfamily E regulatory subunit 1 4 2
MIRT002955 BDNF brain derived neurotrophic factor 2 1
MIRT002956 G6PD glucose-6-phosphate dehydrogenase 6 5
MIRT003203 SOX6 SRY-box 6 2 1
MIRT003524 ATP6V1B2 ATPase H+ transporting V1 subunit B2 3 3
MIRT003525 LARP4 La ribonucleoprotein domain family member 4 2 1
MIRT003526 CNN3 calponin 3 3 2
MIRT003762 ARHGAP29 Rho GTPase activating protein 29 2 1
MIRT003763 CDK14 cyclin dependent kinase 14 2 1
MIRT003764 MTMR12 myotubularin related protein 12 2 2
MIRT003765 PNP purine nucleoside phosphorylase 5 5
MIRT003766 CCSAP centriole, cilia and spindle associated protein 2 1
MIRT003767 XPNPEP3 X-prolyl aminopeptidase 3 2 1
MIRT003768 FAM57A family with sequence similarity 57 member A 2 2
MIRT003769 TNS4 tensin 4 2 1
MIRT003770 SLC44A1 solute carrier family 44 member 1 2 3
MIRT003771 IFT52 intraflagellar transport 52 2 1
MIRT003772 SRXN1 sulfiredoxin 1 3 2
MIRT003847 RBM47 RNA binding motif protein 47 2 2
MIRT003848 C1orf56 chromosome 1 open reading frame 56 2 1
MIRT003849 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT003850 IP6K2 inositol hexakisphosphate kinase 2 2 2
MIRT003851 CNOT6 CCR4-NOT transcription complex subunit 6 2 1
MIRT003852 KLHDC5 kelch like family member 42 2 2
MIRT003853 KIF2A kinesin family member 2A 4 3
MIRT003976 HSPD1 heat shock protein family D (Hsp60) member 1 2 5
MIRT003977 HSPA4 heat shock protein family A (Hsp70) member 4 2 3
MIRT004322 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 4 3
MIRT004467 CALM3 calmodulin 3 2 2
MIRT004602 PPP2R5A protein phosphatase 2 regulatory subunit B'alpha 3 1
MIRT004670 PAX3 paired box 3 6 2
MIRT004983 TSPAN4 tetraspanin 4 2 1
MIRT005072 SRSF9 serine and arginine rich splicing factor 9 7 4
MIRT005089 TWF1 twinfilin actin binding protein 1 6 3
MIRT005273 ZNF384 zinc finger protein 384 2 1
MIRT005274 SNAPIN SNAP associated protein 2 1
MIRT005275 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 1
MIRT005277 WDR11 WD repeat domain 11 2 1
MIRT005278 MON2 MON2 homolog, regulator of endosome-to-Golgi trafficking 2 1
MIRT005279 TMX1 thioredoxin related transmembrane protein 1 2 1
MIRT005280 RNF213 ring finger protein 213 2 1
MIRT005281 FERMT2 fermitin family member 2 2 1
MIRT005282 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 1
MIRT005283 ARMC10 armadillo repeat containing 10 2 1
MIRT005284 PSMG1 proteasome assembly chaperone 1 2 1
MIRT005285 RRBP1 ribosome binding protein 1 2 1
MIRT005439 IRF2BPL interferon regulatory factor 2 binding protein like 2 1
MIRT005539 TWF2 twinfilin actin binding protein 2 4 1
MIRT005904 CALM2 calmodulin 2 4 4
MIRT005905 GATA6 GATA binding protein 6 1 1
MIRT006132 FN1 fibronectin 1 4 2
MIRT006550 NOTCH3 notch 3 4 3
MIRT006819 SLC8A1 solute carrier family 8 member A1 4 2
MIRT006855 EDN1 endothelin 1 5 6
MIRT007205 PRKCE protein kinase C epsilon 1 1
MIRT007213 FABP3 fatty acid binding protein 3 3 1
MIRT007214 SNAI2 snail family transcriptional repressor 2 3 2
MIRT007222 SOX9 SRY-box 9 1 1
MIRT023484 CDC42BPB CDC42 binding protein kinase beta 1 1
MIRT023485 SRRM1 serine and arginine repetitive matrix 1 1 1
MIRT023486 CD44 CD44 molecule (Indian blood group) 1 1
MIRT023487 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT023488 MECR mitochondrial trans-2-enoyl-CoA reductase 1 1
MIRT023489 CUL4B cullin 4B 1 1
MIRT023490 RAB34 RAB34, member RAS oncogene family 1 1
MIRT023491 SOX5 SRY-box 5 1 1
MIRT023492 YTHDC1 YTH domain containing 1 1 1
MIRT023493 DGKH diacylglycerol kinase eta 1 1
MIRT023494 FGFR2 fibroblast growth factor receptor 2 1 1
MIRT023495 OCIAD2 OCIA domain containing 2 1 1
MIRT023496 SYMPK symplekin 1 1
MIRT023497 LIPC lipase C, hepatic type 1 1
MIRT023498 CBR4 carbonyl reductase 4 1 1
MIRT023499 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT023500 AP2S1 adaptor related protein complex 2 sigma 1 subunit 1 1
MIRT023501 IL6 interleukin 6 1 1
MIRT023502 RCC2 regulator of chromosome condensation 2 1 1
MIRT023503 WLS wntless Wnt ligand secretion mediator 1 1
MIRT023504 CRELD2 cysteine rich with EGF like domains 2 1 1
MIRT023505 GNG5 G protein subunit gamma 5 1 1
MIRT023506 AGTRAP angiotensin II receptor associated protein 1 1
MIRT023507 HEATR2 dynein axonemal assembly factor 5 1 1
MIRT023508 UGT8 UDP glycosyltransferase 8 1 1
MIRT023509 ABCB5 ATP binding cassette subfamily B member 5 1 1
MIRT023510 PARD6B par-6 family cell polarity regulator beta 1 1
MIRT023511 ALG3 ALG3, alpha-1,3- mannosyltransferase 1 1
MIRT023512 HIST2H3A histone cluster 2 H3 family member a 1 1
MIRT023513 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT023514 SAMD15 sterile alpha motif domain containing 15 1 1
MIRT023515 DRAP1 DR1 associated protein 1 1 1
MIRT023516 MDC1 mediator of DNA damage checkpoint 1 1 1
MIRT023517 CD63 CD63 molecule 1 1
MIRT023518 KNCN kinocilin 1 1
MIRT023519 FANCI Fanconi anemia complementation group I 1 1
MIRT023520 GJB3 gap junction protein beta 3 1 1
MIRT023521 STK24 serine/threonine kinase 24 1 1
MIRT023522 MCM3 minichromosome maintenance complex component 3 1 1
MIRT023523 DMTN dematin actin binding protein 1 1
MIRT023524 SIN3A SIN3 transcription regulator family member A 1 1
MIRT023525 ZNF561 zinc finger protein 561 1 1
MIRT023526 C1orf173 glutamate rich 3 1 1
MIRT023527 BMP7 bone morphogenetic protein 7 1 1
MIRT023528 SLC39A14 solute carrier family 39 member 14 1 1
MIRT023529 MOBP myelin-associated oligodendrocyte basic protein 1 1
MIRT023530 H1FX H1 histone family member X 1 1
MIRT023531 CBX5 chromobox 5 1 1
MIRT023532 ATL3 atlastin GTPase 3 1 1
MIRT023533 BAG5 BCL2 associated athanogene 5 1 1
MIRT023534 CPSF3 cleavage and polyadenylation specific factor 3 1 1
MIRT023535 SGK3 serum/glucocorticoid regulated kinase family member 3 1 1
MIRT023536 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 1 1
MIRT023537 USP33 ubiquitin specific peptidase 33 1 1
MIRT023538 RIMS2 regulating synaptic membrane exocytosis 2 1 1
MIRT023539 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 1 1
MIRT023540 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT023541 GOLPH3 golgi phosphoprotein 3 1 1
MIRT023542 PGD phosphogluconate dehydrogenase 3 2
MIRT023543 UTRN utrophin 1 1
MIRT023544 GPR137C G protein-coupled receptor 137C 1 1
MIRT023545 FBXO33 F-box protein 33 1 1
MIRT023546 ITGA6 integrin subunit alpha 6 2 2
MIRT023547 SRF serum response factor 1 1
MIRT023548 MRPL19 mitochondrial ribosomal protein L19 2 1
MIRT023549 JUP junction plakoglobin 2 1
MIRT023550 KIF5B kinesin family member 5B 2 1
MIRT023551 SLC27A4 solute carrier family 27 member 4 2 1
MIRT023552 GNAI1 G protein subunit alpha i1 2 1
MIRT023553 PLS3 plastin 3 2 1
MIRT023554 MYO1A myosin IA 2 1
MIRT023555 AP1B1 adaptor related protein complex 1 beta 1 subunit 2 2
MIRT023556 FNDC3A fibronectin type III domain containing 3A 4 4
MIRT023557 FLOT2 flotillin 2 2 2
MIRT023558 PSIP1 PC4 and SFRS1 interacting protein 1 2 2
MIRT023559 MYO1B myosin IB 2 2
MIRT023560 CAPN1 calpain 1 1 1
MIRT023561 TAT tyrosine aminotransferase 1 1
MIRT023562 PCDH7 protocadherin 7 1 1
MIRT023563 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 1 1
MIRT023564 PYGB glycogen phosphorylase B 1 1
MIRT023565 CCDC88C coiled-coil domain containing 88C 1 1
MIRT023566 RBM42 RNA binding motif protein 42 1 1
MIRT023567 ABCB6 ATP binding cassette subfamily B member 6 (Langereis blood group) 1 1
MIRT023568 UNC13D unc-13 homolog D 1 1
MIRT023569 DTX1 deltex E3 ubiquitin ligase 1 1 1
MIRT023570 LGALS1 galectin 1 1 1
MIRT023571 LEPREL2 prolyl 3-hydroxylase 3 1 1
MIRT023572 KLHDC4 kelch domain containing 4 1 1
MIRT023573 SLBP stem-loop binding protein 1 1
MIRT023574 PI16 peptidase inhibitor 16 1 1
MIRT023575 RBM12B RNA binding motif protein 12B 1 1
MIRT023576 CALR calreticulin 1 1
MIRT023577 F2RL1 F2R like trypsin receptor 1 1 1
MIRT023578 SLC25A19 solute carrier family 25 member 19 1 1
MIRT023579 HIST2H2AC histone cluster 2 H2A family member c 1 1
MIRT023580 ABHD12 abhydrolase domain containing 12 1 1
MIRT023581 MCAM melanoma cell adhesion molecule 1 1
MIRT023582 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT023583 COQ6 coenzyme Q6, monooxygenase 1 1
MIRT023584 RFC5 replication factor C subunit 5 1 1
MIRT023585 ZNF579 zinc finger protein 579 1 1
MIRT023586 TRIM26 tripartite motif containing 26 1 1
MIRT023587 SPC24 SPC24, NDC80 kinetochore complex component 1 1
MIRT023588 SEC11C SEC11 homolog C, signal peptidase complex subunit 1 1
MIRT023589 SEMG2 semenogelin II 1 1
MIRT023590 RASSF1 Ras association domain family member 1 1 1
MIRT023591 C11orf31 selenoprotein H 1 1
MIRT023592 MACROD1 MACRO domain containing 1 1 1
MIRT023593 HIST1H1B histone cluster 1 H1 family member b 1 1
MIRT023594 PLXDC2 plexin domain containing 2 1 1
MIRT023595 NXPH2 neurexophilin 2 1 1
MIRT023596 SYNE2 spectrin repeat containing nuclear envelope protein 2 1 1
MIRT023597 TRPM6 transient receptor potential cation channel subfamily M member 6 1 1
MIRT023598 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT023599 SH3TC2 SH3 domain and tetratricopeptide repeats 2 1 1
MIRT023600 VASP vasodilator stimulated phosphoprotein 1 1
MIRT023601 ATP6V1C1 ATPase H+ transporting V1 subunit C1 1 1
MIRT023602 AKAP12 A-kinase anchoring protein 12 1 1
MIRT023603 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 1 1
MIRT023604 CLDN12 claudin 12 1 1
MIRT023605 CHAMP1 chromosome alignment maintaining phosphoprotein 1 1 1
MIRT023606 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 1 1
MIRT023607 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT023608 VPS53 VPS53, GARP complex subunit 1 1
MIRT023609 IPO8 importin 8 1 1
MIRT023610 AKAP4 A-kinase anchoring protein 4 1 1
MIRT023611 VMP1 vacuole membrane protein 1 1 1
MIRT023612 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT023613 DKK1 dickkopf WNT signaling pathway inhibitor 1 1 1
MIRT023614 ZNF326 zinc finger protein 326 1 1
MIRT023615 FAM102A family with sequence similarity 102 member A 1 1
MIRT023616 PLXNA4 plexin A4 1 1
MIRT023617 RABEPK Rab9 effector protein with kelch motifs 1 1
MIRT023618 FUBP1 far upstream element binding protein 1 1 1
MIRT023619 MATR3 matrin 3 3 3
MIRT023620 GNAI2 G protein subunit alpha i2 2 1
MIRT023621 CCDC124 coiled-coil domain containing 124 2 1
MIRT023622 RALB RAS like proto-oncogene B 2 1
MIRT023623 GTF3C6 general transcription factor IIIC subunit 6 2 1
MIRT023624 EMD emerin 2 1
MIRT023625 ECHS1 enoyl-CoA hydratase, short chain 1 2 1
MIRT023626 SEPT6 septin 6 2 1
MIRT023627 CACNA2D1 calcium voltage-gated channel auxiliary subunit alpha2delta 1 2 1
MIRT023628 PXDN peroxidasin 3 3
MIRT023629 AMDHD1 amidohydrolase domain containing 1 1 1
MIRT023630 THAP2 THAP domain containing 2 1 1
MIRT023631 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT023632 NAT14 N-acetyltransferase 14 (putative) 1 1
MIRT023633 DDTL D-dopachrome tautomerase like 1 1
MIRT023634 PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 1 1
MIRT023635 BTC betacellulin 1 1
MIRT023636 ILVBL ilvB acetolactate synthase like 1 1
MIRT023637 RRM1 ribonucleotide reductase catalytic subunit M1 1 1
MIRT023638 GPR83 G protein-coupled receptor 83 1 1
MIRT023639 PPA2 pyrophosphatase (inorganic) 2 1 1
MIRT023640 DYNC1LI1 dynein cytoplasmic 1 light intermediate chain 1 1 1
MIRT023641 NPTN neuroplastin 1 1
MIRT023642 MAGEB3 MAGE family member B3 1 1
MIRT023643 PSG6 pregnancy specific beta-1-glycoprotein 6 1 1
MIRT023644 ORC3 origin recognition complex subunit 3 1 1
MIRT023645 SFI1 SFI1 centrin binding protein 1 1
MIRT023646 PAXBP1 PAX3 and PAX7 binding protein 1 1 1
MIRT023647 HSPA1A heat shock protein family A (Hsp70) member 1A 1 1
MIRT023648 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT023649 PSG3 pregnancy specific beta-1-glycoprotein 3 1 1
MIRT023650 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT023651 PRIMA1 proline rich membrane anchor 1 1 1
MIRT023652 ACP2 acid phosphatase 2, lysosomal 1 1
MIRT023653 IL11 interleukin 11 2 2
MIRT023654 EXOC2 exocyst complex component 2 1 1
MIRT023655 C12orf57 chromosome 12 open reading frame 57 1 1
MIRT023656 CDH4 cadherin 4 1 1
MIRT023657 KLHL3 kelch like family member 3 1 1
MIRT023658 MRE11A MRE11 homolog, double strand break repair nuclease 1 1
MIRT023659 SPERT spermatid associated 1 1
MIRT023660 TRPM4 transient receptor potential cation channel subfamily M member 4 1 1
MIRT023661 CAST calpastatin 1 1
MIRT023662 SCAF11 SR-related CTD associated factor 11 1 1
MIRT023663 KCND1 potassium voltage-gated channel subfamily D member 1 1 1
MIRT023664 CHAF1B chromatin assembly factor 1 subunit B 1 1
MIRT023665 SYTL2 synaptotagmin like 2 1 1
MIRT023666 UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 1 1
MIRT023667 SRSF4 serine and arginine rich splicing factor 4 1 1
MIRT023668 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT023669 TMEM106C transmembrane protein 106C 1 1
MIRT023670 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT023671 OSBPL10 oxysterol binding protein like 10 1 1
MIRT023672 KLK12 kallikrein related peptidase 12 1 1
MIRT023673 INTS6 integrator complex subunit 6 1 1
MIRT023674 MKI67 marker of proliferation Ki-67 1 1
MIRT023675 NUP50 nucleoporin 50 3 7
MIRT023676 SHE Src homology 2 domain containing E 1 1
MIRT023677 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT023678 PPARG peroxisome proliferator activated receptor gamma 1 1
MIRT023679 MAD2L1 mitotic arrest deficient 2 like 1 2 1
MIRT023680 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 2 1
MIRT023681 ACTN4 actinin alpha 4 2 1
MIRT023682 TNKS1BP1 tankyrase 1 binding protein 1 2 1
MIRT023683 PIGT phosphatidylinositol glycan anchor biosynthesis class T 2 1
MIRT023684 PGRMC2 progesterone receptor membrane component 2 2 1
MIRT023685 COMMD2 COMM domain containing 2 2 1
MIRT023686 CD109 CD109 molecule 2 2
MIRT023687 COPG1 coatomer protein complex subunit gamma 1 2 2
MIRT023688 DSG2 desmoglein 2 2 2
MIRT023689 DCUN1D1 defective in cullin neddylation 1 domain containing 1 2 2
MIRT023690 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT023691 MSH2 mutS homolog 2 1 1
MIRT023692 IKBKAP elongator complex protein 1 1 1
MIRT023693 DHRS1 dehydrogenase/reductase 1 1 1
MIRT023694 CCL14 C-C motif chemokine ligand 14 1 1
MIRT023695 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023696 ETV7 ETS variant 7 1 1
MIRT023697 HMOX1 heme oxygenase 1 1 1
MIRT023698 KAT2A lysine acetyltransferase 2A 1 1
MIRT023699 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT023700 SYNPO2L synaptopodin 2 like 1 1
MIRT023701 GLTSCR2 NOP53 ribosome biogenesis factor 1 1
MIRT023702 NCAPD3 non-SMC condensin II complex subunit D3 1 1
MIRT023703 PAFAH1B3 platelet activating factor acetylhydrolase 1b catalytic subunit 3 1 1
MIRT023704 ADAMTSL4 ADAMTS like 4 1 1
MIRT023705 ACADVL acyl-CoA dehydrogenase, very long chain 1 1
MIRT023706 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 1
MIRT023707 HSP90B1 heat shock protein 90 beta family member 1 3 5
MIRT023708 EMP3 epithelial membrane protein 3 1 1
MIRT023709 FAM81A family with sequence similarity 81 member A 2 2
MIRT023710 SPINK1 serine peptidase inhibitor, Kazal type 1 1 1
MIRT023711 AGPAT6 glycerol-3-phosphate acyltransferase 4 1 1
MIRT023712 NT5C1B 5'-nucleotidase, cytosolic IB 3 3
MIRT023713 OXTR oxytocin receptor 1 1
MIRT023714 DPP7 dipeptidyl peptidase 7 1 1
MIRT023715 FAM208A family with sequence similarity 208 member A 1 1
MIRT023716 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT023717 PSG9 pregnancy specific beta-1-glycoprotein 9 1 1
MIRT023718 FHDC1 FH2 domain containing 1 1 1
MIRT023719 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT023720 NR5A2 nuclear receptor subfamily 5 group A member 2 1 1
MIRT023721 NXN nucleoredoxin 1 1
MIRT023722 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023723 H3F3C H3 histone family member 3C 3 9
MIRT023724 HDAC2 histone deacetylase 2 1 1
MIRT023725 LHX4 LIM homeobox 4 1 1
MIRT023726 CDC42 cell division cycle 42 1 1
MIRT023727 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT023728 NCAPG non-SMC condensin I complex subunit G 1 1
MIRT023729 AP1S3 adaptor related protein complex 1 sigma 3 subunit 1 1
MIRT023730 BCAP29 B-cell receptor associated protein 29 1 1
MIRT023731 TSHR thyroid stimulating hormone receptor 1 1
MIRT023732 PDE12 phosphodiesterase 12 1 1
MIRT023733 ADAM12 ADAM metallopeptidase domain 12 1 1
MIRT023734 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT023735 HOOK1 hook microtubule tethering protein 1 1 1
MIRT023736 PFDN1 prefoldin subunit 1 1 1
MIRT023737 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT023738 SUSD1 sushi domain containing 1 1 1
MIRT023739 SEC62 SEC62 homolog, preprotein translocation factor 1 1
MIRT023740 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 1 1
MIRT023741 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 3 2
MIRT023742 NXT2 nuclear transport factor 2 like export factor 2 1 1
MIRT023743 ACTN1 actinin alpha 1 2 1
MIRT023744 EIF4G1 eukaryotic translation initiation factor 4 gamma 1 2 1
MIRT023745 COPZ1 coatomer protein complex subunit zeta 1 2 1
MIRT023746 MOB4 MOB family member 4, phocein 2 1
MIRT023747 RSRC2 arginine and serine rich coiled-coil 2 2 1
MIRT023748 MYO3B myosin IIIB 2 1
MIRT023749 PDIA3 protein disulfide isomerase family A member 3 2 1
MIRT023750 FLNB filamin B 2 1
MIRT023751 CHRAC1 chromatin accessibility complex 1 2 1
MIRT023752 PLS1 plastin 1 2 1
MIRT023753 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT023754 LRRC8C leucine rich repeat containing 8 VRAC subunit C 2 2
MIRT023755 OXCT1 3-oxoacid CoA-transferase 1 2 1
MIRT023756 WASF2 WAS protein family member 2 2 1
MIRT023757 FLNA filamin A 2 2
MIRT023758 IGFBP7 insulin like growth factor binding protein 7 1 1
MIRT023759 FBN1 fibrillin 1 1 1
MIRT023760 PNN pinin, desmosome associated protein 1 1
MIRT023761 NCS1 neuronal calcium sensor 1 1 1
MIRT023762 WDR33 WD repeat domain 33 1 1
MIRT023763 MSH6 mutS homolog 6 1 1
MIRT023764 RAB27B RAB27B, member RAS oncogene family 1 1
MIRT023765 MAN1B1 mannosidase alpha class 1B member 1 1 1
MIRT023766 OASL 2'-5'-oligoadenylate synthetase like 1 1
MIRT023767 IFIT3 interferon induced protein with tetratricopeptide repeats 3 1 1
MIRT023768 TMEM87A transmembrane protein 87A 1 1
MIRT023769 TUBB2B tubulin beta 2B class IIb 1 1
MIRT023770 SNRNP35 small nuclear ribonucleoprotein U11/U12 subunit 35 1 1
MIRT023771 ZNF799 zinc finger protein 799 1 1
MIRT023772 C6orf118 chromosome 6 open reading frame 118 1 1
MIRT023773 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023774 HINT2 histidine triad nucleotide binding protein 2 1 1
MIRT023775 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 1
MIRT023776 DPY30 dpy-30, histone methyltransferase complex regulatory subunit 1 1
MIRT023777 RGN regucalcin 1 1
MIRT023778 MFSD10 major facilitator superfamily domain containing 10 1 1
MIRT023779 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 1 1
MIRT023780 CENPF centromere protein F 1 1
MIRT023781 SLC25A10 solute carrier family 25 member 10 1 1
MIRT023782 PLK2 polo like kinase 2 1 1
MIRT023783 IQCD IQ motif containing D 1 1
MIRT023784 CCDC134 coiled-coil domain containing 134 1 1
MIRT023785 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 1 1
MIRT023786 TRIM9 tripartite motif containing 9 1 1
MIRT023787 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 1 1
MIRT023788 AIM2 absent in melanoma 2 1 1
MIRT023789 PHLDB2 pleckstrin homology like domain family B member 2 1 1
MIRT023790 TPD52L2 tumor protein D52 like 2 1 1
MIRT023791 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT023792 RASSF5 Ras association domain family member 5 1 1
MIRT023793 KIF4A kinesin family member 4A 1 1
MIRT023795 PARVA parvin alpha 1 1
MIRT023796 LIFR LIF receptor alpha 1 1
MIRT023797 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT023798 FMNL3 formin like 3 1 1
MIRT023799 EFR3A EFR3 homolog A 1 1
MIRT023800 CCND1 cyclin D1 2 2
MIRT023801 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT023802 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023803 RAPGEF2 Rap guanine nucleotide exchange factor 2 1 1
MIRT023804 SRSF6 serine and arginine rich splicing factor 6 1 1
MIRT023805 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT023806 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023807 SRI sorcin 1 1
MIRT023808 E2F5 E2F transcription factor 5 1 1
MIRT023809 EIF4E eukaryotic translation initiation factor 4E 1 1
MIRT023810 SIGMAR1 sigma non-opioid intracellular receptor 1 2 1
MIRT023811 GPC1 glypican 1 2 1
MIRT023812 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 2 1
MIRT023813 CCDC22 coiled-coil domain containing 22 2 1
MIRT023814 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT023815 PDCD10 programmed cell death 10 2 2
MIRT023816 C12orf10 chromosome 12 open reading frame 10 1 1
MIRT023817 BRDT bromodomain testis associated 1 1
MIRT023818 PROCR protein C receptor 1 1
MIRT023819 CPSF1 cleavage and polyadenylation specific factor 1 1 1
MIRT023820 RFC2 replication factor C subunit 2 1 1
MIRT023821 PACSIN3 protein kinase C and casein kinase substrate in neurons 3 1 1
MIRT023822 BCL6B B-cell CLL/lymphoma 6B 1 1
MIRT023823 HSD17B8 hydroxysteroid 17-beta dehydrogenase 8 1 1
MIRT023824 CXCL3 C-X-C motif chemokine ligand 3 1 1
MIRT023825 AMZ1 archaelysin family metallopeptidase 1 1 1
MIRT023826 FADD Fas associated via death domain 1 1
MIRT023827 CLEC1A C-type lectin domain family 1 member A 1 1
MIRT023828 ANGPTL4 angiopoietin like 4 1 1
MIRT023829 FRG1 FSHD region gene 1 1 1
MIRT023830 IL27RA interleukin 27 receptor subunit alpha 1 1
MIRT023831 CA3 carbonic anhydrase 3 1 1
MIRT023832 PIGS phosphatidylinositol glycan anchor biosynthesis class S 1 1
MIRT023833 MME membrane metalloendopeptidase 1 1
MIRT023834 ETNK1 ethanolamine kinase 1 1 1
MIRT023835 IFIT2 interferon induced protein with tetratricopeptide repeats 2 1 1
MIRT023836 CRYGS crystallin gamma S 1 1
MIRT023837 MCM2 minichromosome maintenance complex component 2 1 1
MIRT023838 GIMAP4 GTPase, IMAP family member 4 1 1
MIRT023839 ACTC1 actin, alpha, cardiac muscle 1 1 1
MIRT023840 ANP32A acidic nuclear phosphoprotein 32 family member A 1 1
MIRT023841 SMC4 structural maintenance of chromosomes 4 1 1
MIRT023842 YTHDF2 YTH N6-methyladenosine RNA binding protein 2 1 1
MIRT023843 ERMN ermin 1 1
MIRT023844 RBM39 RNA binding motif protein 39 1 1
MIRT023845 IFI44 interferon induced protein 44 1 1
MIRT023846 TPSD1 tryptase delta 1 1 1
MIRT023847 DROSHA drosha ribonuclease III 1 1
MIRT023848 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT023849 NUAK1 NUAK family kinase 1 1 1
MIRT023850 ZNF207 zinc finger protein 207 1 1
MIRT023851 GNRHR gonadotropin releasing hormone receptor 1 1
MIRT023852 LEMD3 LEM domain containing 3 1 1
MIRT023853 UBA6 ubiquitin like modifier activating enzyme 6 1 1
MIRT023854 RHOC ras homolog family member C 1 1
MIRT023855 RAB30 RAB30, member RAS oncogene family 1 1
MIRT023856 SCN3A sodium voltage-gated channel alpha subunit 3 1 1
MIRT023857 PRKG2 protein kinase, cGMP-dependent, type II 1 1
MIRT023858 PLCB3 phospholipase C beta 3 1 1
MIRT023859 PIR pirin 1 1
MIRT023860 NAB1 NGFI-A binding protein 1 1 1
MIRT023861 FUBP3 far upstream element binding protein 3 1 1
MIRT023862 HSD17B11 hydroxysteroid 17-beta dehydrogenase 11 1 1
MIRT023863 FMNL2 formin like 2 1 1
MIRT023864 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 1 1
MIRT023865 MRFAP1 Morf4 family associated protein 1 2 1
MIRT023866 CETN3 centrin 3 2 1
MIRT023867 SDPR caveolae associated protein 2 1 1
MIRT023868 LIMS1 LIM zinc finger domain containing 1 2 1
MIRT023869 SUGP1 SURP and G-patch domain containing 1 2 1
MIRT023870 GNB2 G protein subunit beta 2 2 1
MIRT023871 LCP1 lymphocyte cytosolic protein 1 2 1
MIRT023872 CTTN cortactin 2 2
MIRT023873 ZNF48 zinc finger protein 48 1 1
MIRT023874 POLD1 DNA polymerase delta 1, catalytic subunit 1 1
MIRT023875 POLR2I RNA polymerase II subunit I 1 1
MIRT023876 CSTF3 cleavage stimulation factor subunit 3 1 1
MIRT023877 MFN2 mitofusin 2 1 1
MIRT023878 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT023879 MTHFS methenyltetrahydrofolate synthetase 1 1
MIRT023880 RPP40 ribonuclease P/MRP subunit p40 1 1
MIRT023881 MINPP1 multiple inositol-polyphosphate phosphatase 1 1 1
MIRT023882 RRP36 ribosomal RNA processing 36 1 1
MIRT023883 ITGA1 integrin subunit alpha 1 1 1
MIRT023884 LCA5L LCA5L, lebercilin like 1 1
MIRT023885 UBE2I ubiquitin conjugating enzyme E2 I 1 1
MIRT023886 DEFB125 defensin beta 125 1 1
MIRT023887 TSPAN19 tetraspanin 19 1 1
MIRT023888 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT023889 S100A11 S100 calcium binding protein A11 1 1
MIRT023890 MCM7 minichromosome maintenance complex component 7 1 1
MIRT023891 AP1M1 adaptor related protein complex 1 mu 1 subunit 1 1
MIRT023892 GSTO1 glutathione S-transferase omega 1 1 1
MIRT023893 CXCL2 C-X-C motif chemokine ligand 2 1 1
MIRT023894 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT023895 LRWD1 leucine rich repeats and WD repeat domain containing 1 1 1
MIRT023896 STXBP3 syntaxin binding protein 3 1 1
MIRT023897 ABCC4 ATP binding cassette subfamily C member 4 1 1
MIRT023898 PTPN22 protein tyrosine phosphatase, non-receptor type 22 1 1
MIRT023899 TAGLN transgelin 1 1
MIRT023900 EXOC3 exocyst complex component 3 1 1
MIRT023901 DDX60 DExD/H-box helicase 60 1 1
MIRT023902 FADS1 fatty acid desaturase 1 1 1
MIRT023903 SLC26A7 solute carrier family 26 member 7 1 1
MIRT023904 TRPA1 transient receptor potential cation channel subfamily A member 1 1 1
MIRT023905 PPIA peptidylprolyl isomerase A 1 1
MIRT023906 CAPG capping actin protein, gelsolin like 1 1
MIRT023907 TLR4 toll like receptor 4 1 1
MIRT023908 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 1
MIRT023909 TMEM68 transmembrane protein 68 1 1
MIRT023910 SLC35A5 solute carrier family 35 member A5 1 1
MIRT023911 TMOD3 tropomodulin 3 1 1
MIRT023912 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT023913 PLEKHH2 pleckstrin homology, MyTH4 and FERM domain containing H2 1 1
MIRT023914 DOK6 docking protein 6 1 1
MIRT023915 SEC61A1 Sec61 translocon alpha 1 subunit 1 1
MIRT023916 SRSF7 serine and arginine rich splicing factor 7 1 1
MIRT023917 ZNF280C zinc finger protein 280C 1 1
MIRT023918 CAPRIN1 cell cycle associated protein 1 1 1
MIRT023919 CLTC clathrin heavy chain 1 1
MIRT023920 SMIM14 small integral membrane protein 14 1 1
MIRT023921 CHMP2A charged multivesicular body protein 2A 2 1
MIRT023922 NUP160 nucleoporin 160 2 1
MIRT023923 CTDNEP1 CTD nuclear envelope phosphatase 1 2 1
MIRT023924 CNIH4 cornichon family AMPA receptor auxiliary protein 4 2 1
MIRT023925 EDF1 endothelial differentiation related factor 1 2 1
MIRT023926 GNAI3 G protein subunit alpha i3 2 1
MIRT023927 MYOCD myocardin 1 1
MIRT023928 ZNF622 zinc finger protein 622 2 1
MIRT023929 GNB1 G protein subunit beta 1 2 1
MIRT023930 CD2AP CD2 associated protein 2 1
MIRT023931 COPB1 coatomer protein complex subunit beta 1 2 2
MIRT023932 HADH hydroxyacyl-CoA dehydrogenase 2 2
MIRT023933 GPAA1 glycosylphosphatidylinositol anchor attachment 1 1 1
MIRT023934 S100G S100 calcium binding protein G 1 1
MIRT023935 APEH acylaminoacyl-peptide hydrolase 1 1
MIRT023936 NDUFS4 NADH:ubiquinone oxidoreductase subunit S4 1 1
MIRT023937 HYI hydroxypyruvate isomerase (putative) 1 1
MIRT023938 ELMOD2 ELMO domain containing 2 1 1
MIRT023939 NUP210 nucleoporin 210 1 1
MIRT023940 GLI2 GLI family zinc finger 2 1 1
MIRT023941 HIF3A hypoxia inducible factor 3 alpha subunit 1 1
MIRT023942 RCOR2 REST corepressor 2 1 1
MIRT023943 SYPL1 synaptophysin like 1 1 1
MIRT023944 LRRC8D leucine rich repeat containing 8 VRAC subunit D 1 1
MIRT023945 GPX1P1 glutathione peroxidase pseudogene 1 1 1
MIRT023946 MCM4 minichromosome maintenance complex component 4 1 1
MIRT023947 HIST2H3D histone cluster 2 H3 family member d 1 1
MIRT023948 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT023949 UNC45A unc-45 myosin chaperone A 1 1
MIRT023950 PSME1 proteasome activator subunit 1 1 1
MIRT023951 FTSJ1 FtsJ RNA methyltransferase homolog 1 1 1
MIRT023952 REM2 RRAD and GEM like GTPase 2 1 1
MIRT023953 ITGA3 integrin subunit alpha 3 1 1
MIRT023954 ISG15 ISG15 ubiquitin-like modifier 1 1
MIRT023955 NT5E 5'-nucleotidase ecto 1 1
MIRT023956 PLGRKT plasminogen receptor with a C-terminal lysine 1 1
MIRT023957 PKD1L1 polycystin 1 like 1, transient receptor potential channel interacting 1 1
MIRT023958 ATP6V1E1 ATPase H+ transporting V1 subunit E1 1 1
MIRT023959 DDX6 DEAD-box helicase 6 1 1
MIRT023960 NOC2L NOC2 like nucleolar associated transcriptional repressor 1 1
MIRT023961 DPY19L1 dpy-19 like C-mannosyltransferase 1 1 1
MIRT023962 MCM5 minichromosome maintenance complex component 5 1 1
MIRT023963 HIST2H3C histone cluster 2 H3 family member c 1 1
MIRT023964 EFCAB1 EF-hand calcium binding domain 1 1 1
MIRT023965 LMNB1 lamin B1 1 1
MIRT023966 AIFM2 apoptosis inducing factor, mitochondria associated 2 1 1
MIRT023967 FBXO45 F-box protein 45 1 1
MIRT023968 MYO18A myosin XVIIIA 1 1
MIRT023969 SMEK1 protein phosphatase 4 regulatory subunit 3A 1 1
MIRT023970 HERC5 HECT and RLD domain containing E3 ubiquitin protein ligase 5 1 1
MIRT023971 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 1
MIRT023972 LONP2 lon peptidase 2, peroxisomal 1 1
MIRT023973 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT023974 DDX42 DEAD-box helicase 42 1 1
MIRT023975 TTC17 tetratricopeptide repeat domain 17 1 1
MIRT023976 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT023977 AFAP1 actin filament associated protein 1 1 1
MIRT023978 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT023979 EML3 echinoderm microtubule associated protein like 3 1 1
MIRT023980 ANKRD17 ankyrin repeat domain 17 1 1
MIRT023981 TRPS1 transcriptional repressor GATA binding 1 1 1
MIRT023982 XPOT exportin for tRNA 1 1
MIRT023983 ALG2 ALG2, alpha-1,3/1,6-mannosyltransferase 1 1
MIRT023984 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT023985 OSTF1 osteoclast stimulating factor 1 1 1
MIRT023986 IST1 IST1, ESCRT-III associated factor 2 1
MIRT023987 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT023988 PQBP1 polyglutamine binding protein 1 2 1
MIRT023989 BAX BCL2 associated X, apoptosis regulator 2 1
MIRT023990 GNA13 G protein subunit alpha 13 2 1
MIRT023991 FOLR1 folate receptor 1 2 1
MIRT023992 PRDX2 peroxiredoxin 2 2 1
MIRT023993 AHNAK2 AHNAK nucleoprotein 2 2 1
MIRT023994 GNAT2 G protein subunit alpha transducin 2 2 1
MIRT023995 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 1
MIRT023996 KRT75 keratin 75 2 1
MIRT023997 CTBP2 C-terminal binding protein 2 2 1
MIRT023998 DOLPP1 dolichyldiphosphatase 1 2 2
MIRT023999 CXCL1 C-X-C motif chemokine ligand 1 1 1
MIRT024000 KCNN4 potassium calcium-activated channel subfamily N member 4 1 1
MIRT024001 FILIP1 filamin A interacting protein 1 1 1
MIRT024002 PPP1R16A protein phosphatase 1 regulatory subunit 16A 1 1
MIRT024003 MAST4 microtubule associated serine/threonine kinase family member 4 1 1
MIRT024004 ISG20 interferon stimulated exonuclease gene 20 1 1
MIRT024005 PPAP2C phospholipid phosphatase 2 1 1
MIRT024006 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT024007 RAB39B RAB39B, member RAS oncogene family 1 1
MIRT024008 HSD3B7 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 1 1
MIRT024009 HIST3H3 histone cluster 3 H3 1 1
MIRT024010 MMS22L MMS22 like, DNA repair protein 1 1
MIRT024011 COTL1 coactosin like F-actin binding protein 1 1 1
MIRT024012 HNRNPD heterogeneous nuclear ribonucleoprotein D 1 1
MIRT024013 C12orf40 chromosome 12 open reading frame 40 1 1
MIRT024014 BRPF3 bromodomain and PHD finger containing 3 1 1
MIRT024015 TRIM24 tripartite motif containing 24 1 1
MIRT024016 GATA3 GATA binding protein 3 1 1
MIRT024017 SEMA4D semaphorin 4D 1 1
MIRT024018 POLRMT RNA polymerase mitochondrial 1 1
MIRT024019 TIGD4 tigger transposable element derived 4 1 1
MIRT024020 SRSF5 serine and arginine rich splicing factor 5 1 1
MIRT024021 IMPDH1 inosine monophosphate dehydrogenase 1 1 1
MIRT024022 IFIT1 interferon induced protein with tetratricopeptide repeats 1 1 1
MIRT024023 RBM28 RNA binding motif protein 28 1 1
MIRT024024 CCDC102A coiled-coil domain containing 102A 1 1
MIRT024025 KIF2C kinesin family member 2C 1 1
MIRT024026 CTBP1 C-terminal binding protein 1 1 1
MIRT024027 MCM6 minichromosome maintenance complex component 6 1 1
MIRT024028 GTF2H1 general transcription factor IIH subunit 1 1 1
MIRT024029 FRMD7 FERM domain containing 7 1 1
MIRT024030 CBX2 chromobox 2 1 1
MIRT024031 TKT transketolase 3 2
MIRT024032 LRRC8B leucine rich repeat containing 8 VRAC subunit B 1 1
MIRT024033 CCDC180 coiled-coil domain containing 180 1 1
MIRT024034 RSF1 remodeling and spacing factor 1 1 1
MIRT024035 TBC1D9 TBC1 domain family member 9 1 1
MIRT024036 IPO9 importin 9 1 1
MIRT024037 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 3 3
MIRT024038 KIAA1522 KIAA1522 1 1
MIRT024039 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT024040 KDM2B lysine demethylase 2B 1 1
MIRT024041 HP1BP3 heterochromatin protein 1 binding protein 3 1 1
MIRT024042 CDC42SE1 CDC42 small effector 1 1 1
MIRT024043 UNC119B unc-119 lipid binding chaperone B 1 1
MIRT024044 CEBPZ CCAAT/enhancer binding protein zeta 1 1
MIRT024045 CCDC170 coiled-coil domain containing 170 1 1
MIRT024046 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT024047 UBAC2 UBA domain containing 2 2 1
MIRT024048 LGALS3BP galectin 3 binding protein 2 1
MIRT024049 DCAKD dephospho-CoA kinase domain containing 2 1
MIRT024050 COL12A1 collagen type XII alpha 1 chain 2 1
MIRT024051 ABCC1 ATP binding cassette subfamily C member 1 2 1
MIRT024052 CAMK2G calcium/calmodulin dependent protein kinase II gamma 2 1
MIRT024053 DBN1 drebrin 1 2 2
MIRT024054 CALM1 calmodulin 1 2 2
MIRT024055 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT024056 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT024057 RGS17 regulator of G protein signaling 17 1 1
MIRT024058 CCL2 C-C motif chemokine ligand 2 1 1
MIRT024059 SLC39A3 solute carrier family 39 member 3 1 1
MIRT024060 SEC16A SEC16 homolog A, endoplasmic reticulum export factor 1 1
MIRT024061 ESYT1 extended synaptotagmin 1 1 1
MIRT024062 ISY1 ISY1 splicing factor homolog 1 1
MIRT024063 TBCD tubulin folding cofactor D 1 1
MIRT024064 NBL1 neuroblastoma 1, DAN family BMP antagonist 1 1
MIRT024065 TELO2 telomere maintenance 2 1 1
MIRT024066 ATP13A1 ATPase 13A1 1 1
MIRT024067 PLXNB2 plexin B2 1 1
MIRT024068 ZNF638 zinc finger protein 638 1 1
MIRT024069 ZNF568 zinc finger protein 568 1 1
MIRT024070 CDH13 cadherin 13 1 1
MIRT024071 FAM167A family with sequence similarity 167 member A 1 1
MIRT024072 F11R F11 receptor 1 1
MIRT024073 KIAA1731 centrosomal protein 295 1 1
MIRT024074 S100A16 S100 calcium binding protein A16 1 1
MIRT024075 TROVE2 TROVE domain family member 2 1 1
MIRT024076 SDR39U1 short chain dehydrogenase/reductase family 39U member 1 1 1
MIRT024077 VAMP7 vesicle associated membrane protein 7 1 1
MIRT024078 RIN1 Ras and Rab interactor 1 1 1
MIRT024079 ARG1 arginase 1 1 1
MIRT024080 DDT D-dopachrome tautomerase 1 1
MIRT024081 FOXN4 forkhead box N4 1 1
MIRT024082 SFN stratifin 1 1
MIRT024083 AKR1D1 aldo-keto reductase family 1 member D1 1 1
MIRT024084 RIPK2 receptor interacting serine/threonine kinase 2 1 1
MIRT024085 L1CAM L1 cell adhesion molecule 1 1
MIRT024086 IL8 C-X-C motif chemokine ligand 8 1 1
MIRT024087 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT024088 OARD1 O-acyl-ADP-ribose deacylase 1 1 1
MIRT024089 DDX50 DExD-box helicase 50 1 1
MIRT024090 C2orf48 chromosome 2 open reading frame 48 1 1
MIRT024091 ARGLU1 arginine and glutamate rich 1 1 1
MIRT024092 C10orf137 erythroid differentiation regulatory factor 1 1 1
MIRT024093 DFNA5 DFNA5, deafness associated tumor suppressor 1 1
MIRT024094 RXFP1 relaxin/insulin like family peptide receptor 1 1 1
MIRT024095 SSR1 signal sequence receptor subunit 1 1 1
MIRT024096 MIER1 MIER1 transcriptional regulator 1 1
MIRT024097 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT024098 ACTB actin beta 1 1
MIRT024099 TRA2B transformer 2 beta homolog 1 1
MIRT024100 CSNK2A2 casein kinase 2 alpha 2 1 1
MIRT024101 ANP32E acidic nuclear phosphoprotein 32 family member E 3 3
MIRT024102 G3BP1 G3BP stress granule assembly factor 1 1 1
MIRT024103 THY1 Thy-1 cell surface antigen 2 1
MIRT024104 CDH2 cadherin 2 2 1
MIRT024105 C1orf27 chromosome 1 open reading frame 27 2 1
MIRT024106 FLNC filamin C 2 1
MIRT024107 CDK4 cyclin dependent kinase 4 2 1
MIRT024108 CRIP2 cysteine rich protein 2 2 2
MIRT024109 EPB41L2 erythrocyte membrane protein band 4.1 like 2 2 2
MIRT035536 SP1 Sp1 transcription factor 1 1
MIRT046543 FBXO22 F-box protein 22 1 1
MIRT046544 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 1 1
MIRT054150 ETS1 ETS proto-oncogene 1, transcription factor 3 1
MIRT054707 FASN fatty acid synthase 2 1
MIRT054889 PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha 3 1
MIRT192334 KLF13 Kruppel like factor 13 2 2
MIRT215738 C5ORF51 chromosome 5 open reading frame 51 2 4
MIRT269374 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT332729 QSER1 glutamine and serine rich 1 2 2
MIRT394616 PPP2R1B protein phosphatase 2 scaffold subunit Abeta 2 2
MIRT437776 TH tyrosine hydroxylase 1 1
MIRT437777 TH tyrosine hydroxylase 1 1
MIRT437822 MPL MPL proto-oncogene, thrombopoietin receptor 4 1
MIRT437831 API5 apoptosis inhibitor 5 3 1
MIRT437883 SPRED1 sprouty related EVH1 domain containing 1 3 1
MIRT437918 ASPH aspartate beta-hydroxylase 1 1
MIRT438458 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT438459 COX1 cytochrome c oxidase subunit I 1 1
MIRT438811 FRS2 fibroblast growth factor receptor substrate 2 3 1
MIRT438813 FZD7 frizzled class receptor 7 3 1
MIRT438862 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT442950 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT446165 C8A complement C8 alpha chain 2 2
MIRT446281 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT448537 RIMS4 regulating synaptic membrane exocytosis 4 2 2
MIRT448837 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT449399 TOX4 TOX high mobility group box family member 4 2 2
MIRT449446 STAMBP STAM binding protein 2 2
MIRT452043 NT5C1B-RDH14 NT5C1B-RDH14 readthrough 2 2
MIRT456019 PSMA7 proteasome subunit alpha 7 2 2
MIRT456593 CHML CHM like, Rab escort protein 2 2 2
MIRT458330 SALL2 spalt like transcription factor 2 2 2
MIRT461318 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT464025 WBP2 WW domain binding protein 2 2 2
MIRT466871 STX6 syntaxin 6 2 2
MIRT469336 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT472374 TSPAN1 tetraspanin 1 2 2
MIRT477574 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT478271 DDX19B DEAD-box helicase 19B 2 2
MIRT480680 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT482899 SMKR1 small lysine rich protein 1 2 6
MIRT484249 ANK1 ankyrin 1 2 2
MIRT485161 RAB5C RAB5C, member RAS oncogene family 2 8
MIRT485306 NFAT5 nuclear factor of activated T-cells 5 2 8
MIRT512088 CRK CRK proto-oncogene, adaptor protein 2 4
MIRT512352 ARPP19 cAMP regulated phosphoprotein 19 2 4
MIRT519968 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT526409 TFAM transcription factor A, mitochondrial 2 2
MIRT527095 VSTM5 V-set and transmembrane domain containing 5 2 2
MIRT530393 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT535608 NUDT21 nudix hydrolase 21 2 2
MIRT561977 LRRC59 leucine rich repeat containing 59 2 2
MIRT563131 ZNF215 zinc finger protein 215 2 2
MIRT564856 ZBED3 zinc finger BED-type containing 3 2 2
MIRT576357 Pxdn peroxidasin 2 2
MIRT609377 FAM216B family with sequence similarity 216 member B 2 2
MIRT616891 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 2
MIRT639512 FYB FYN binding protein 1 2 2
MIRT675449 SRP19 signal recognition particle 19 2 2
MIRT687226 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT689969 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT695511 ALPI alkaline phosphatase, intestinal 2 2
MIRT698425 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT698740 STX12 syntaxin 12 2 2
MIRT718002 ZNF79 zinc finger protein 79 2 2
MIRT720102 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT731362 KRAS KRAS proto-oncogene, GTPase 3 2
MIRT731787 NAIP NLR family apoptosis inhibitory protein 3 1
MIRT731842 VEGFA vascular endothelial growth factor A 3 1
MIRT734608 IL10 interleukin 10 1 0
MIRT734810 MINOS1 mitochondrial inner membrane organizing system 1 3 0
MIRT734830 STAR steroidogenic acute regulatory protein 2 0
MIRT735354 MB myoglobin 1 0
MIRT735770 WNT4 Wnt family member 4 3 0
MIRT736437 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 0
MIRT736987 YY1 YY1 transcription factor 1 0
MIRT756120 CXCR4 C-X-C motif chemokine receptor 4 5 1
MIRT756237 NEAT1 nuclear paraspeckle assembly transcript 1 (non-protein coding) 1 1
MIRT756238 GNA12 G protein subunit alpha 12 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1-3p Doxorubicin 31703 NSC123127 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299, N417, BEAS-2B)
hsa-miR-1-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1-3p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1-3p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-1-3p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-1-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-1-3p Fluoropyrimidine + Oxaliplatin/Paclitaxel resistant Low Gastric Cancer tissue
hsa-miR-1-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1-3p Platinum-based doublet chemotherapy resistant Low Lung Adenocarcinoma tissue
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (Calu6)
hsa-miR-1-3p Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-1-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-1-3p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma tissue
hsa-miR-1-3p Cyflumetofen 11496052 sensitive Low Normal tissue
hsa-miR-1-3p Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC‐9, HCC‐827)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer tissue and cell line (A549, H1299)
hsa-miR-1-3p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-1-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-CC)
hsa-miR-1-3p Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-1-3p Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-1-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375)
hsa-miR-1-3p Bromocriptine 31101 NSC169774 approved resistant Low Prolactinoma tissue
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7, ZR-7530)
hsa-miR-1-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7, ZR-7530)
hsa-miR-1-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (Hep3B, HepG2)
hsa-miR-1-3p Doxorubicin 31703 NSC123127 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Paclitaxel 36314 NSC125973 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Etoposide 36462 NSC141540 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Vinorelbine 44424639 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (H460, A549)
hsa-miR-1-3p Antiepileptic Drug sensitive High Pediatric Epilepsy tissue
hsa-miR-1-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-1-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1-3p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1-3p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-1-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1-3p Sunitinib 5329102 NSC750690 approved sensitive tissue (clear cell renal cell carcinoma)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-1-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-1-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1-3p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-1-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-1-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission