miRTarBase - #MIRT000656


—
pre-miRNA Information
pre-miRNA hsa-mir-424   
Genomic Coordinates chrX: 134546614 - 134546711
Synonyms MIR322, MIRN424, hsa-mir-424, miRNA424, MIR424
Description Homo sapiens miR-424 stem-loop
Comment This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells . The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-424-5p
Sequence 11| CAGCAGCAAUUCAUGUUUUGAA |32
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 X - 134546697 29233923 MiREDiBase
A-to-I 8 X - 134546694 17604727 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs888095819 1 dbSNP
rs1486362336 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CHEK1   
Synonyms CHK1
Description checkpoint kinase 1
Transcript NM_001114122   
Other Transcripts NM_001114121 , NM_001274   
Expression
Putative miRNA Targets on CHEK1
3'UTR of CHEK1
(miRNA target sites are highlighted)		 
>CHEK1|NM_001114122|3'UTR
   1 TCGGACCATCGGCTCTGGGGAATCCTGGTGAATATAGTGCTGCTATGTTGACATTATTCTTCCTAGAGAAGATTATCCTG
  81 TCCTGCAAACTGCAAATAGTAGTTCCTGAAGTGTTCACTTCCCTGTTTATCCAAACATCTTCCAATTTATTTTGTTTGTT
 161 CGGCATACAAATAATACCTATATCTTAATTGTAAGCAAAACTTTGGGGAAAGGATGAATAGAATTCATTTGATTATTTCT
 241 TCATGTGTGTTTAGTATCTGAATTTGAAACTCATCTGGTGGAAACCAAGTTTCAGGGGACATGAGTTTTCCAGCTTTTAT
 321 ACACACGTATCTCATTTTTATCAAAACATTTTGTTTAATTCAAAAAGTACATATTCCATGTTGATTTAATTCTAAGATGA
 401 ACCAATAAAGACATAATTCTTGTGACTTTTGGACAGTAGATTTATCAGTCTGTGAAGCGAAGCCAGCTTCAAAACATATC
 481 CCCAAGATTTGTACTTATATTTTCAAAAGGGCCTGGCCAGTTATATAAACCTGTTTTTGAATTATAATGATTAATTAAAA
 561 TTGCAAGTAGGTGTTTTTTCCAGTGTAGTTAGTAAAATACTTGTATTTTACAGTGTTGCATAAACTCTAGTGCTTAACTA
 641 ACTTTACTCTAAAAATTACTGTTGAACATCTTAAATATTTTTCTATATTTTCTACTTTCATAGCCATATTTTAACCTTTT
 721 CAACTTACTGGTGACCAAGCTTTTAGGTGATAAAGAATAAAAGAGGGAAGGGAAGAGTAAGGAAGCTATAAGAAAAATAG
 801 ATCTGATTCTTTGTTCCTTTACCTGTTAGACTTACAAAAAGTTTGTTTTTCTAATAAAATTTGTATCAACTTTGGGGCAT
 881 ATTAGGTTGAGGCCTTGGCTCCTGCCTGTAGTCCCAGCTACTTAGGAGGCTGAGAGAGGAGGATCGCGTGAACCTGGAAG
 961 TTTGAGGCTGTAGTGAGCTATGATTGCACCAGTGCACTCCAGCTTGGATGACAGAGTAAGACCCTACCTCTAATAAAAAT
1041 TTTTAAAATTGTAAAACATTATAAAATTAATCAGTTATTTTAATCTGAAGCCAAGAACATGTAGAATGTTATGATTAGAG
1121 TTTATCACATATTAATGTATACTGGCAAATTGTGTTACTGGAGTATACCCATAGGAGGAATAAATTCAAACCTGTTTTAT
1201 TTATTTGAACCTATTTACGGTATGCTTAAGAATTGAATCAGTATAAATTCTCAAATATGGGAGAAATTTTGTTCTTGAGA
1281 ATTATCTGAGTCATTAATATTTTTCAAAAACAGCTCTCACTGACTTGAACCTCTTCTGTAAGCTCTAACCTTTTACCTGC
1361 TTTACATTTCCACTTGAATGTCTAGTAGGCATCTCTTGACCAAAAACAGCTTTTGATTCCTGTTCTCCAACCTGTTCCTC
1441 TCCTAGTTTTCTCCATCTCAGAAATGTTACTTCCTCTGCAAAGTCTTTCCCTGACTTATCTAAAATAATAACCTCCTCTG
1521 TTTGCTGTGGGAATTTGTATAGAATGGTGGGAAAATTTCAAGTTTCATATTTGGATTAGCTCTGACATTTATTTATCTGA
1601 ACACTGGTAATTGCCTCAGTAAAGACACTGATAATAAGTACCTTTTAGAGTTATTTTAATCTTTAATGCTTTAATGTGTA
1681 GGAAGAGTATAGTGTCCTGTTTTGCACAGAAAGGCATTCTGTAAATAATAAGTTGCCTTAATTTTCCTGTAATGTTCATT
1761 ATATTGTTGTGGGAAGGTATTTACTCCTATTATTAAAAATAAAAATGTGTAAAATTTACTACCTGAAAAAAAAAAAAAAA
1841 AAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aaguUUUGUACUUAACGACGAc 5'
              :||:||  | ||||||| 
Target 5' tggtGAATAT--AGTGCTGCTa 3'
 26 - 45 154.00 -11.10
2 
miRNA  3' aagUUUUGU----ACUUAACGACGAc 5'
             ||||||    | :||| |||:| 
Target 5' ccaAAAACAGCTTTTGATTCCTGTTc 3'
 1400 - 1425 121.00 -6.30
3 
miRNA  3' aaGUUUUGU--ACUUA-------ACGACGac 5'
            :||||:|  || ||       ||:|||  
Target 5' agTAAAATACTTGTATTTTACAGTGTTGCat 3'
 591 - 621 118.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26575252 4 COSMIC
COSN26556998 13 COSMIC
COSN31600859 24 COSMIC
COSN30158938 26 COSMIC
COSN30179292 28 COSMIC
COSN30179290 29 COSMIC
COSN31613997 36 COSMIC
COSN26970625 58 COSMIC
COSN30460365 84 COSMIC
COSN31564405 127 COSMIC
COSN26671781 155 COSMIC
COSN31605508 162 COSMIC
COSN1128439 371 COSMIC
COSN20108960 376 COSMIC
COSN8736231 935 COSMIC
COSN25658961 1250 COSMIC
COSN27293215 1826 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1461079315 2 dbSNP
rs746474609 3 dbSNP
rs373998065 4 dbSNP
rs1032047014 5 dbSNP
rs780645711 8 dbSNP
rs747973479 11 dbSNP
rs748831574 12 dbSNP
rs749279821 14 dbSNP
rs1379752146 17 dbSNP
rs573744071 21 dbSNP
rs375887872 23 dbSNP
rs1453372998 25 dbSNP
rs1177289255 27 dbSNP
rs760632598 31 dbSNP
rs1296278154 34 dbSNP
rs764381233 37 dbSNP
rs776659228 44 dbSNP
rs1397834579 48 dbSNP
rs769434607 53 dbSNP
rs9282658 62 dbSNP
rs952890763 80 dbSNP
rs1383282654 86 dbSNP
rs1182803697 88 dbSNP
rs1285677542 90 dbSNP
rs1444978164 94 dbSNP
rs148807246 96 dbSNP
rs1202753914 98 dbSNP
rs1257439035 100 dbSNP
rs1260282320 103 dbSNP
rs868300535 112 dbSNP
rs1018498934 117 dbSNP
rs528501689 119 dbSNP
rs1313514770 124 dbSNP
rs976752552 128 dbSNP
rs547243050 132 dbSNP
rs373169887 137 dbSNP
rs1245738497 139 dbSNP
rs1185444197 141 dbSNP
rs566608597 144 dbSNP
rs967472656 162 dbSNP
rs1440480505 163 dbSNP
rs545410689 165 dbSNP
rs961200994 167 dbSNP
rs184393295 168 dbSNP
rs1288996773 181 dbSNP
rs925778195 182 dbSNP
rs1363674707 190 dbSNP
rs1433947874 227 dbSNP
rs1162802614 236 dbSNP
rs1358449867 251 dbSNP
rs1369909741 256 dbSNP
rs937212660 257 dbSNP
rs1303399900 270 dbSNP
rs530886491 273 dbSNP
rs1194524971 286 dbSNP
rs1401362524 295 dbSNP
rs1055553794 300 dbSNP
rs551019927 302 dbSNP
rs762754025 303 dbSNP
rs917138297 311 dbSNP
rs567785939 320 dbSNP
rs1377194929 325 dbSNP
rs142447277 327 dbSNP
rs1040471427 328 dbSNP
rs1036004503 330 dbSNP
rs546900560 335 dbSNP
rs1343032866 342 dbSNP
rs897513387 351 dbSNP
rs901934954 368 dbSNP
rs1405549905 372 dbSNP
rs141464656 372 dbSNP
rs113628894 374 dbSNP
rs199723723 374 dbSNP
rs3731480 374 dbSNP
rs201914580 377 dbSNP
rs1165988339 384 dbSNP
rs1461266556 393 dbSNP
rs994580634 400 dbSNP
rs1171589699 413 dbSNP
rs778999496 414 dbSNP
rs190098261 424 dbSNP
rs746593482 427 dbSNP
rs566817329 433 dbSNP
rs1257116570 434 dbSNP
rs892931725 435 dbSNP
rs1483176648 440 dbSNP
rs1339090288 441 dbSNP
rs1258323332 445 dbSNP
rs181773130 447 dbSNP
rs1198805611 460 dbSNP
rs1320960403 464 dbSNP
rs1011511727 470 dbSNP
rs1007031214 474 dbSNP
rs1022875058 476 dbSNP
rs557311968 477 dbSNP
rs867477773 481 dbSNP
rs571357048 485 dbSNP
rs536760417 494 dbSNP
rs1458257673 495 dbSNP
rs1390626647 505 dbSNP
rs1035314960 512 dbSNP
rs1378667515 517 dbSNP
rs184932784 525 dbSNP
rs1467433618 529 dbSNP
rs1427436159 531 dbSNP
rs1176460827 534 dbSNP
rs998869350 535 dbSNP
rs1020269576 561 dbSNP
rs1464426378 569 dbSNP
rs1026499237 574 dbSNP
rs573756240 581 dbSNP
rs978811178 585 dbSNP
rs531003966 591 dbSNP
rs1239245813 598 dbSNP
rs1200891775 605 dbSNP
rs925998849 614 dbSNP
rs1262086017 625 dbSNP
rs536408620 627 dbSNP
rs943414991 641 dbSNP
rs796283040 646 dbSNP
rs923231958 648 dbSNP
rs1377549826 660 dbSNP
rs552083132 674 dbSNP
rs1311246212 687 dbSNP
rs1450148898 694 dbSNP
rs1404227733 700 dbSNP
rs1388896449 708 dbSNP
rs1336264376 718 dbSNP
rs991252163 721 dbSNP
rs570698696 727 dbSNP
rs1156885807 729 dbSNP
rs892998671 730 dbSNP
rs771819651 734 dbSNP
rs113311223 744 dbSNP
rs918927650 745 dbSNP
rs1443124777 762 dbSNP
rs905781244 768 dbSNP
rs776907998 772 dbSNP
rs189829306 783 dbSNP
rs1198048265 785 dbSNP
rs1048767326 789 dbSNP
rs1489557570 801 dbSNP
rs537919085 808 dbSNP
rs1288022429 810 dbSNP
rs896789185 810 dbSNP
rs1431220464 814 dbSNP
rs1007335617 818 dbSNP
rs1172778733 824 dbSNP
rs151312608 839 dbSNP
rs993953816 849 dbSNP
rs1424198947 853 dbSNP
rs1039856921 858 dbSNP
rs952281786 864 dbSNP
rs1167841670 866 dbSNP
rs549875618 871 dbSNP
rs984923724 887 dbSNP
rs998438095 888 dbSNP
rs1020992549 895 dbSNP
rs903447742 896 dbSNP
rs1160925923 901 dbSNP
rs1423145620 906 dbSNP
rs545446097 915 dbSNP
rs1384930241 921 dbSNP
rs140546391 922 dbSNP
rs1032986172 923 dbSNP
rs1473607950 934 dbSNP
rs144047942 946 dbSNP
rs567889 947 dbSNP
rs867555391 948 dbSNP
rs368655022 949 dbSNP
rs971677146 950 dbSNP
rs988944790 953 dbSNP
rs1341628002 955 dbSNP
rs1218107471 966 dbSNP
rs561393899 971 dbSNP
rs1268601050 972 dbSNP
rs530272683 973 dbSNP
rs1399503558 979 dbSNP
rs1323581880 987 dbSNP
rs1222663973 988 dbSNP
rs914637377 1000 dbSNP
rs34215005 1004 dbSNP
rs1300593475 1005 dbSNP
rs146445217 1018 dbSNP
rs551723322 1028 dbSNP
rs1165978004 1029 dbSNP
rs984433707 1039 dbSNP
rs1166897737 1040 dbSNP
rs927080479 1040 dbSNP
rs1477414696 1053 dbSNP
rs938596460 1058 dbSNP
rs1196627164 1065 dbSNP
rs1490179143 1070 dbSNP
rs1247187638 1073 dbSNP
rs1057412025 1077 dbSNP
rs1435819396 1085 dbSNP
rs1271166799 1091 dbSNP
rs867617337 1101 dbSNP
rs560443248 1105 dbSNP
rs1318868650 1109 dbSNP
rs370171293 1113 dbSNP
rs896845485 1116 dbSNP
rs910246133 1120 dbSNP
rs140816182 1121 dbSNP
rs1347716742 1133 dbSNP
rs1423156691 1138 dbSNP
rs1040559377 1140 dbSNP
rs1300374712 1144 dbSNP
rs552421232 1146 dbSNP
rs1048183188 1150 dbSNP
rs1361742416 1154 dbSNP
rs1425294398 1167 dbSNP
rs1189216717 1170 dbSNP
rs1173691372 1172 dbSNP
rs1432055258 1176 dbSNP
rs1425819515 1190 dbSNP
rs773225208 1192 dbSNP
rs1192795100 1196 dbSNP
rs1400004414 1211 dbSNP
rs1479539900 1212 dbSNP
rs1268924766 1214 dbSNP
rs901335616 1215 dbSNP
rs888197735 1216 dbSNP
rs934112906 1219 dbSNP
rs1041895640 1220 dbSNP
rs1381498057 1223 dbSNP
rs1017741795 1236 dbSNP
rs565362064 1252 dbSNP
rs1311618759 1258 dbSNP
rs1302589675 1268 dbSNP
rs1221495673 1272 dbSNP
rs1371792226 1282 dbSNP
rs997748107 1286 dbSNP
rs1447935595 1287 dbSNP
rs1030992149 1289 dbSNP
rs1334235867 1290 dbSNP
rs528324506 1292 dbSNP
rs535067031 1301 dbSNP
rs1000422066 1315 dbSNP
rs914545162 1319 dbSNP
rs1218518953 1320 dbSNP
rs1032956466 1321 dbSNP
rs968801474 1329 dbSNP
rs894508571 1333 dbSNP
rs1179066512 1338 dbSNP
rs1286554540 1344 dbSNP
rs1013001066 1345 dbSNP
rs1024771987 1351 dbSNP
rs1441263637 1358 dbSNP
rs980156664 1376 dbSNP
rs971515016 1378 dbSNP
rs763049367 1381 dbSNP
rs1180266399 1383 dbSNP
rs766801457 1385 dbSNP
rs1483044508 1411 dbSNP
rs1487831828 1413 dbSNP
rs761790614 1417 dbSNP
rs1285885772 1419 dbSNP
rs1026172464 1423 dbSNP
rs1379507579 1431 dbSNP
rs938480103 1437 dbSNP
rs1057083995 1441 dbSNP
rs951925606 1479 dbSNP
rs144623058 1482 dbSNP
rs1180724862 1494 dbSNP
rs1359847030 1495 dbSNP
rs370678835 1496 dbSNP
rs1421291632 1498 dbSNP
rs943053106 1501 dbSNP
rs1186558281 1517 dbSNP
rs1423507722 1518 dbSNP
rs1441086072 1519 dbSNP
rs748754627 1519 dbSNP
rs572649402 1525 dbSNP
rs975774215 1532 dbSNP
rs1487323349 1546 dbSNP
rs1263124699 1550 dbSNP
rs11220176 1560 dbSNP
rs1006613036 1570 dbSNP
rs949295920 1596 dbSNP
rs1244492261 1597 dbSNP
rs1321991357 1603 dbSNP
rs1381387110 1608 dbSNP
rs1380040775 1618 dbSNP
rs550412202 1622 dbSNP
rs998090409 1636 dbSNP
rs1298268826 1637 dbSNP
rs1030458160 1638 dbSNP
rs770167851 1641 dbSNP
rs1361354186 1647 dbSNP
rs1042253999 1652 dbSNP
rs1448865039 1672 dbSNP
rs1369295606 1673 dbSNP
rs903384237 1678 dbSNP
rs1476886605 1679 dbSNP
rs1380667947 1684 dbSNP
rs567344136 1684 dbSNP
rs936244239 1686 dbSNP
rs138368921 1691 dbSNP
rs1489585943 1692 dbSNP
rs894732706 1696 dbSNP
rs1013300343 1701 dbSNP
rs1045744018 1704 dbSNP
rs907259154 1716 dbSNP
rs993621795 1717 dbSNP
rs568382140 1722 dbSNP
rs1026141402 1729 dbSNP
rs1242658815 1732 dbSNP
rs951896323 1733 dbSNP
rs553181272 1737 dbSNP
rs1266848410 1742 dbSNP
rs1352764643 1743 dbSNP
rs1316906472 1744 dbSNP
rs1278328639 1749 dbSNP
rs180885007 1751 dbSNP
rs1280681048 1752 dbSNP
rs1010459027 1753 dbSNP
rs1442876902 1758 dbSNP
rs1269270365 1763 dbSNP
rs1017491515 1770 dbSNP
rs964665283 1783 dbSNP
rs1387154327 1797 dbSNP
rs1392537814 1801 dbSNP
rs1208822841 1804 dbSNP
rs1296239259 1806 dbSNP
rs976124566 1808 dbSNP
rs968685585 1812 dbSNP
rs538949609 1817 dbSNP
rs1449106730 1819 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Disease WEE1;
Location of target site 3'UTR
Tools used in this research EIMMO , TargetScan
Original Description (Extracted from the article) ... "we 茂卢聛nd the following: mir-424 targets ANLN ...

- Forrest AR; Kanamori-Katayama M; Tomaru Y; et al., 2010, Leukemia.

Article - Forrest AR; Kanamori-Katayama M; Tomaru Y; et al.
- Leukemia, 2010
Acute myeloid leukemia (AML) involves a block in terminal differentiation of the myeloid lineage and uncontrolled proliferation of a progenitor state. Using phorbol myristate acetate (PMA), it is possible to overcome this block in THP-1 cells (an M5-AML containing the MLL-MLLT3 fusion), resulting in differentiation to an adherent monocytic phenotype. As part of FANTOM4, we used microarrays to identify 23 microRNAs that are regulated by PMA. We identify four PMA-induced microRNAs (mir-155, mir-222, mir-424 and mir-503) that when overexpressed cause cell-cycle arrest and partial differentiation and when used in combination induce additional changes not seen by any individual microRNA. We further characterize these pro-differentiative microRNAs and show that mir-155 and mir-222 induce G2 arrest and apoptosis, respectively. We find mir-424 and mir-503 are derived from a polycistronic precursor mir-424-503 that is under repression by the MLL-MLLT3 leukemogenic fusion. Both of these microRNAs directly target cell-cycle regulators and induce G1 cell-cycle arrest when overexpressed in THP-1. We also find that the pro-differentiative mir-424 and mir-503 downregulate the anti-differentiative mir-9 by targeting a site in its primary transcript. Our study highlights the combinatorial effects of multiple microRNAs within cellular systems.
LinkOut: [PMID: 19956200]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions SiHa , CaSki
Disease 1111.0
Location of target site 3'UTR
Tools used in this research miRecord , PicTar , TargetScan
Original Description (Extracted from the article) ... "Western blot analysis showed that transfection with miR-424 mimic significantly decreased the levels of Chk1 protein in both SiHa and CaSki cells// a significant reduction of luciferase activity was observed in SiHa cells with miR-424 transfection ...

- Xu J; Li Y; Wang F; Wang X; Cheng B; Ye F; et al., 2013, Oncogene.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aaguUUUGUACUUAACGACGAc 5'
              :||:||  | ||||||| 
Target 5' ugguGAAUAU--AGUGCUGCUa 3'
 		4 - 23
Article - Xu J; Li Y; Wang F; Wang X; Cheng B; Ye F; et al.
- Oncogene, 2013
MicroRNAs (miRNAs) act as important gene regulators in human genomes and their aberrant expression links to many malignancies. We previously identified a different characteristic miRNA expression profile in cervical cancer from that in cervical normal tissues, including the downregulated miR-424. However, the role and mechanism of miR-424 in cervical cancer still remain unknown. Here, we focused on identifying the tumor-suppressive function and clinical significance of miR-424 and exploring the mechanistic relevance by characterizing its target. We showed a significantly decreased expression of miR-424 in 147 cervical cancer tissues versus 74 cervical normal tissues by performing quantitative RT-PCR. In 147 cervical cancer tissue samples, low-level expression of miR-424 was positively correlated with poor tumor differentiation, advanced clinical stage, lymph node metastasis and other poor prognostic clinicopathological parameters. Further in vitro observations showed that enforced expression of miR-424 inhibited cell growth by both enhancing apoptosis and blocking G1/S transition, and suppressed cell migration and invasion in two human cervical cancer cell lines, SiHa and CaSki, implying that miR-424 functions as a tumor suppressor in the progression of cervical cancer. Interestingly, overexpression of miR-424 inhibited the expression of protein checkpoint kinase 1 (Chk1) and phosphorylated Chk1 (p-Chk1) at residues Ser345 and decreased the activity of luciferase-reporter containing the 3'-untranslated region (UTR) of Chk1 with predicted miR-424-binding site. Moreover, miR-424 expression levels were inversely correlated with Chk1 and p-Chk1 protein levels in both cervical cancer and normal tissues. Furthermore, RNAi-mediated knockdown of Chk1 decreased matrix metalloproteinase 9 expression and phenocopied the tumor suppressive effects of miR-424 in cell models. Taken together, our results identify a crucial tumor suppressive role of miR-424 in the progression of cervical cancer at least partly via upreglating the expression of Chk1 and p-Chk1, and suggest that miR-424 might be a candidate of prognostic predictor or an anticancer therapeutic target for cervical cancer patients.
LinkOut: [PMID: 22469983]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aaguUUUGUACUUAACGACGAc 5'
              :||:||  | ||||||| 
Target 5' ugguGAAUAU--AGUGCUGCUa 3'
 		6 - 25
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000534070.1 | 3UTR | AAUCCUGGUGAAUAUAGUGCUGCUAUGUUGACAUUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17498 Multiple myeloma 0.522 2.8e-4 0.509 4.0e-4 40 Click to see details
GSE28544 Breast cancer -0.415 2.2e-2 -0.363 4.1e-2 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.589 4.8e-2 0.583 5.0e-2 9 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.321 8.4e-2 0.755 6.0e-5 20 Click to see details
GSE19783 ER- ER- breast cancer -0.146 1.0e-1 -0.153 8.9e-2 79 Click to see details
GSE42095 Differentiated embryonic stem cells -0.268 1.1e-1 -0.263 1.1e-1 23 Click to see details
GSE32688 Pancreatic cancer 0.219 1.1e-1 -0.004 4.9e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.273 1.8e-1 -0.099 3.7e-1 13 Click to see details
GSE19536 Breast cancer -0.09 1.9e-1 -0.107 1.4e-1 100 Click to see details
GSE38226 Liver fibrosis -0.197 2.0e-1 0.121 3.0e-1 21 Click to see details
GSE21687 Ependynoma primary tumors 0.087 2.5e-1 -0.188 6.8e-2 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.142 2.5e-1 -0.086 3.4e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.17 2.6e-1 0.100 3.6e-1 16 Click to see details
GSE19350 CNS germ cell tumors -0.191 2.8e-1 -0.208 2.6e-1 12 Click to see details
GSE17306 Multiple myeloma 0.084 2.8e-1 0.131 1.8e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.057 3.0e-1 -0.148 8.2e-2 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.107 3.1e-1 0.387 2.8e-2 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.092 3.3e-1 0.206 1.6e-1 25 Click to see details
GSE21849 B cell lymphoma 0.047 4.0e-1 0.237 1.1e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.027 4.6e-1 -0.116 3.1e-1 20 Click to see details
GSE21032 Prostate cancer -0.003 4.9e-1 0.018 4.4e-1 83 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD 0.458 0 0.280 0.02 50 Click to see details
BRCA 0.26 0.01 0.229 0.02 84 Click to see details
STAD 0.419 0.01 0.467 0 32 Click to see details
LUSC 0.366 0.01 0.351 0.02 38 Click to see details
LIHC -0.286 0.02 -0.237 0.05 49 Click to see details
UCEC 0.436 0.03 0.442 0.03 19 Click to see details
BLCA 0.306 0.11 0.333 0.09 18 Click to see details
PCPG -0.934 0.12 -0.500 0.33 3 Click to see details
LUAD 0.263 0.2 0.091 0.39 12 Click to see details
PAAD -0.57 0.22 -0.400 0.3 4 Click to see details
ESCA 0.252 0.23 0.273 0.21 11 Click to see details
HNSC -0.101 0.26 -0.101 0.26 42 Click to see details
THCA -0.081 0.27 -0.091 0.25 59 Click to see details
CHOL 0.22 0.28 0.200 0.3 9 Click to see details
KIRC -0.066 0.3 -0.007 0.48 68 Click to see details
COAD -0.324 0.3 -0.200 0.37 5 Click to see details
KIRP 0.087 0.32 0.139 0.22 32 Click to see details
KICH -0.076 0.36 -0.305 0.07 25 Click to see details
KICH -0.076 0.36 -0.305 0.07 25 Click to see details
CESC 1 0.5 1.000 0.5 3 Click to see details
CESC 1 0.5 1.000 0.5 3 Click to see details
451 hsa-miR-424-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000653 CCNF cyclin F 2 1
MIRT000654 CDC14A cell division cycle 14A 2 1
MIRT000655 CDC25A cell division cycle 25A 4 3
MIRT000656 CHEK1 checkpoint kinase 1 5 4
MIRT000657 KIF23 kinesin family member 23 4 7
MIRT000658 ATF6 activating transcription factor 6 2 1
MIRT000659 WEE1 WEE1 G2 checkpoint kinase 6 7
MIRT000660 ANLN anillin actin binding protein 2 1
MIRT000696 PLAG1 PLAG1 zinc finger 6 10
MIRT000936 CCNE1 cyclin E1 6 7
MIRT000937 CCND3 cyclin D3 4 1
MIRT000938 CDK6 cyclin dependent kinase 6 6 3
MIRT000941 CCND1 cyclin D1 6 4
MIRT003225 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 1
MIRT003226 MAP2K1 mitogen-activated protein kinase kinase 1 4 2
MIRT003227 PIAS1 protein inhibitor of activated STAT 1 2 1
MIRT003228 FGFR1 fibroblast growth factor receptor 1 5 3
MIRT003928 NFIA nuclear factor I A 3 2
MIRT005886 MYB MYB proto-oncogene, transcription factor 3 2
MIRT005887 SIAH1 siah E3 ubiquitin protein ligase 1 3 1
MIRT005926 HIF1A hypoxia inducible factor 1 alpha subunit 5 1
MIRT005927 CUL2 cullin 2 5 1
MIRT005928 SPI1 Spi-1 proto-oncogene 5 1
MIRT042434 CCIN calicin 1 1
MIRT042435 TTC39A tetratricopeptide repeat domain 39A 1 1
MIRT042436 TMF1 TATA element modulatory factor 1 1 1
MIRT042437 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT042438 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT042439 IARS isoleucyl-tRNA synthetase 1 1
MIRT042440 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT042441 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 3
MIRT042442 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT042443 MAGED1 MAGE family member D1 1 1
MIRT042444 CNIH4 cornichon family AMPA receptor auxiliary protein 4 1 1
MIRT042445 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT042446 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT042447 BAZ2B bromodomain adjacent to zinc finger domain 2B 1 1
MIRT042448 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT042449 ANKRD17 ankyrin repeat domain 17 1 1
MIRT042450 RBM4B RNA binding motif protein 4B 1 1
MIRT042451 LAMTOR4 late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 1 1
MIRT042452 TRAP1 TNF receptor associated protein 1 1 1
MIRT042453 SCOC short coiled-coil protein 1 1
MIRT042454 SACS sacsin molecular chaperone 1 1
MIRT042455 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT042456 TBPL1 TATA-box binding protein like 1 2 3
MIRT042457 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT042458 GTF2A1 general transcription factor IIA subunit 1 1 1
MIRT053106 FASN fatty acid synthase 4 5
MIRT053149 SOCS6 suppressor of cytokine signaling 6 2 1
MIRT053379 CDX2 caudal type homeobox 2 3 1
MIRT055427 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT055818 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057518 CEP55 centrosomal protein 55 2 8
MIRT057737 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT061008 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061250 AMOTL1 angiomotin like 1 2 12
MIRT064689 CCND2 cyclin D2 2 4
MIRT065719 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066297 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066316 USP15 ubiquitin specific peptidase 15 2 2
MIRT071212 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072826 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 4
MIRT074534 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075256 SNTB2 syntrophin beta 2 2 4
MIRT075278 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075897 C16ORF72 chromosome 16 open reading frame 72 2 6
MIRT076796 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT078287 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT079659 NAPG NSF attachment protein gamma 2 12
MIRT080016 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082989 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083270 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084466 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT086013 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087428 ZNRF3 zinc and ring finger 3 2 2
MIRT087559 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT089112 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089212 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT091674 RARB retinoic acid receptor beta 2 6
MIRT093688 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT096239 CANX calnexin 2 2
MIRT100211 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100369 HSPA1B heat shock protein family A (Hsp70) member 1B 2 6
MIRT100572 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100741 VEGFA vascular endothelial growth factor A 2 12
MIRT100900 CD2AP CD2 associated protein 2 2
MIRT102441 CALU calumenin 2 2
MIRT102636 UBN2 ubinuclein 2 2 10
MIRT102974 EN2 engrailed homeobox 2 2 6
MIRT103097 MAFK MAF bZIP transcription factor K 2 4
MIRT103859 FOXK1 forkhead box K1 2 2
MIRT104020 USP42 ubiquitin specific peptidase 42 2 6
MIRT104236 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106300 ZFHX4 zinc finger homeobox 4 2 6
MIRT106737 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT107222 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT107689 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT109245 ZNF275 zinc finger protein 275 2 2
MIRT110057 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 5 7
MIRT112976 LUZP1 leucine zipper protein 1 2 6
MIRT114929 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117660 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120684 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT127740 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT133776 SKI SKI proto-oncogene 2 2
MIRT140152 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142247 DCTN5 dynactin subunit 5 2 8
MIRT152287 TNFSF9 TNF superfamily member 9 2 2
MIRT154054 RASSF2 Ras association domain family member 2 2 2
MIRT156468 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158533 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT165183 GRAMD3 GRAM domain containing 2B 2 2
MIRT165904 CREBRF CREB3 regulatory factor 2 2
MIRT175237 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT179014 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180914 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186375 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189764 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189965 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT190188 GPR180 G protein-coupled receptor 180 2 6
MIRT191460 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191629 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194242 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194909 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196457 TAOK1 TAO kinase 1 2 2
MIRT201460 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204597 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204628 MOB4 MOB family member 4, phocein 2 8
MIRT204744 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206023 NUP50 nucleoporin 50 2 6
MIRT211201 FGF2 fibroblast growth factor 2 5 5
MIRT211317 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212611 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT223695 FZD6 frizzled class receptor 6 2 6
MIRT224969 BAG4 BCL2 associated athanogene 4 2 2
MIRT229350 ZNF449 zinc finger protein 449 2 2
MIRT229864 YIPF6 Yip1 domain family member 6 2 2
MIRT234346 MSL1 male specific lethal 1 homolog 2 8
MIRT247241 ELK4 ELK4, ETS transcription factor 2 4
MIRT247371 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248769 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249453 ZNF691 zinc finger protein 691 2 4
MIRT251497 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255339 SRPRB SRP receptor beta subunit 2 4
MIRT256311 CDC42SE2 CDC42 small effector 2 2 2
MIRT258414 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265059 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT267532 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270556 SETD1B SET domain containing 1B 2 2
MIRT273669 HOXC8 homeobox C8 2 2
MIRT274745 RAB3IP RAB3A interacting protein 2 2
MIRT277509 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282538 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT289635 CBX2 chromobox 2 2 2
MIRT294287 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295815 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297782 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300110 STRADB STE20-related kinase adaptor beta 2 2
MIRT300998 MTMR3 myotubularin related protein 3 2 2
MIRT302619 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302829 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307145 CTDSPL CTD small phosphatase like 2 4
MIRT313679 ITGA2 integrin subunit alpha 2 2 2
MIRT314055 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317725 PPIL1 peptidylprolyl isomerase like 1 2 6
MIRT319335 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320631 ZNRF2 zinc and ring finger 2 2 2
MIRT326306 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327967 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT367269 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT438750 PTCH1 patched 1 1 1
MIRT443811 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446504 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447774 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448443 TLL1 tolloid like 1 2 2
MIRT449186 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451835 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453284 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453750 CSNK1E casein kinase 1 epsilon 2 2
MIRT454966 TPM2 tropomyosin 2 2 2
MIRT456863 ZNF460 zinc finger protein 460 2 10
MIRT460220 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460434 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461560 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463168 ZNF367 zinc finger protein 367 2 10
MIRT464666 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464752 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 2
MIRT465167 TSC22D2 TSC22 domain family member 2 2 2
MIRT465566 TOB2 transducer of ERBB2, 2 2 2
MIRT465930 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466009 TMEM189 transmembrane protein 189 2 8
MIRT466294 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466433 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466920 STK38 serine/threonine kinase 38 2 10
MIRT466998 SSRP1 structure specific recognition protein 1 2 4
MIRT468055 SIK1 salt inducible kinase 1 2 2
MIRT468147 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468673 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469086 RNF168 ring finger protein 168 2 2
MIRT469411 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471035 PISD phosphatidylserine decarboxylase 2 10
MIRT471492 PDE4D phosphodiesterase 4D 2 4
MIRT471952 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472269 NFIC nuclear factor I C 2 2
MIRT472661 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474314 LAMC1 laminin subunit gamma 1 2 2
MIRT474829 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475065 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475119 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475535 HOXA3 homeobox A3 4 8
MIRT475716 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475841 HDGF heparin binding growth factor 2 4
MIRT476256 GNB1 G protein subunit beta 1 2 6
MIRT476273 GNAL G protein subunit alpha L 2 6
MIRT476696 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477561 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477845 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478908 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479989 CARD10 caspase recruitment domain family member 10 2 2
MIRT481185 AVL9 AVL9 cell migration associated 2 6
MIRT482117 AKT3 AKT serine/threonine kinase 3 5 4
MIRT482373 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482553 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482578 ABHD2 abhydrolase domain containing 2 2 2
MIRT484774 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485216 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487390 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492711 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494353 CASKIN1 CASK interacting protein 1 2 2
MIRT495143 ZNRF1 zinc and ring finger 1 2 2
MIRT496015 CD180 CD180 molecule 2 2
MIRT497772 KIAA0895 KIAA0895 2 2
MIRT498980 ORC4 origin recognition complex subunit 4 2 8
MIRT499452 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499616 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500093 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500324 ZNF622 zinc finger protein 622 2 8
MIRT500422 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500576 USP53 ubiquitin specific peptidase 53 2 2
MIRT500864 SYPL1 synaptophysin like 1 2 8
MIRT500935 SRPR SRP receptor alpha subunit 2 6
MIRT500949 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501088 SMAD7 SMAD family member 7 5 9
MIRT501502 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502036 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502148 KIF5B kinesin family member 5B 2 8
MIRT502498 FAM122B family with sequence similarity 122B 2 8
MIRT502571 E2F7 E2F transcription factor 7 2 10
MIRT502646 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502919 CDCA4 cell division cycle associated 4 2 8
MIRT502948 CDC37L1 cell division cycle 37 like 1 2 8
MIRT503143 ATG9A autophagy related 9A 2 6
MIRT504334 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504536 ZNF620 zinc finger protein 620 2 6
MIRT504852 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505114 YTHDC1 YTH domain containing 1 2 6
MIRT505346 TMEM245 transmembrane protein 245 2 6
MIRT505396 TMEM100 transmembrane protein 100 2 2
MIRT505502 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505546 SNX16 sorting nexin 16 2 6
MIRT505690 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505908 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505926 RCAN3 RCAN family member 3 2 4
MIRT506108 PPIG peptidylprolyl isomerase G 2 6
MIRT506139 PLRG1 pleiotropic regulator 1 2 4
MIRT506192 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506486 MYO5A myosin VA 2 6
MIRT506999 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507819 CDK1 cyclin dependent kinase 1 2 6
MIRT507850 CCNE2 cyclin E2 2 6
MIRT507882 CBX6 chromobox 6 2 2
MIRT508036 AXIN2 axin 2 2 6
MIRT508641 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509364 DMPK DM1 protein kinase 2 11
MIRT509690 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510043 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511845 GPATCH8 G-patch domain containing 8 2 4
MIRT512285 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT512642 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT513856 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514022 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 4
MIRT514043 ATG14 autophagy related 14 2 2
MIRT518091 TRIM35 tripartite motif containing 35 2 2
MIRT518530 FLCN folliculin 2 6
MIRT518994 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521056 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521203 SBNO1 strawberry notch homolog 1 2 6
MIRT521814 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522100 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT522775 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537817 EFNB2 ephrin B2 2 4
MIRT539899 RPL14 ribosomal protein L14 2 4
MIRT540843 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541216 HOXA10 homeobox A10 2 2
MIRT541434 CBX4 chromobox 4 2 2
MIRT542808 PHC3 polyhomeotic homolog 3 2 2
MIRT542836 PDCD1 programmed cell death 1 2 7
MIRT543059 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543079 APP amyloid beta precursor protein 2 2
MIRT543306 ZNF585B zinc finger protein 585B 2 2
MIRT543408 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543525 PRSS21 protease, serine 21 2 2
MIRT543797 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543835 GSG1 germ cell associated 1 2 2
MIRT544571 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544589 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544912 CLSPN claspin 2 2
MIRT544965 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545186 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545347 CCDC83 coiled-coil domain containing 83 2 2
MIRT545682 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545959 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT546114 USP48 ubiquitin specific peptidase 48 2 4
MIRT546610 SALL1 spalt like transcription factor 1 2 4
MIRT546623 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546639 RTN4 reticulon 4 2 2
MIRT547132 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547234 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547306 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT547411 MKX mohawk homeobox 2 2
MIRT547462 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547549 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547663 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547700 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547970 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT547996 HCFC2 host cell factor C2 2 4
MIRT548015 GRB2 growth factor receptor bound protein 2 2 4
MIRT548223 FKBP1A FK506 binding protein 1A 2 2
MIRT548273 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548729 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548806 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548949 CDK17 cyclin dependent kinase 17 2 2
MIRT549074 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549121 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549276 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT549390 AMOT angiomotin 2 2
MIRT550402 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550466 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550615 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550823 FAM229B family with sequence similarity 229 member B 2 2
MIRT551379 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551617 ZNF267 zinc finger protein 267 2 2
MIRT551737 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552035 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552344 ZNF704 zinc finger protein 704 2 2
MIRT552749 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553439 TPM3 tropomyosin 3 2 2
MIRT553561 TMEM161B transmembrane protein 161B 2 2
MIRT553618 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553772 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553809 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554700 RNF149 ring finger protein 149 2 2
MIRT554962 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555032 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555142 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555225 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555275 PRDM4 PR/SET domain 4 2 2
MIRT555432 PPAP2B phospholipid phosphatase 3 2 2
MIRT556387 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556855 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557281 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557480 GPR27 G protein-coupled receptor 27 2 4
MIRT558037 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558507 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558589 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558662 CNKSR3 CNKSR family member 3 2 2
MIRT559011 CA8 carbonic anhydrase 8 2 2
MIRT559158 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559531 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT560852 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561149 KRT33B keratin 33B 2 2
MIRT561400 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561874 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562027 LANCL1 LanC like 1 2 2
MIRT562201 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562877 KIAA1456 KIAA1456 2 2
MIRT563086 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563503 DLGAP3 DLG associated protein 3 2 2
MIRT563701 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563845 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563896 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564332 CCNT1 cyclin T1 2 2
MIRT564478 ZNF391 zinc finger protein 391 2 2
MIRT564552 CCDC80 coiled-coil domain containing 80 2 2
MIRT564836 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564950 XKR7 XK related 7 2 2
MIRT564989 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565044 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565401 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566120 RASEF RAS and EF-hand domain containing 2 2
MIRT566650 NCKAP1 NCK associated protein 1 2 2
MIRT566831 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567021 KLHL15 kelch like family member 15 2 2
MIRT567446 GNG12 G protein subunit gamma 12 2 2
MIRT567477 FZD9 frizzled class receptor 9 2 2
MIRT568021 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568142 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568474 ARMC12 armadillo repeat containing 12 2 2
MIRT568574 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568625 ACVR2A activin A receptor type 2A 5 3
MIRT570466 TLK1 tousled like kinase 1 2 2
MIRT571119 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571283 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571428 RIF1 replication timing regulatory factor 1 2 2
MIRT571660 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571828 PHF19 PHD finger protein 19 2 2
MIRT571928 LSM11 LSM11, U7 small nuclear RNA associated 2 2
MIRT574057 PROSC pyridoxal phosphate binding protein 2 2
MIRT574202 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574539 PDIA6 protein disulfide isomerase family A member 6 2 4
MIRT574594 N4BP1 NEDD4 binding protein 1 2 2
MIRT575882 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575924 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576099 Pdcd1 programmed cell death 1 2 5
MIRT576591 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614698 TRAK1 trafficking kinesin protein 1 2 2
MIRT616467 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618896 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT621498 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640538 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645510 BSPRY B-box and SPRY domain containing 2 2
MIRT646595 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648784 KLHL40 kelch like family member 40 2 2
MIRT655812 NOTCH2 notch 2 2 2
MIRT658793 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659256 CUL3 cullin 3 2 2
MIRT680982 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682285 RS1 retinoschisin 1 2 2
MIRT682514 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691709 FLOT2 flotillin 2 2 2
MIRT693930 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701506 NEGR1 neuronal growth regulator 1 2 2
MIRT702092 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702877 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713419 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714438 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716432 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717461 ADORA3 adenosine A3 receptor 2 2
MIRT720149 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725132 SYNRG synergin gamma 2 2
MIRT731524 SOCS2 suppressor of cytokine signaling 2 1 1
MIRT731954 KDM5B lysine demethylase 5B 1 1
MIRT732455 LINC00922 long intergenic non-protein coding RNA 922 2 0
MIRT734001 BFAR bifunctional apoptosis regulator 3 0
MIRT734203 APLNR apelin receptor 3 0
MIRT734275 APLN apelin 3 0
MIRT735229 KCNQ1OT1 KCNQ1 opposite strand/antisense transcript 1 (non-protein coding) 0 0
MIRT737161 LINC00324 long intergenic non-protein coding RNA 324 1 0
MIRT737429 CADM1 cell adhesion molecule 1 2 0
MIRT756449 NUAK1 NUAK family kinase 1 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-424 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-424 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-424 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-424 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-424 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-424 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-424 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-424 Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 down-regulated
miR-424 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-424 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC-7901)
hsa-mir-424 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-424 Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-424 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-424 Methotrexate 126941 NSC740 approved resistant cell line (W1)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-424 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-424 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-424 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-424 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (SGC-7901)
hsa-mir-424 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-424-5p (-)-huprine y 54608866 NSC720262 resistant
hsa-miR-424-5p (-)7,8-dihydrocalanolide a 383107 NSC682400 sensitive
hsa-miR-424-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 resistant
hsa-miR-424-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 resistant
hsa-miR-424-5p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-424-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-424-5p (5R,5aS)-5-[2-(dimethylamino)ethoxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 371049 NSC644945 sensitive
hsa-miR-424-5p (5s,5as)-5-[3-(dimethylamino)propylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 375034 NSC653860 sensitive
hsa-miR-424-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 resistant
hsa-miR-424-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-fluorophenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351427 NSC670226 resistant
hsa-miR-424-5p (z)-3-iodo-1,2-diphenyl-2-propen-1-one 5468683 NSC674454 resistant
hsa-miR-424-5p [1-[(2-bromo-5-hydroxy-4-methoxyphenyl)methyl]spiro[1,3,4,5,7,8-hexahydroisoquinoline-6,2'-1,3-dioxolane]-2-yl]-cyclobutylmethanone 401792 NSC715522 resistant
hsa-miR-424-5p [2-[[3-(3-aminopropoxy)naphthalene-2-carbonyl]amino]-5-chlorophenyl] 3-(3-aminopropoxy)naphthalene-2-carboxylate;hydrochloride 54613723 NSC751300 resistant
hsa-miR-424-5p [4-fluoro-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] butanoate 380992 NSC666869 sensitive
hsa-miR-424-5p 1-(2-hydroxybenzoyl)-3-methyl-4-(4-methoxybenzylidene)-1h-pyrazole-5(4h)-one 5351408 NSC652174 sensitive
hsa-miR-424-5p 1-(5,8-dimethyl-6-nitro-9h-carbazol-3-yl)ethanone hydrazone 6078917 NSC652561 sensitive
hsa-miR-424-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-424-5p 1-[(z)-(5-chloro-2-hydroxyphenyl)methylideneamino]-3-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]urea 135408530 NSC48238 resistant
hsa-miR-424-5p 1-[5-[(e)-2-[4-(dimethylamino)phenyl]ethenyl]-6-methyl-1,2,4-triazin-3-yl]-6-hydroxy-3-phenyl-2-sulfanylidenepyrimidin-4-one 6412312 NSC698031 resistant
hsa-miR-424-5p 1-[8-(3-methoxyphenyl)-6,7-dimethyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]pyrrolidine 382365 NSC669884 resistant
hsa-miR-424-5p 10,11-methylenedioxycamptothecin 72403 NSC634724 sensitive
hsa-miR-424-5p 15-[2-(dimethylamino)ethyl]-10-[2-(2-hydroxyethylamino)ethylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392057 NSC691849 sensitive
hsa-miR-424-5p 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethyl-methylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione 392571 NSC693118 sensitive
hsa-miR-424-5p 2-(2-ethyl-6-propan-2-ylanilino)-3-(4-methylpyridin-1-ium-1-yl)naphthalene-1,4-dione;perchlorate 24202023 NSC618659 sensitive
hsa-miR-424-5p 2-(dipentylamino)-1-(1,2,3,4-tetrahydrophenanthren-9-yl)ethanol;hydrochloride 24181846 NSC62485 resistant
hsa-miR-424-5p 2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-n-[2-[[4-[2-[[2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-2-(sulfanylmethylamino)acetyl]amino]ethylamino]-5,8-dihydroxy-9,10-dioxoanthracen- 438971 NSC692228 sensitive
hsa-miR-424-5p 2-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]pentanedioic acid 135402053 NSC327182 sensitive
hsa-miR-424-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 sensitive
hsa-miR-424-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-424-5p 2-[3-[1-(4-chlorophenyl)-1-methyl-3-oxo-isoindolin-2-yl]propyl]isoindoline-1,3-dione 395648 NSC700430 resistant
hsa-miR-424-5p 2-amino-6-(benzylamino)-4-(2-chlorophenyl)pyridine-3,5-dicarbonitrile 24205132 NSC734396 sensitive
hsa-miR-424-5p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 resistant
hsa-miR-424-5p 2-chloro-3-phenoxy-1,4-naphthoquinone NSC1507 resistant
hsa-miR-424-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-424-5p 2-methoxy-5,7,8,13,13a,14-hexahydroisoquino[3,2-b][3]benzazepine 392606 NSC693146 resistant
hsa-miR-424-5p 2-phenyl-3a,3b,4,5,6,7,8,8a,13,13b-decahydro-1h-cyclohepta[c]pyrrolo[3,4-a]carbazole-1,3(2h)-dione 362439 NSC626388 sensitive
hsa-miR-424-5p 2-thienyl-[3-(thiophene-2-carbonyl)-2-thioxo-imidazolidin-1-yl]methanone 396758 NSC703468 sensitive
hsa-miR-424-5p 2,2,2-trifluoro-N-[3-[naphthalen-2-ylmethyl-[4-[naphthalen-2-ylmethyl-[3-[(2,2,2-trifluoroacetyl)amino]propyl]amino]butyl]amino]propyl]acetamide 389638 NSC685981 resistant
hsa-miR-424-5p 2,4-quinazolinediamine, 6,6'-thiobis- 393413 NSC695267 sensitive
hsa-miR-424-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-424-5p 20-[3-(1,4-diazepan-1-yl)propyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaene-11,19-dione;hydrochloride 45027855 NSC728319 sensitive
hsa-miR-424-5p 3-[(4-chlorophenyl)methyl]-4-[(e)-(3-methoxyphenyl)methylideneamino]-1h-1,2,4-triazol-5-one 9556356 NSC698065 sensitive
hsa-miR-424-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-424-5p 3-amino-N-(4-benzylphenyl)-5-chloroindazole-1-carboxamide 51033073 NSC749550 resistant
hsa-miR-424-5p 4'-(9-acridinylamino)sulfanilanilide, monohydrochloride 148802 NSC140701 sensitive
hsa-miR-424-5p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 resistant
hsa-miR-424-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(4-fluorophenyl)benzamide 1194957 NSC732830 sensitive
hsa-miR-424-5p 4-[[3-[(4-carbamimidoylphenoxy)methyl]phenyl]methoxy]benzenecarboximidamide;hydrochloride 24203365 NSC727667 sensitive
hsa-miR-424-5p 4-[6-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]hexyl]benzenesulfonyl fluoride;ethanesulfonic acid 280526 NSC132279 sensitive
hsa-miR-424-5p 4-amino-8-chloro-2-(4-methoxyphenyl)iminopyrimido[2,1-b][1,3]benzothiazole-3-carbonitrile 45029232 NSC745677 resistant
hsa-miR-424-5p 4-n-(7-chloro-3-phenylquinolin-4-yl)-1-n,1-n-diethylpentane-1,4-diamine;hydroiodide 24182056 NSC13477 resistant
hsa-miR-424-5p 4-n-(7-chloroquinolin-4-yl)-1-n-cyclohexylcyclohexane-1,4-diamine NSC3618 resistant
hsa-miR-424-5p 5-(3-phenyl-3-oxo-1-propynyl)pyrimidine-2,4(1h,3h)-dione 359098 NSC619674 sensitive
hsa-miR-424-5p 5-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1h-pyrazole 49865894 NSC748404 resistant
hsa-miR-424-5p 5-[(E)-2-(5-ethyl-1-methylpyridin-1-ium-2-yl)ethenyl]quinolin-8-ol;iodide 135534376 NSC79543 sensitive
hsa-miR-424-5p 5-amino-2-(4-chloroanilino)-1,3-thiazole-4-carbonitrile 367981 NSC638199 sensitive
hsa-miR-424-5p 5-phenyl-2,3-bis(2-thienyl)thiophene 395510 NSC700200 resistant
hsa-miR-424-5p 6-[2-[2-[2-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]ethylamino]ethylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027880 NSC730870 sensitive
hsa-miR-424-5p 6-[2-[3-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]propylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027847 NSC728087 sensitive
hsa-miR-424-5p 6-[3-[(4-fluorophenyl)methoxy]phenyl]-5-(2-methylsulfonylpyrimidin-4-yl)imidazo[2,1-b][1,3]thiazole 155811287 NSC763232 resistant
hsa-miR-424-5p 6-chloro-1-[2-[ethyl-(2-hydroxy-2-methylpropyl)amino]ethylamino]-4-methylthioxanthen-9-one;hydrochloride 24182355 NSC15795 resistant
hsa-miR-424-5p 6-chloro-9-[4-(4-methylphenoxy)-5-[(4-methylphenoxy)methyl]oxolan-2-yl]purine 389530 NSC685827 resistant
hsa-miR-424-5p 7-phenyl-5h-pyrazolo[3,4-e][1,2,4]triazin-3-ylamine 6399307 NSC629487 sensitive
hsa-miR-424-5p 7h-5,6-dithioleno[4,3-d]uracil 388876 NSC684074 sensitive
hsa-miR-424-5p 9,10-anthracenedione, 1-[(oxiranylmethyl)amino]- 384119 NSC673348 sensitive
hsa-miR-424-5p 9.beta.-d-arabinofuranosyl-2-chloroadenine 235481 NSC76356 sensitive
hsa-miR-424-5p Acetylmarinobufogenin 282302 NSC135687 sensitive
hsa-miR-424-5p Aclarubicin 308141 NSC208734 sensitive
hsa-miR-424-5p Acovenoside b 272418 NSC116789 sensitive
hsa-miR-424-5p Anthraquinone, 1-hydroxy-4-[p-(2-hydroxyethyl)anilino]- 291365 NSC156565 resistant
hsa-miR-424-5p Arq monoacetate 385441 NSC676676 sensitive
hsa-miR-424-5p Azane;dichloroplatinum;2-(3,4-dimethoxyphenyl)ethanamine 498557 NSC631304 sensitive
hsa-miR-424-5p Azq 42616 NSC182986 sensitive
hsa-miR-424-5p Bafilomycin deriv 5385089 NSC381866 resistant
hsa-miR-424-5p Benzene, 1,1'-(1,2-ethanediyl)bis[2,5-dimethoxy- 297389 NSC168516 resistant
hsa-miR-424-5p Betuletol 5459196 NSC641548 sensitive
hsa-miR-424-5p Bialamicol 10304 NSC6386 resistant
hsa-miR-424-5p Biantrazole 54607781 NSC357885 sensitive
hsa-miR-424-5p Bn-2629 393111 NSC694501 sensitive
hsa-miR-424-5p Calactin 30100 NSC650471 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-424-5p Camptothecin 24360 NSC94600 sensitive
hsa-miR-424-5p Camptothecin 24360 NSC94600 sensitive
hsa-miR-424-5p Cardenolide 2 388098 NSC682561 sensitive
hsa-miR-424-5p Ci-921: amsacrine derivative 157348 NSC343499 sensitive
hsa-miR-424-5p Cladribine 1546 NSC105014 sensitive
hsa-miR-424-5p Digitoxigenin glycoside NSC267713 sensitive
hsa-miR-424-5p Digoxin 2724385 NSC95100 approved sensitive
hsa-miR-424-5p Dimethyl (Z)-2-(2,3,4,6,8-pentamethylazulen-1-yl)but-2-enedioate 5468314 NSC668419 resistant
hsa-miR-424-5p Echujetin 274159 NSC407806 sensitive
hsa-miR-424-5p Fagaronine chloride 40304 NSC157995 sensitive
hsa-miR-424-5p Faradiol 397486 NSC705534 sensitive
hsa-miR-424-5p Ferric-taxol 54612932 NSC749908 resistant
hsa-miR-424-5p Fludarabine 657237 NSC118218 approved sensitive
hsa-miR-424-5p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 resistant
hsa-miR-424-5p Gw876790x 25023715 NSC756413 resistant
hsa-miR-424-5p Homohalichondrin b 6711269 NSC609394 resistant
hsa-miR-424-5p Hopeaphenol 495605 NSC661748 resistant
hsa-miR-424-5p Irinotecan 60838 NSC728073 approved sensitive
hsa-miR-424-5p Irinotecan 60838 NSC728073 approved sensitive
hsa-miR-424-5p Isopinnatal 390665 NSC688277 sensitive
hsa-miR-424-5p Lmp-400 11533060 NSC724998 sensitive
hsa-miR-424-5p Lunatin 5351204 NSC89671 resistant
hsa-miR-424-5p M-amsa 148674 NSC154948 sensitive
hsa-miR-424-5p Melphalan 460612 NSC8806 approved sensitive
hsa-miR-424-5p Merophan 9571 NSC57199 sensitive
hsa-miR-424-5p Methyl (2s)-2-[[4-[[[(e)-2-methyl-3-phenylprop-2-enoyl]amino]methyl]benzoyl]amino]-4-methylsulfanylbutanoate 5470461 NSC702106 resistant
hsa-miR-424-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-424-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-424-5p N-((3-benzoyl-2-thioxo-1-imidazolidinyl)carbothioyl)-n-phenylbenzamide 396960 NSC704180 sensitive
hsa-miR-424-5p N-(3,5-dimethoxybenzyl)-4-methoxyaniline 364713 NSC631371 resistant
hsa-miR-424-5p N-[(5s,8ar,9r)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]-3-cyanobenzamide 369926 NSC642293 sensitive
hsa-miR-424-5p N-[4-[[[2-(4-chloroanilino)pyridine-3-carbonyl]amino]sulfamoyl]phenyl]acetamide 16126694 NSC737147 resistant
hsa-miR-424-5p N-[bis(aziridin-1-yl)phosphoryl]adamantan-1-amine 64376 NSC166199 sensitive
hsa-miR-424-5p N,n-bis{[(4-chlorophenyl)sulfanyl]methyl}-4-methylaniline 248767 NSC66211 sensitive
hsa-miR-424-5p Navan 941650 NSC108165 resistant
hsa-miR-424-5p Ncs-665564 380161 NSC665564 sensitive
hsa-miR-424-5p Neriifolin 276293 NSC123976 sensitive
hsa-miR-424-5p NSC623283 NSC623283 sensitive
hsa-miR-424-5p NSC763857 NSC763857 resistant
hsa-miR-424-5p Oxanthrazole 59916 NSC349174 sensitive
hsa-miR-424-5p Pcnu 26328 NSC95466 sensitive
hsa-miR-424-5p Phenylbenzophenone 407452 NSC5639 resistant
hsa-miR-424-5p S-(6-oxo-1,3,5-triphenyl-2-thioxo-1,2,3,6-tetrahydro-4-pyrimidinyl) 4-methoxybenzenecarbothioate 383063 NSC671107 sensitive
hsa-miR-424-5p S-(dimethylarsino)-3-mercapto-1,2-propanediol 406475 NSC724596 sensitive
hsa-miR-424-5p Stk716556 342450 NSC379399 resistant
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved resistant
hsa-miR-424-5p Tetramethyl (1R,5R,6S,9S)-3-(4-chlorobenzoyl)oxy-5-hydroxy-7-[2-(trifluoromethyl)phenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 24204894 NSC733348 sensitive
hsa-miR-424-5p Thevetin 5458241 NSC123979 sensitive
hsa-miR-424-5p Toddalin 5351594 NSC76023 resistant
hsa-miR-424-5p Topotecan 60699 NSC609699 approved sensitive
hsa-miR-424-5p Topotecan 60699 NSC609699 approved sensitive
hsa-miR-424-5p Venenatine 272417 NSC116787 sensitive
hsa-miR-424-5p Yoshi 864 18949 NSC102627 sensitive
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Docetaxel 148124 NSC628503 approved resistant High Non-Small Cell Lung Cancer cell line (SPC-A1)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant High Leukemia cell line (K562)
hsa-miR-424-5p 10-Hydroxycamptothecin 97226 NSC107124 sensitive High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SUIT-2, CAPAN-1)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Germ Cell Tumor cell line (NTERA-2)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive Low Epidermoid Carcinoma cell line (KB-3-1, KB-CP.5, KB-CP20)
hsa-miR-424-5p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-424-5p Etoposide 36462 NSC141540 approved resistant Low melanoma tissue and cell line (A375)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved resistant Low Colorectal Cancer tissue and cell line (HCT-116)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-424-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-424-5p Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT-8)
hsa-miR-424-5p Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-424-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-424-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR20
hsa-miR-424-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-424-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-424-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-424-5p Trail sensitive Low Acute Myeloid Leukemia tissue and cell line (HL-60, K562, NB4)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (ID8)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer tissue and cell line
hsa-miR-424-5p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-424-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-424-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant Low Bladder Cancer cell line (5637, J82, BIU87, T24)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive High Bladder Cancer cell line (CDDP-R-BOY, CDDP-R-T24)
hsa-miR-424-5p Taxol 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-424-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-424-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer cell line (HT-29)
hsa-miR-424-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-424-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKVO3ip1)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-424-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-424-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-424-5p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-424-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-424-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-424-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-424-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-424-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-424-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-424-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR1)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-424-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-424-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-424-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-424-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)
hsa-miR-424-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission