miRTarBase - #MIRT000654


—
pre-miRNA Information
pre-miRNA hsa-mir-424   
Genomic Coordinates chrX: 134546614 - 134546711
Synonyms MIR322, MIRN424, hsa-mir-424, miRNA424, MIR424
Description Homo sapiens miR-424 stem-loop
Comment This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells . The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-424-5p
Sequence 11| CAGCAGCAAUUCAUGUUUUGAA |32
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 X - 134546697 29233923 MiREDiBase
A-to-I 8 X - 134546694 17604727 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs888095819 1 dbSNP
rs1486362336 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDC14A   
Synonyms DFNB105, cdc14, hCDC14
Description cell division cycle 14A
Transcript NM_003672   
Other Transcripts NM_033312 , NM_033313   
Expression
Putative miRNA Targets on CDC14A
3'UTR of CDC14A
(miRNA target sites are highlighted)		 
>CDC14A|NM_003672|3'UTR
   1 GGCCTTGCCACTCCAGTGAAAGCTGTTCTTCTCTTAGACACAATTTCTTCATCTGGACGAGCAGTGGAGAGGGAAAGCAA
  81 CTTCTTGCTGGAAGAATATCTCTGCCTTCTTACCTTAAATTAAAAAGAGCACTAAGATAACACCTTCAAGAGACTTGAAA
 161 ACAGAAAACTGGTTAATGACTACTATAAATGCACTGAAACTATGTTTATGGAGATTTCCATACTTTTAAAGACAGTTTTA
 241 ATGTTGAATTTGGTATTTTGAAGGGTTATTTTTAATGTATTTTGGTAATACATTTATTATTATATTTACATGTACAGTGT
 321 TACATTATATATGTATTGTGAACTTTAAAAGACTATTTTGATAAATTTATAAATATATAAAATTATGTAAAAACTACACT
 401 ATATTTTGATTTAGATTTTCCTGCTGTTTGCTACCAAAAATTTGTATTTTAAATCTGTTTAGTTTTAGTATGGTTTTGTC
 481 TCTAATGAATAAATAATTCCTTCTTATTAAGAAGAAGTAAGGGAGAAAGTTTTTAGAAAGTGATTTTTATGCTCGCACTA
 561 TAAATATGGCAGGTCAGTTCATTCTTTTGGGAAGTCAGTTTAGTTACACTGAGTTTATCCAAGTTTATCTCTACCAAGAG
 641 TATAATGGCATGGGATGGCTTATTTAGGACAATTCCCTTTCCTATTGTTTTTGTTGCTGAGCCAATTTGAGTTAGTTTTG
 721 CATCCTGGGGGGCTTTAAAATACAGCATGCAGTGAAAGATCAGAATTCACTGAATATTTCTTCTGAGAGCATGGTTTCAT
 801 GGTTTTTCTCTATGAAATGACTCAATATTCCAAATGTTTTTTTTTCCTTCCTCCTTTCAAAAGAGTTCTTAACCCAATTA
 881 GGATATCCTGCTTTGGGTATGAGGTTGTTGTTGCCTGTAATCACACATGGTTTGACATCAGTTTTAAATCAATGGAGAGA
 961 AAAAACTGAAAAAGATGCTGCTAAGTAGTTCTCTGTATTAAAGGAGATATTTTTAAAACAGGGTACAACCCCCTGCTGCA
1041 CACGCTAGCATATCTGGAACCTACTATGAAAATGAAAGGACCCTTATAGGTACTCACAGCCCTTTCATGTAAGTATGATC
1121 TGATATTTAGGTCTTCAGAAGCCTGTAGGTTTCATTTCTATGAGGAATCGAGGAGCGTTACATCCTGATATCCTTCCAGG
1201 CTGCTTAAGAATGGACTGCTTCGACACTGAAAGTGCTAGTTAAATGGATTCATATGAAGTGCTTTACTCCCAACCATTGA
1281 GTTATTTATAATGTATTTATTAGGGGAGGGTACCTTGAGTCTATTATATATGCTTCATCAAAACATCTTGTTCATGTTTT
1361 ATGTTTTTAAAAAAGGCATTTGAATGAATGTTTGACTCAGGTTTGTTAAATTAACCTTCAGTAACTGCAGTACCAAAAAT
1441 TACACTCAACTGATGAAAAAAACGAATTGTATGATTTAGGAATCAAAAACTAAAATAAGTGGAATTATGTATCTTTTCTA
1521 AAGTTAAAAAAGTAAAATATTTTATTATGAGTTATTATAAAAATTGGTTAATTGTATAGGAAGATGACAGTATTTTTTTC
1601 AAGTTATCATAAAAAGTAATTCAGATGACATTTGAGAAGTAGGGGAAAGGGAATCATGTTGACAGTTTTAGTTCTGTGAA
1681 CACTAATTTGTGTGAAGCTATTAAAATGATTGTAAAGTTGACTACTGTAAATTTCCCATAATTATGTGTGTATATGTGTC
1761 ATATGTATGTACATGTATATGTCTAAAAATTACTTTACACATGTGCCTACATAGACACACCAAGAAGTGGATGTATATAA
1841 TATAGAAAGTATATAGCAAAGTAATTTTACTCTGATAATAAAAATTGTTTGACATGTATTTTGTTATGAATAGTTTATCT
1921 TCCAAAAGATATTTTGCTCTATTTTAAAGTGTAGAAGAATACACTGCTAATAAATAATAAAAGTTTTATTCAATTTAAAA
2001 AAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aagUUUUGUACUU----AACGACGAc 5'
             ||||| ||||     ||||||| 
Target 5' gaaAAAAC-TGAAAAAGATGCTGCTa 3'
 959 - 983 160.00 -11.40
2 
miRNA  3' aaGUUUUGUAC----UU----AACGACGac 5'
            :|||||| |    ||     ||||||  
Target 5' ttTAAAACAGGGTACAACCCCCTGCTGCac 3'
 1012 - 1041 132.00 -16.00
3 
miRNA  3' aaguUUUGUACU-UAACGACGAc 5'
              ::::|||| :|||:||:| 
Target 5' ctttGGGTATGAGGTTGTTGTTg 3'
 891 - 913 130.00 -16.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM8711383 1 COSMIC
COSN31554792 23 COSMIC
COSN30185865 34 COSMIC
COSN30500646 35 COSMIC
COSN28861409 61 COSMIC
COSN24398828 72 COSMIC
COSN31581659 78 COSMIC
COSN31601962 118 COSMIC
COSN31536303 153 COSMIC
COSN30162850 154 COSMIC
COSN30493739 161 COSMIC
COSN31554584 169 COSMIC
COSN30136743 179 COSMIC
COSN30162851 186 COSMIC
COSN31605487 188 COSMIC
COSN30105650 195 COSMIC
COSN8635176 196 COSMIC
COSN31607084 214 COSMIC
COSN26644191 370 COSMIC
COSN31566749 383 COSMIC
COSN31486728 428 COSMIC
COSN30168303 504 COSMIC
COSN5350222 550 COSMIC
COSN31568830 556 COSMIC
COSN20090290 575 COSMIC
COSN29493988 604 COSMIC
COSN30166873 1405 COSMIC
COSN31595811 1407 COSMIC
COSN31567696 1437 COSMIC
COSN25914805 1470 COSMIC
COSN17181737 1584 COSMIC
COSN1085602 1601 COSMIC
COSN5729330 1645 COSMIC
COSN8635177 1770 COSMIC
COSN31610955 1809 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs530200786 9 dbSNP
rs1033832652 10 dbSNP
rs960892057 11 dbSNP
rs1443083164 14 dbSNP
rs1249674105 16 dbSNP
rs1281338194 26 dbSNP
rs370532372 31 dbSNP
rs1239698644 32 dbSNP
rs1304380866 35 dbSNP
rs186880975 39 dbSNP
rs113106934 40 dbSNP
rs770841250 42 dbSNP
rs1291264909 45 dbSNP
rs776637950 45 dbSNP
rs1206095280 49 dbSNP
rs1230685118 51 dbSNP
rs34882223 53 dbSNP
rs748700058 59 dbSNP
rs1034876948 60 dbSNP
rs370438821 66 dbSNP
rs974112300 77 dbSNP
rs919977530 78 dbSNP
rs932771793 80 dbSNP
rs1050295205 85 dbSNP
rs890950445 97 dbSNP
rs765013552 99 dbSNP
rs1214754839 103 dbSNP
rs943912621 106 dbSNP
rs1052927341 122 dbSNP
rs772549994 123 dbSNP
rs1475416890 125 dbSNP
rs1450668106 126 dbSNP
rs1189443914 129 dbSNP
rs1023969852 131 dbSNP
rs1011165221 132 dbSNP
rs1042745307 148 dbSNP
rs905547107 152 dbSNP
rs1472448229 156 dbSNP
rs28364924 164 dbSNP
rs1035883685 177 dbSNP
rs1361920198 180 dbSNP
rs1216704716 193 dbSNP
rs139593034 194 dbSNP
rs559728078 203 dbSNP
rs867479334 204 dbSNP
rs1015822091 214 dbSNP
rs573417127 219 dbSNP
rs36025972 228 dbSNP
rs1400009916 254 dbSNP
rs10783134 257 dbSNP
rs986495342 260 dbSNP
rs747382824 264 dbSNP
rs912758677 270 dbSNP
rs1339198317 271 dbSNP
rs535019060 277 dbSNP
rs1477387398 291 dbSNP
rs1375573788 294 dbSNP
rs954215961 303 dbSNP
rs1039959393 307 dbSNP
rs985559000 313 dbSNP
rs893346399 315 dbSNP
rs1196714451 323 dbSNP
rs1355968317 326 dbSNP
rs1238166408 341 dbSNP
rs912647871 346 dbSNP
rs1285577415 347 dbSNP
rs1486156767 351 dbSNP
rs28364925 354 dbSNP
rs1253852290 370 dbSNP
rs1376683463 376 dbSNP
rs1307508270 377 dbSNP
rs1041717277 381 dbSNP
rs41287270 383 dbSNP
rs1413419567 390 dbSNP
rs1002990194 391 dbSNP
rs1160153000 393 dbSNP
rs1381556358 394 dbSNP
rs1043393930 400 dbSNP
rs1379506849 402 dbSNP
rs377003688 417 dbSNP
rs905518325 425 dbSNP
rs1001649465 426 dbSNP
rs1237999915 436 dbSNP
rs1209320799 454 dbSNP
rs1056844949 459 dbSNP
rs1467297844 462 dbSNP
rs1217689093 467 dbSNP
rs895577387 469 dbSNP
rs1057231290 471 dbSNP
rs896361395 485 dbSNP
rs1013732729 490 dbSNP
rs1015790846 495 dbSNP
rs1446452262 504 dbSNP
rs961563073 509 dbSNP
rs1395902890 512 dbSNP
rs1299470772 513 dbSNP
rs1419720887 526 dbSNP
rs1332640408 535 dbSNP
rs1379849375 541 dbSNP
rs1012452271 555 dbSNP
rs1023558305 556 dbSNP
rs1444644144 556 dbSNP
rs1414250157 557 dbSNP
rs1308668813 559 dbSNP
rs552750895 567 dbSNP
rs568377629 575 dbSNP
rs1467346424 576 dbSNP
rs1168880306 577 dbSNP
rs954030911 585 dbSNP
rs975647544 590 dbSNP
rs1253961891 593 dbSNP
rs1194519462 603 dbSNP
rs1063302 604 dbSNP
rs995150467 617 dbSNP
rs1025288085 623 dbSNP
rs1224985252 641 dbSNP
rs1322766638 641 dbSNP
rs28364926 650 dbSNP
rs576864164 651 dbSNP
rs1227154346 660 dbSNP
rs775691857 673 dbSNP
rs1279344721 678 dbSNP
rs1177436319 682 dbSNP
rs7516109 684 dbSNP
rs1296036427 685 dbSNP
rs531046912 697 dbSNP
rs1438132959 706 dbSNP
rs1350305471 710 dbSNP
rs1163840804 713 dbSNP
rs947241826 716 dbSNP
rs1042977162 723 dbSNP
rs964253814 729 dbSNP
rs936989571 730 dbSNP
rs975958286 734 dbSNP
rs767558557 737 dbSNP
rs1056831506 744 dbSNP
rs146587744 748 dbSNP
rs1488915437 749 dbSNP
rs182797022 752 dbSNP
rs34470860 767 dbSNP
rs1219862985 781 dbSNP
rs1376218411 793 dbSNP
rs541443321 796 dbSNP
rs1465853368 814 dbSNP
rs374782479 826 dbSNP
rs1403061614 836 dbSNP
rs1275735256 837 dbSNP
rs940405832 837 dbSNP
rs187483712 838 dbSNP
rs897321645 839 dbSNP
rs1330697930 847 dbSNP
rs1368410464 848 dbSNP
rs1388670231 851 dbSNP
rs924642188 852 dbSNP
rs1330798457 854 dbSNP
rs938663587 861 dbSNP
rs1402186369 869 dbSNP
rs1057239204 878 dbSNP
rs1027203015 881 dbSNP
rs1421635265 882 dbSNP
rs530357007 883 dbSNP
rs1012092519 884 dbSNP
rs1045276242 887 dbSNP
rs111368789 888 dbSNP
rs537283414 892 dbSNP
rs1442006525 895 dbSNP
rs760568898 900 dbSNP
rs140999780 904 dbSNP
rs1025507055 911 dbSNP
rs1211626245 914 dbSNP
rs1312207739 915 dbSNP
rs1300239903 916 dbSNP
rs1258679178 920 dbSNP
rs1231615490 921 dbSNP
rs951089222 934 dbSNP
rs766156176 939 dbSNP
rs1007815466 953 dbSNP
rs1428801895 955 dbSNP
rs1304448331 960 dbSNP
rs1019555453 961 dbSNP
rs1019374228 967 dbSNP
rs1358637195 969 dbSNP
rs964111157 976 dbSNP
rs563768044 985 dbSNP
rs1441755037 992 dbSNP
rs914756668 1011 dbSNP
rs1464467443 1012 dbSNP
rs988846880 1017 dbSNP
rs1170596020 1024 dbSNP
rs1258896368 1028 dbSNP
rs1182940499 1032 dbSNP
rs1483332075 1040 dbSNP
rs968868756 1044 dbSNP
rs748856210 1045 dbSNP
rs1355432822 1048 dbSNP
rs1286236799 1051 dbSNP
rs1239163597 1053 dbSNP
rs532746601 1055 dbSNP
rs754633761 1058 dbSNP
rs552340700 1067 dbSNP
rs1314837233 1076 dbSNP
rs1396504230 1082 dbSNP
rs1378600018 1083 dbSNP
rs1301193423 1087 dbSNP
rs938670250 1089 dbSNP
rs1421550406 1091 dbSNP
rs1291909919 1098 dbSNP
rs778340450 1100 dbSNP
rs1057434056 1101 dbSNP
rs1158217711 1103 dbSNP
rs916014304 1104 dbSNP
rs192447817 1108 dbSNP
rs927203967 1113 dbSNP
rs937274257 1150 dbSNP
rs1423716960 1160 dbSNP
rs1400876725 1164 dbSNP
rs528460715 1168 dbSNP
rs1254626436 1170 dbSNP
rs1358203988 1171 dbSNP
rs752195909 1176 dbSNP
rs548635978 1177 dbSNP
rs1348360619 1183 dbSNP
rs1266967192 1185 dbSNP
rs916907762 1198 dbSNP
rs898368552 1210 dbSNP
rs1291290189 1211 dbSNP
rs568339704 1213 dbSNP
rs931144612 1218 dbSNP
rs940373793 1223 dbSNP
rs1341200792 1228 dbSNP
rs1297895528 1236 dbSNP
rs1380718071 1246 dbSNP
rs1393388432 1248 dbSNP
rs1164217693 1252 dbSNP
rs747469584 1255 dbSNP
rs898916837 1265 dbSNP
rs1367238149 1266 dbSNP
rs886998247 1278 dbSNP
rs1478549404 1289 dbSNP
rs185509062 1290 dbSNP
rs1192548553 1298 dbSNP
rs1444948039 1302 dbSNP
rs1313344620 1319 dbSNP
rs1488003865 1325 dbSNP
rs1323492847 1326 dbSNP
rs386633878 1329 dbSNP
rs112473179 1330 dbSNP
rs192602599 1331 dbSNP
rs539642456 1333 dbSNP
rs866054474 1369 dbSNP
rs901177701 1369 dbSNP
rs1386576489 1376 dbSNP
rs1218351658 1381 dbSNP
rs1334028643 1398 dbSNP
rs1466572079 1399 dbSNP
rs1400146067 1408 dbSNP
rs1166842573 1412 dbSNP
rs1474103545 1415 dbSNP
rs1379021891 1420 dbSNP
rs748756736 1422 dbSNP
rs1010196543 1425 dbSNP
rs1477041884 1427 dbSNP
rs184443737 1429 dbSNP
rs1021374208 1434 dbSNP
rs1415127811 1440 dbSNP
rs1458173256 1444 dbSNP
rs969221916 1445 dbSNP
rs1194154120 1451 dbSNP
rs765962217 1454 dbSNP
rs978595761 1456 dbSNP
rs1162721036 1457 dbSNP
rs1275722159 1459 dbSNP
rs188592712 1464 dbSNP
rs977549856 1465 dbSNP
rs1311946889 1499 dbSNP
rs1447931167 1501 dbSNP
rs1376818415 1502 dbSNP
rs145209158 1526 dbSNP
rs1407773928 1530 dbSNP
rs1403719290 1531 dbSNP
rs547849490 1537 dbSNP
rs1031938959 1540 dbSNP
rs917211292 1552 dbSNP
rs992738591 1552 dbSNP
rs960253927 1555 dbSNP
rs1358944208 1556 dbSNP
rs1440002018 1560 dbSNP
rs993075583 1575 dbSNP
rs1179555250 1578 dbSNP
rs1444263712 1581 dbSNP
rs1279384241 1590 dbSNP
rs373557418 1592 dbSNP
rs1200142204 1593 dbSNP
rs1399153360 1600 dbSNP
rs915924983 1601 dbSNP
rs1381219475 1604 dbSNP
rs1226556745 1606 dbSNP
rs1311309454 1607 dbSNP
rs1353801558 1609 dbSNP
rs1241346336 1611 dbSNP
rs948740408 1612 dbSNP
rs1489746244 1614 dbSNP
rs1278360907 1616 dbSNP
rs372863256 1623 dbSNP
rs1283422739 1627 dbSNP
rs920640882 1630 dbSNP
rs561334688 1637 dbSNP
rs1183675536 1646 dbSNP
rs1413593309 1652 dbSNP
rs1373247728 1662 dbSNP
rs1487784867 1664 dbSNP
rs746125619 1675 dbSNP
rs1046857547 1680 dbSNP
rs930368515 1713 dbSNP
rs1238444014 1714 dbSNP
rs1050213925 1726 dbSNP
rs770045485 1728 dbSNP
rs1237945141 1733 dbSNP
rs1180639543 1737 dbSNP
rs1484698709 1739 dbSNP
rs1384615347 1745 dbSNP
rs943982723 1750 dbSNP
rs1353483944 1751 dbSNP
rs1040961775 1754 dbSNP
rs1440394817 1755 dbSNP
rs775781620 1763 dbSNP
rs901442564 1769 dbSNP
rs1378678325 1773 dbSNP
rs899538152 1774 dbSNP
rs1284057180 1778 dbSNP
rs996488602 1782 dbSNP
rs1353010413 1790 dbSNP
rs1021803424 1793 dbSNP
rs1176474583 1808 dbSNP
rs904242513 1813 dbSNP
rs1344440164 1820 dbSNP
rs1315986896 1823 dbSNP
rs1406810623 1827 dbSNP
rs181388175 1836 dbSNP
rs1164111257 1839 dbSNP
rs1414461616 1839 dbSNP
rs1474304380 1842 dbSNP
rs543713350 1843 dbSNP
rs143133059 1850 dbSNP
rs1194712027 1855 dbSNP
rs186061449 1862 dbSNP
rs1240530181 1885 dbSNP
rs1224249157 1888 dbSNP
rs1452497208 1895 dbSNP
rs1289868264 1903 dbSNP
rs1231995867 1905 dbSNP
rs577337599 1908 dbSNP
rs960180342 1911 dbSNP
rs189253506 1914 dbSNP
rs1000678516 1920 dbSNP
rs1218660742 1923 dbSNP
rs1034475144 1928 dbSNP
rs958786320 1935 dbSNP
rs1438414886 1941 dbSNP
rs1014100490 1945 dbSNP
rs559868480 1949 dbSNP
rs1325182638 1956 dbSNP
rs1459786448 1965 dbSNP
rs993519973 1966 dbSNP
rs1306502699 1971 dbSNP
rs1023213022 1976 dbSNP
rs1024199274 1979 dbSNP
rs763137947 1979 dbSNP
rs528623532 1981 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Disease WEE1;
Location of target site 3'UTR
Tools used in this research EIMMO , TargetScan
Original Description (Extracted from the article) ... "we 茂卢聛nd the following: mir-424 targets ANLN ...

- Forrest AR; Kanamori-Katayama M; Tomaru Y; et al., 2010, Leukemia.

Article - Forrest AR; Kanamori-Katayama M; Tomaru Y; et al.
- Leukemia, 2010
Acute myeloid leukemia (AML) involves a block in terminal differentiation of the myeloid lineage and uncontrolled proliferation of a progenitor state. Using phorbol myristate acetate (PMA), it is possible to overcome this block in THP-1 cells (an M5-AML containing the MLL-MLLT3 fusion), resulting in differentiation to an adherent monocytic phenotype. As part of FANTOM4, we used microarrays to identify 23 microRNAs that are regulated by PMA. We identify four PMA-induced microRNAs (mir-155, mir-222, mir-424 and mir-503) that when overexpressed cause cell-cycle arrest and partial differentiation and when used in combination induce additional changes not seen by any individual microRNA. We further characterize these pro-differentiative microRNAs and show that mir-155 and mir-222 induce G2 arrest and apoptosis, respectively. We find mir-424 and mir-503 are derived from a polycistronic precursor mir-424-503 that is under repression by the MLL-MLLT3 leukemogenic fusion. Both of these microRNAs directly target cell-cycle regulators and induce G1 cell-cycle arrest when overexpressed in THP-1. We also find that the pro-differentiative mir-424 and mir-503 downregulate the anti-differentiative mir-9 by targeting a site in its primary transcript. Our study highlights the combinatorial effects of multiple microRNAs within cellular systems.
LinkOut: [PMID: 19956200]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors 0.408 4.1e-4 0.223 3.8e-2 64 Click to see details
GSE19783 ER- ER- breast cancer 0.304 3.2e-3 0.278 6.6e-3 79 Click to see details
GSE14794 Lymphoblastoid cells -0.239 1.2e-2 -0.209 2.4e-2 90 Click to see details
GSE21032 Prostate cancer 0.238 1.5e-2 0.231 1.8e-2 83 Click to see details
GSE19350 CNS germ cell tumors 0.416 8.9e-2 0.334 1.4e-1 12 Click to see details
GSE28544 Breast cancer -0.255 1.1e-1 -0.262 1.1e-1 24 Click to see details
GSE17498 Multiple myeloma -0.173 1.4e-1 -0.170 1.5e-1 40 Click to see details
GSE19536 Breast cancer 0.101 1.6e-1 0.085 2.0e-1 100 Click to see details
GSE38226 Liver fibrosis 0.185 2.1e-1 -0.006 4.9e-1 21 Click to see details
GSE28260 Renal cortex and medulla 0.225 2.3e-1 0.203 2.5e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.181 2.5e-1 -0.141 3.0e-1 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.141 2.8e-1 0.205 1.9e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.191 3.1e-1 -0.033 4.7e-1 9 Click to see details
GSE21849 B cell lymphoma -0.083 3.3e-1 0.334 3.8e-2 29 Click to see details
GSE17306 Multiple myeloma -0.05 3.7e-1 -0.061 3.4e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.063 3.8e-1 -0.033 4.4e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.061 4.0e-1 -0.047 4.2e-1 20 Click to see details
GSE32688 Pancreatic cancer 0.036 4.2e-1 0.082 3.3e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.034 4.4e-1 0.046 4.1e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.029 4.5e-1 -0.124 2.9e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells 0.028 4.5e-1 0.121 2.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.443 0 -0.349 0.01 50 Click to see details
STAD 0.434 0.01 0.388 0.01 32 Click to see details
THCA 0.251 0.03 0.218 0.05 59 Click to see details
CHOL 0.62 0.04 0.400 0.14 9 Click to see details
ESCA 0.478 0.07 0.473 0.07 11 Click to see details
HNSC -0.208 0.09 -0.223 0.08 42 Click to see details
LUAD 0.346 0.14 0.385 0.11 12 Click to see details
PCPG 0.91 0.14 1.000 0.5 3 Click to see details
LIHC 0.151 0.15 0.049 0.37 49 Click to see details
KICH 0.205 0.16 0.234 0.13 25 Click to see details
BRCA 0.106 0.17 0.125 0.13 84 Click to see details
BLCA 0.216 0.19 0.137 0.29 18 Click to see details
LUSC 0.082 0.31 0.155 0.18 38 Click to see details
UCEC 0.099 0.34 0.151 0.27 19 Click to see details
KIRP -0.067 0.36 -0.048 0.4 32 Click to see details
CESC 0.374 0.38 0.500 0.33 3 Click to see details
PAAD -0.11 0.45 -0.400 0.3 4 Click to see details
COAD -0.039 0.48 -0.200 0.37 5 Click to see details
KIRC -0.002 0.49 0.005 0.48 68 Click to see details
KIRC -0.002 0.49 0.005 0.48 68 Click to see details
KIRC -0.002 0.49 0.005 0.48 68 Click to see details
451 hsa-miR-424-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000653 CCNF cyclin F 2 1
MIRT000654 CDC14A cell division cycle 14A 2 1
MIRT000655 CDC25A cell division cycle 25A 4 3
MIRT000656 CHEK1 checkpoint kinase 1 5 4
MIRT000657 KIF23 kinesin family member 23 4 7
MIRT000658 ATF6 activating transcription factor 6 2 1
MIRT000659 WEE1 WEE1 G2 checkpoint kinase 6 7
MIRT000660 ANLN anillin actin binding protein 2 1
MIRT000696 PLAG1 PLAG1 zinc finger 6 10
MIRT000936 CCNE1 cyclin E1 6 7
MIRT000937 CCND3 cyclin D3 4 1
MIRT000938 CDK6 cyclin dependent kinase 6 6 3
MIRT000941 CCND1 cyclin D1 6 4
MIRT003225 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 1
MIRT003226 MAP2K1 mitogen-activated protein kinase kinase 1 4 2
MIRT003227 PIAS1 protein inhibitor of activated STAT 1 2 1
MIRT003228 FGFR1 fibroblast growth factor receptor 1 5 3
MIRT003928 NFIA nuclear factor I A 3 2
MIRT005886 MYB MYB proto-oncogene, transcription factor 3 2
MIRT005887 SIAH1 siah E3 ubiquitin protein ligase 1 3 1
MIRT005926 HIF1A hypoxia inducible factor 1 alpha subunit 5 1
MIRT005927 CUL2 cullin 2 5 1
MIRT005928 SPI1 Spi-1 proto-oncogene 5 1
MIRT042434 CCIN calicin 1 1
MIRT042435 TTC39A tetratricopeptide repeat domain 39A 1 1
MIRT042436 TMF1 TATA element modulatory factor 1 1 1
MIRT042437 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT042438 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT042439 IARS isoleucyl-tRNA synthetase 1 1
MIRT042440 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT042441 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 3
MIRT042442 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT042443 MAGED1 MAGE family member D1 1 1
MIRT042444 CNIH4 cornichon family AMPA receptor auxiliary protein 4 1 1
MIRT042445 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT042446 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT042447 BAZ2B bromodomain adjacent to zinc finger domain 2B 1 1
MIRT042448 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT042449 ANKRD17 ankyrin repeat domain 17 1 1
MIRT042450 RBM4B RNA binding motif protein 4B 1 1
MIRT042451 LAMTOR4 late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 1 1
MIRT042452 TRAP1 TNF receptor associated protein 1 1 1
MIRT042453 SCOC short coiled-coil protein 1 1
MIRT042454 SACS sacsin molecular chaperone 1 1
MIRT042455 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT042456 TBPL1 TATA-box binding protein like 1 2 3
MIRT042457 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT042458 GTF2A1 general transcription factor IIA subunit 1 1 1
MIRT053106 FASN fatty acid synthase 4 5
MIRT053149 SOCS6 suppressor of cytokine signaling 6 2 1
MIRT053379 CDX2 caudal type homeobox 2 3 1
MIRT055427 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT055818 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057518 CEP55 centrosomal protein 55 2 8
MIRT057737 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT061008 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061250 AMOTL1 angiomotin like 1 2 12
MIRT064689 CCND2 cyclin D2 2 4
MIRT065719 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066297 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066316 USP15 ubiquitin specific peptidase 15 2 2
MIRT071212 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072826 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 4
MIRT074534 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075256 SNTB2 syntrophin beta 2 2 4
MIRT075278 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075897 C16ORF72 chromosome 16 open reading frame 72 2 6
MIRT076796 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT078287 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079659 NAPG NSF attachment protein gamma 2 12
MIRT080016 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082989 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083270 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084466 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT086013 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087428 ZNRF3 zinc and ring finger 3 2 2
MIRT087559 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT089112 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089212 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT091674 RARB retinoic acid receptor beta 2 6
MIRT093688 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096239 CANX calnexin 2 2
MIRT100211 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100369 HSPA1B heat shock protein family A (Hsp70) member 1B 2 6
MIRT100572 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100741 VEGFA vascular endothelial growth factor A 2 12
MIRT100900 CD2AP CD2 associated protein 2 2
MIRT102441 CALU calumenin 2 2
MIRT102636 UBN2 ubinuclein 2 2 10
MIRT102974 EN2 engrailed homeobox 2 2 6
MIRT103097 MAFK MAF bZIP transcription factor K 2 4
MIRT103859 FOXK1 forkhead box K1 2 2
MIRT104020 USP42 ubiquitin specific peptidase 42 2 6
MIRT104236 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106300 ZFHX4 zinc finger homeobox 4 2 6
MIRT106737 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT107222 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT107689 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT109245 ZNF275 zinc finger protein 275 2 2
MIRT110057 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 5 7
MIRT112976 LUZP1 leucine zipper protein 1 2 6
MIRT114929 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117660 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120684 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127740 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT133776 SKI SKI proto-oncogene 2 2
MIRT140152 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142247 DCTN5 dynactin subunit 5 2 8
MIRT152287 TNFSF9 TNF superfamily member 9 2 2
MIRT154054 RASSF2 Ras association domain family member 2 2 2
MIRT156468 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158533 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT165183 GRAMD3 GRAM domain containing 2B 2 2
MIRT165904 CREBRF CREB3 regulatory factor 2 2
MIRT175237 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT179014 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180914 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186375 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189764 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189965 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190188 GPR180 G protein-coupled receptor 180 2 6
MIRT191460 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191629 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194242 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194909 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196457 TAOK1 TAO kinase 1 2 2
MIRT201460 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204597 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204628 MOB4 MOB family member 4, phocein 2 8
MIRT204744 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206023 NUP50 nucleoporin 50 2 6
MIRT211201 FGF2 fibroblast growth factor 2 5 5
MIRT211317 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212611 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT223695 FZD6 frizzled class receptor 6 2 6
MIRT224969 BAG4 BCL2 associated athanogene 4 2 2
MIRT229350 ZNF449 zinc finger protein 449 2 2
MIRT229864 YIPF6 Yip1 domain family member 6 2 2
MIRT234346 MSL1 male specific lethal 1 homolog 2 8
MIRT247241 ELK4 ELK4, ETS transcription factor 2 4
MIRT247371 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248769 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249453 ZNF691 zinc finger protein 691 2 4
MIRT251497 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255339 SRPRB SRP receptor beta subunit 2 4
MIRT256311 CDC42SE2 CDC42 small effector 2 2 2
MIRT258414 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265059 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT267532 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270556 SETD1B SET domain containing 1B 2 2
MIRT273669 HOXC8 homeobox C8 2 2
MIRT274745 RAB3IP RAB3A interacting protein 2 2
MIRT277509 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282538 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT289635 CBX2 chromobox 2 2 2
MIRT294287 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295815 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297782 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300110 STRADB STE20-related kinase adaptor beta 2 2
MIRT300998 MTMR3 myotubularin related protein 3 2 2
MIRT302619 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302829 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307145 CTDSPL CTD small phosphatase like 2 4
MIRT313679 ITGA2 integrin subunit alpha 2 2 2
MIRT314055 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317725 PPIL1 peptidylprolyl isomerase like 1 2 6
MIRT319335 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320631 ZNRF2 zinc and ring finger 2 2 2
MIRT326306 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327967 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT367269 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT438750 PTCH1 patched 1 1 1
MIRT443811 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446504 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447774 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448443 TLL1 tolloid like 1 2 2
MIRT449186 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451835 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453284 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453750 CSNK1E casein kinase 1 epsilon 2 2
MIRT454966 TPM2 tropomyosin 2 2 2
MIRT456863 ZNF460 zinc finger protein 460 2 10
MIRT460220 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460434 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461560 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463168 ZNF367 zinc finger protein 367 2 10
MIRT464666 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464752 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 2
MIRT465167 TSC22D2 TSC22 domain family member 2 2 2
MIRT465566 TOB2 transducer of ERBB2, 2 2 2
MIRT465930 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466009 TMEM189 transmembrane protein 189 2 8
MIRT466294 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466433 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466920 STK38 serine/threonine kinase 38 2 10
MIRT466998 SSRP1 structure specific recognition protein 1 2 4
MIRT468055 SIK1 salt inducible kinase 1 2 2
MIRT468147 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468673 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469086 RNF168 ring finger protein 168 2 2
MIRT469411 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471035 PISD phosphatidylserine decarboxylase 2 10
MIRT471492 PDE4D phosphodiesterase 4D 2 4
MIRT471952 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472269 NFIC nuclear factor I C 2 2
MIRT472661 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474314 LAMC1 laminin subunit gamma 1 2 2
MIRT474829 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475065 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475119 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475535 HOXA3 homeobox A3 4 8
MIRT475716 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475841 HDGF heparin binding growth factor 2 4
MIRT476256 GNB1 G protein subunit beta 1 2 6
MIRT476273 GNAL G protein subunit alpha L 2 6
MIRT476696 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477561 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477845 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478908 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479989 CARD10 caspase recruitment domain family member 10 2 2
MIRT481185 AVL9 AVL9 cell migration associated 2 6
MIRT482117 AKT3 AKT serine/threonine kinase 3 5 4
MIRT482373 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482553 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482578 ABHD2 abhydrolase domain containing 2 2 2
MIRT484774 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485216 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487390 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492711 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494353 CASKIN1 CASK interacting protein 1 2 2
MIRT495143 ZNRF1 zinc and ring finger 1 2 2
MIRT496015 CD180 CD180 molecule 2 2
MIRT497772 KIAA0895 KIAA0895 2 2
MIRT498980 ORC4 origin recognition complex subunit 4 2 8
MIRT499452 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499616 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500093 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500324 ZNF622 zinc finger protein 622 2 8
MIRT500422 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500576 USP53 ubiquitin specific peptidase 53 2 2
MIRT500864 SYPL1 synaptophysin like 1 2 8
MIRT500935 SRPR SRP receptor alpha subunit 2 6
MIRT500949 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501088 SMAD7 SMAD family member 7 5 9
MIRT501502 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502036 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502148 KIF5B kinesin family member 5B 2 8
MIRT502498 FAM122B family with sequence similarity 122B 2 8
MIRT502571 E2F7 E2F transcription factor 7 2 10
MIRT502646 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502919 CDCA4 cell division cycle associated 4 2 8
MIRT502948 CDC37L1 cell division cycle 37 like 1 2 8
MIRT503143 ATG9A autophagy related 9A 2 6
MIRT504334 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504536 ZNF620 zinc finger protein 620 2 6
MIRT504852 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505114 YTHDC1 YTH domain containing 1 2 6
MIRT505346 TMEM245 transmembrane protein 245 2 6
MIRT505396 TMEM100 transmembrane protein 100 2 2
MIRT505502 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505546 SNX16 sorting nexin 16 2 6
MIRT505690 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505908 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505926 RCAN3 RCAN family member 3 2 4
MIRT506108 PPIG peptidylprolyl isomerase G 2 6
MIRT506139 PLRG1 pleiotropic regulator 1 2 4
MIRT506192 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506486 MYO5A myosin VA 2 6
MIRT506999 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507819 CDK1 cyclin dependent kinase 1 2 6
MIRT507850 CCNE2 cyclin E2 2 6
MIRT507882 CBX6 chromobox 6 2 2
MIRT508036 AXIN2 axin 2 2 6
MIRT508641 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509364 DMPK DM1 protein kinase 2 11
MIRT509690 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510043 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511845 GPATCH8 G-patch domain containing 8 2 4
MIRT512285 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT512642 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT513856 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514022 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 4
MIRT514043 ATG14 autophagy related 14 2 2
MIRT518091 TRIM35 tripartite motif containing 35 2 2
MIRT518530 FLCN folliculin 2 6
MIRT518994 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521056 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521203 SBNO1 strawberry notch homolog 1 2 6
MIRT521814 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522100 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT522775 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537817 EFNB2 ephrin B2 2 4
MIRT539899 RPL14 ribosomal protein L14 2 4
MIRT540843 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541216 HOXA10 homeobox A10 2 2
MIRT541434 CBX4 chromobox 4 2 2
MIRT542808 PHC3 polyhomeotic homolog 3 2 2
MIRT542836 PDCD1 programmed cell death 1 2 7
MIRT543059 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543079 APP amyloid beta precursor protein 2 2
MIRT543306 ZNF585B zinc finger protein 585B 2 2
MIRT543408 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543525 PRSS21 protease, serine 21 2 2
MIRT543797 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543835 GSG1 germ cell associated 1 2 2
MIRT544571 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544589 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544912 CLSPN claspin 2 2
MIRT544965 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545186 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545347 CCDC83 coiled-coil domain containing 83 2 2
MIRT545682 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545959 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT546114 USP48 ubiquitin specific peptidase 48 2 4
MIRT546610 SALL1 spalt like transcription factor 1 2 4
MIRT546623 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546639 RTN4 reticulon 4 2 2
MIRT547132 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547234 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547306 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT547411 MKX mohawk homeobox 2 2
MIRT547462 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547549 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547663 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547700 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547970 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT547996 HCFC2 host cell factor C2 2 4
MIRT548015 GRB2 growth factor receptor bound protein 2 2 4
MIRT548223 FKBP1A FK506 binding protein 1A 2 2
MIRT548273 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548729 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548806 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548949 CDK17 cyclin dependent kinase 17 2 2
MIRT549074 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549121 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549276 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT549390 AMOT angiomotin 2 2
MIRT550402 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550466 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550615 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550823 FAM229B family with sequence similarity 229 member B 2 2
MIRT551379 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551617 ZNF267 zinc finger protein 267 2 2
MIRT551737 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552035 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552344 ZNF704 zinc finger protein 704 2 2
MIRT552749 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553439 TPM3 tropomyosin 3 2 2
MIRT553561 TMEM161B transmembrane protein 161B 2 2
MIRT553618 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553772 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553809 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554700 RNF149 ring finger protein 149 2 2
MIRT554962 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555032 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555142 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555225 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555275 PRDM4 PR/SET domain 4 2 2
MIRT555432 PPAP2B phospholipid phosphatase 3 2 2
MIRT556387 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556855 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557281 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557480 GPR27 G protein-coupled receptor 27 2 4
MIRT558037 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558507 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558589 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558662 CNKSR3 CNKSR family member 3 2 2
MIRT559011 CA8 carbonic anhydrase 8 2 2
MIRT559158 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559531 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT560852 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561149 KRT33B keratin 33B 2 2
MIRT561400 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561874 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562027 LANCL1 LanC like 1 2 2
MIRT562201 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562877 KIAA1456 KIAA1456 2 2
MIRT563086 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563503 DLGAP3 DLG associated protein 3 2 2
MIRT563701 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563845 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563896 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564332 CCNT1 cyclin T1 2 2
MIRT564478 ZNF391 zinc finger protein 391 2 2
MIRT564552 CCDC80 coiled-coil domain containing 80 2 2
MIRT564836 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564950 XKR7 XK related 7 2 2
MIRT564989 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565044 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565401 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566120 RASEF RAS and EF-hand domain containing 2 2
MIRT566650 NCKAP1 NCK associated protein 1 2 2
MIRT566831 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567021 KLHL15 kelch like family member 15 2 2
MIRT567446 GNG12 G protein subunit gamma 12 2 2
MIRT567477 FZD9 frizzled class receptor 9 2 2
MIRT568021 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568142 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568474 ARMC12 armadillo repeat containing 12 2 2
MIRT568574 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568625 ACVR2A activin A receptor type 2A 5 3
MIRT570466 TLK1 tousled like kinase 1 2 2
MIRT571119 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571283 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571428 RIF1 replication timing regulatory factor 1 2 2
MIRT571660 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571828 PHF19 PHD finger protein 19 2 2
MIRT571928 LSM11 LSM11, U7 small nuclear RNA associated 2 2
MIRT574057 PROSC pyridoxal phosphate binding protein 2 2
MIRT574202 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574539 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574594 N4BP1 NEDD4 binding protein 1 2 2
MIRT575882 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575924 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576099 Pdcd1 programmed cell death 1 2 5
MIRT576591 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614698 TRAK1 trafficking kinesin protein 1 2 2
MIRT616467 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618896 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621498 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640538 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645510 BSPRY B-box and SPRY domain containing 2 2
MIRT646595 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648784 KLHL40 kelch like family member 40 2 2
MIRT655812 NOTCH2 notch 2 2 2
MIRT658793 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659256 CUL3 cullin 3 2 2
MIRT680982 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682285 RS1 retinoschisin 1 2 2
MIRT682514 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691709 FLOT2 flotillin 2 2 2
MIRT693930 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701506 NEGR1 neuronal growth regulator 1 2 2
MIRT702092 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702877 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713419 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714438 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716432 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717461 ADORA3 adenosine A3 receptor 2 2
MIRT720149 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725132 SYNRG synergin gamma 2 2
MIRT731524 SOCS2 suppressor of cytokine signaling 2 1 1
MIRT731954 KDM5B lysine demethylase 5B 1 1
MIRT732455 LINC00922 long intergenic non-protein coding RNA 922 2 0
MIRT734001 BFAR bifunctional apoptosis regulator 3 0
MIRT734203 APLNR apelin receptor 3 0
MIRT734275 APLN apelin 3 0
MIRT735229 KCNQ1OT1 KCNQ1 opposite strand/antisense transcript 1 (non-protein coding) 0 0
MIRT737161 LINC00324 long intergenic non-protein coding RNA 324 1 0
MIRT737429 CADM1 cell adhesion molecule 1 2 0
MIRT756449 NUAK1 NUAK family kinase 1 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-424 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-424 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-424 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-424 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-424 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-424 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-424 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-424 Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 down-regulated
miR-424 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-424 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC-7901)
hsa-mir-424 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-424 Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-424 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-424 Methotrexate 126941 NSC740 approved resistant cell line (W1)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-424 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-424 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-424 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-424 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (SGC-7901)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-424-5p (-)-huprine y 54608866 NSC720262 resistant
hsa-miR-424-5p (-)7,8-dihydrocalanolide a 383107 NSC682400 sensitive
hsa-miR-424-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 resistant
hsa-miR-424-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 resistant
hsa-miR-424-5p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-424-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-424-5p (5R,5aS)-5-[2-(dimethylamino)ethoxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 371049 NSC644945 sensitive
hsa-miR-424-5p (5s,5as)-5-[3-(dimethylamino)propylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 375034 NSC653860 sensitive
hsa-miR-424-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 resistant
hsa-miR-424-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-fluorophenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351427 NSC670226 resistant
hsa-miR-424-5p (z)-3-iodo-1,2-diphenyl-2-propen-1-one 5468683 NSC674454 resistant
hsa-miR-424-5p [1-[(2-bromo-5-hydroxy-4-methoxyphenyl)methyl]spiro[1,3,4,5,7,8-hexahydroisoquinoline-6,2'-1,3-dioxolane]-2-yl]-cyclobutylmethanone 401792 NSC715522 resistant
hsa-miR-424-5p [2-[[3-(3-aminopropoxy)naphthalene-2-carbonyl]amino]-5-chlorophenyl] 3-(3-aminopropoxy)naphthalene-2-carboxylate;hydrochloride 54613723 NSC751300 resistant
hsa-miR-424-5p [4-fluoro-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] butanoate 380992 NSC666869 sensitive
hsa-miR-424-5p 1-(2-hydroxybenzoyl)-3-methyl-4-(4-methoxybenzylidene)-1h-pyrazole-5(4h)-one 5351408 NSC652174 sensitive
hsa-miR-424-5p 1-(5,8-dimethyl-6-nitro-9h-carbazol-3-yl)ethanone hydrazone 6078917 NSC652561 sensitive
hsa-miR-424-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-424-5p 1-[(z)-(5-chloro-2-hydroxyphenyl)methylideneamino]-3-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]urea 135408530 NSC48238 resistant
hsa-miR-424-5p 1-[5-[(e)-2-[4-(dimethylamino)phenyl]ethenyl]-6-methyl-1,2,4-triazin-3-yl]-6-hydroxy-3-phenyl-2-sulfanylidenepyrimidin-4-one 6412312 NSC698031 resistant
hsa-miR-424-5p 1-[8-(3-methoxyphenyl)-6,7-dimethyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]pyrrolidine 382365 NSC669884 resistant
hsa-miR-424-5p 10,11-methylenedioxycamptothecin 72403 NSC634724 sensitive
hsa-miR-424-5p 15-[2-(dimethylamino)ethyl]-10-[2-(2-hydroxyethylamino)ethylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392057 NSC691849 sensitive
hsa-miR-424-5p 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethyl-methylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione 392571 NSC693118 sensitive
hsa-miR-424-5p 2-(2-ethyl-6-propan-2-ylanilino)-3-(4-methylpyridin-1-ium-1-yl)naphthalene-1,4-dione;perchlorate 24202023 NSC618659 sensitive
hsa-miR-424-5p 2-(dipentylamino)-1-(1,2,3,4-tetrahydrophenanthren-9-yl)ethanol;hydrochloride 24181846 NSC62485 resistant
hsa-miR-424-5p 2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-n-[2-[[4-[2-[[2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-2-(sulfanylmethylamino)acetyl]amino]ethylamino]-5,8-dihydroxy-9,10-dioxoanthracen- 438971 NSC692228 sensitive
hsa-miR-424-5p 2-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]pentanedioic acid 135402053 NSC327182 sensitive
hsa-miR-424-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 sensitive
hsa-miR-424-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-424-5p 2-[3-[1-(4-chlorophenyl)-1-methyl-3-oxo-isoindolin-2-yl]propyl]isoindoline-1,3-dione 395648 NSC700430 resistant
hsa-miR-424-5p 2-amino-6-(benzylamino)-4-(2-chlorophenyl)pyridine-3,5-dicarbonitrile 24205132 NSC734396 sensitive
hsa-miR-424-5p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 resistant
hsa-miR-424-5p 2-chloro-3-phenoxy-1,4-naphthoquinone NSC1507 resistant
hsa-miR-424-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-424-5p 2-methoxy-5,7,8,13,13a,14-hexahydroisoquino[3,2-b][3]benzazepine 392606 NSC693146 resistant
hsa-miR-424-5p 2-phenyl-3a,3b,4,5,6,7,8,8a,13,13b-decahydro-1h-cyclohepta[c]pyrrolo[3,4-a]carbazole-1,3(2h)-dione 362439 NSC626388 sensitive
hsa-miR-424-5p 2-thienyl-[3-(thiophene-2-carbonyl)-2-thioxo-imidazolidin-1-yl]methanone 396758 NSC703468 sensitive
hsa-miR-424-5p 2,2,2-trifluoro-N-[3-[naphthalen-2-ylmethyl-[4-[naphthalen-2-ylmethyl-[3-[(2,2,2-trifluoroacetyl)amino]propyl]amino]butyl]amino]propyl]acetamide 389638 NSC685981 resistant
hsa-miR-424-5p 2,4-quinazolinediamine, 6,6'-thiobis- 393413 NSC695267 sensitive
hsa-miR-424-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-424-5p 20-[3-(1,4-diazepan-1-yl)propyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaene-11,19-dione;hydrochloride 45027855 NSC728319 sensitive
hsa-miR-424-5p 3-[(4-chlorophenyl)methyl]-4-[(e)-(3-methoxyphenyl)methylideneamino]-1h-1,2,4-triazol-5-one 9556356 NSC698065 sensitive
hsa-miR-424-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-424-5p 3-amino-N-(4-benzylphenyl)-5-chloroindazole-1-carboxamide 51033073 NSC749550 resistant
hsa-miR-424-5p 4'-(9-acridinylamino)sulfanilanilide, monohydrochloride 148802 NSC140701 sensitive
hsa-miR-424-5p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 resistant
hsa-miR-424-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(4-fluorophenyl)benzamide 1194957 NSC732830 sensitive
hsa-miR-424-5p 4-[[3-[(4-carbamimidoylphenoxy)methyl]phenyl]methoxy]benzenecarboximidamide;hydrochloride 24203365 NSC727667 sensitive
hsa-miR-424-5p 4-[6-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]hexyl]benzenesulfonyl fluoride;ethanesulfonic acid 280526 NSC132279 sensitive
hsa-miR-424-5p 4-amino-8-chloro-2-(4-methoxyphenyl)iminopyrimido[2,1-b][1,3]benzothiazole-3-carbonitrile 45029232 NSC745677 resistant
hsa-miR-424-5p 4-n-(7-chloro-3-phenylquinolin-4-yl)-1-n,1-n-diethylpentane-1,4-diamine;hydroiodide 24182056 NSC13477 resistant
hsa-miR-424-5p 4-n-(7-chloroquinolin-4-yl)-1-n-cyclohexylcyclohexane-1,4-diamine NSC3618 resistant
hsa-miR-424-5p 5-(3-phenyl-3-oxo-1-propynyl)pyrimidine-2,4(1h,3h)-dione 359098 NSC619674 sensitive
hsa-miR-424-5p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-424-5p 5-[(E)-2-(5-ethyl-1-methylpyridin-1-ium-2-yl)ethenyl]quinolin-8-ol;iodide 135534376 NSC79543 sensitive
hsa-miR-424-5p 5-amino-2-(4-chloroanilino)-1,3-thiazole-4-carbonitrile 367981 NSC638199 sensitive
hsa-miR-424-5p 5-phenyl-2,3-bis(2-thienyl)thiophene 395510 NSC700200 resistant
hsa-miR-424-5p 6-[2-[2-[2-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]ethylamino]ethylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027880 NSC730870 sensitive
hsa-miR-424-5p 6-[2-[3-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]propylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027847 NSC728087 sensitive
hsa-miR-424-5p 6-[3-[(4-fluorophenyl)methoxy]phenyl]-5-(2-methylsulfonylpyrimidin-4-yl)imidazo[2,1-b][1,3]thiazole 155811287 NSC763232 resistant
hsa-miR-424-5p 6-chloro-1-[2-[ethyl-(2-hydroxy-2-methylpropyl)amino]ethylamino]-4-methylthioxanthen-9-one;hydrochloride 24182355 NSC15795 resistant
hsa-miR-424-5p 6-chloro-9-[4-(4-methylphenoxy)-5-[(4-methylphenoxy)methyl]oxolan-2-yl]purine 389530 NSC685827 resistant
hsa-miR-424-5p 7-phenyl-5h-pyrazolo[3,4-e][1,2,4]triazin-3-ylamine 6399307 NSC629487 sensitive
hsa-miR-424-5p 7h-5,6-dithioleno[4,3-d]uracil 388876 NSC684074 sensitive
hsa-miR-424-5p 9,10-anthracenedione, 1-[(oxiranylmethyl)amino]- 384119 NSC673348 sensitive
hsa-miR-424-5p 9.beta.-d-arabinofuranosyl-2-chloroadenine 235481 NSC76356 sensitive
hsa-miR-424-5p Acetylmarinobufogenin 282302 NSC135687 sensitive
hsa-miR-424-5p Aclarubicin 308141 NSC208734 sensitive
hsa-miR-424-5p Acovenoside b 272418 NSC116789 sensitive
hsa-miR-424-5p Anthraquinone, 1-hydroxy-4-[p-(2-hydroxyethyl)anilino]- 291365 NSC156565 resistant
hsa-miR-424-5p Arq monoacetate 385441 NSC676676 sensitive
hsa-miR-424-5p Azane;dichloroplatinum;2-(3,4-dimethoxyphenyl)ethanamine 498557 NSC631304 sensitive
hsa-miR-424-5p Azq 42616 NSC182986 sensitive
hsa-miR-424-5p Bafilomycin deriv 5385089 NSC381866 resistant
hsa-miR-424-5p Benzene, 1,1'-(1,2-ethanediyl)bis[2,5-dimethoxy- 297389 NSC168516 resistant
hsa-miR-424-5p Betuletol 5459196 NSC641548 sensitive
hsa-miR-424-5p Bialamicol 10304 NSC6386 resistant
hsa-miR-424-5p Biantrazole 54607781 NSC357885 sensitive
hsa-miR-424-5p Bn-2629 393111 NSC694501 sensitive
hsa-miR-424-5p Calactin 30100 NSC650471 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin 24360 NSC94600 sensitive
hsa-miR-424-5p Camptothecin 24360 NSC94600 sensitive
hsa-miR-424-5p Cardenolide 2 388098 NSC682561 sensitive
hsa-miR-424-5p Ci-921: amsacrine derivative 157348 NSC343499 sensitive
hsa-miR-424-5p Cladribine 1546 NSC105014 sensitive
hsa-miR-424-5p Digitoxigenin glycoside NSC267713 sensitive
hsa-miR-424-5p Digoxin 2724385 NSC95100 approved sensitive
hsa-miR-424-5p Dimethyl (Z)-2-(2,3,4,6,8-pentamethylazulen-1-yl)but-2-enedioate 5468314 NSC668419 resistant
hsa-miR-424-5p Echujetin 274159 NSC407806 sensitive
hsa-miR-424-5p Fagaronine chloride 40304 NSC157995 sensitive
hsa-miR-424-5p Faradiol 397486 NSC705534 sensitive
hsa-miR-424-5p Ferric-taxol 54612932 NSC749908 resistant
hsa-miR-424-5p Fludarabine 657237 NSC118218 approved sensitive
hsa-miR-424-5p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 resistant
hsa-miR-424-5p Gw876790x 25023715 NSC756413 resistant
hsa-miR-424-5p Homohalichondrin b 6711269 NSC609394 resistant
hsa-miR-424-5p Hopeaphenol 495605 NSC661748 resistant
hsa-miR-424-5p Irinotecan 60838 NSC728073 approved sensitive
hsa-miR-424-5p Irinotecan 60838 NSC728073 approved sensitive
hsa-miR-424-5p Isopinnatal 390665 NSC688277 sensitive
hsa-miR-424-5p Lmp-400 11533060 NSC724998 sensitive
hsa-miR-424-5p Lunatin 5351204 NSC89671 resistant
hsa-miR-424-5p M-amsa 148674 NSC154948 sensitive
hsa-miR-424-5p Melphalan 460612 NSC8806 approved sensitive
hsa-miR-424-5p Merophan 9571 NSC57199 sensitive
hsa-miR-424-5p Methyl (2s)-2-[[4-[[[(e)-2-methyl-3-phenylprop-2-enoyl]amino]methyl]benzoyl]amino]-4-methylsulfanylbutanoate 5470461 NSC702106 resistant
hsa-miR-424-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-424-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-424-5p N-((3-benzoyl-2-thioxo-1-imidazolidinyl)carbothioyl)-n-phenylbenzamide 396960 NSC704180 sensitive
hsa-miR-424-5p N-(3,5-dimethoxybenzyl)-4-methoxyaniline 364713 NSC631371 resistant
hsa-miR-424-5p N-[(5s,8ar,9r)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]-3-cyanobenzamide 369926 NSC642293 sensitive
hsa-miR-424-5p N-[4-[[[2-(4-chloroanilino)pyridine-3-carbonyl]amino]sulfamoyl]phenyl]acetamide 16126694 NSC737147 resistant
hsa-miR-424-5p N-[bis(aziridin-1-yl)phosphoryl]adamantan-1-amine 64376 NSC166199 sensitive
hsa-miR-424-5p N,n-bis{[(4-chlorophenyl)sulfanyl]methyl}-4-methylaniline 248767 NSC66211 sensitive
hsa-miR-424-5p Navan 941650 NSC108165 resistant
hsa-miR-424-5p Ncs-665564 380161 NSC665564 sensitive
hsa-miR-424-5p Neriifolin 276293 NSC123976 sensitive
hsa-miR-424-5p NSC623283 NSC623283 sensitive
hsa-miR-424-5p NSC763857 NSC763857 resistant
hsa-miR-424-5p Oxanthrazole 59916 NSC349174 sensitive
hsa-miR-424-5p Pcnu 26328 NSC95466 sensitive
hsa-miR-424-5p Phenylbenzophenone 407452 NSC5639 resistant
hsa-miR-424-5p S-(6-oxo-1,3,5-triphenyl-2-thioxo-1,2,3,6-tetrahydro-4-pyrimidinyl) 4-methoxybenzenecarbothioate 383063 NSC671107 sensitive
hsa-miR-424-5p S-(dimethylarsino)-3-mercapto-1,2-propanediol 406475 NSC724596 sensitive
hsa-miR-424-5p Stk716556 342450 NSC379399 resistant
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved resistant
hsa-miR-424-5p Tetramethyl (1R,5R,6S,9S)-3-(4-chlorobenzoyl)oxy-5-hydroxy-7-[2-(trifluoromethyl)phenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 24204894 NSC733348 sensitive
hsa-miR-424-5p Thevetin 5458241 NSC123979 sensitive
hsa-miR-424-5p Toddalin 5351594 NSC76023 resistant
hsa-miR-424-5p Topotecan 60699 NSC609699 approved sensitive
hsa-miR-424-5p Topotecan 60699 NSC609699 approved sensitive
hsa-miR-424-5p Venenatine 272417 NSC116787 sensitive
hsa-miR-424-5p Yoshi 864 18949 NSC102627 sensitive
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Docetaxel 148124 NSC628503 approved resistant High Non-Small Cell Lung Cancer cell line (SPC-A1)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant High Leukemia cell line (K562)
hsa-miR-424-5p 10-Hydroxycamptothecin 97226 NSC107124 sensitive High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SUIT-2, CAPAN-1)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Germ Cell Tumor cell line (NTERA-2)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive Low Epidermoid Carcinoma cell line (KB-3-1, KB-CP.5, KB-CP20)
hsa-miR-424-5p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-424-5p Etoposide 36462 NSC141540 approved resistant Low melanoma tissue and cell line (A375)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant Low Colorectal Cancer tissue and cell line (HCT-116)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-424-5p Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT-8)
hsa-miR-424-5p Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-424-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-424-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR20
hsa-miR-424-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-424-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-424-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-424-5p Trail sensitive Low Acute Myeloid Leukemia tissue and cell line (HL-60, K562, NB4)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (ID8)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer tissue and cell line
hsa-miR-424-5p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-424-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant Low Bladder Cancer cell line (5637, J82, BIU87, T24)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Bladder Cancer cell line (CDDP-R-BOY, CDDP-R-T24)
hsa-miR-424-5p Taxol 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-424-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer cell line (HT-29)
hsa-miR-424-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-424-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKVO3ip1)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-424-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-424-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-424-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-424-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-424-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR1)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-424-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-424-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-424-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission